PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

Tamanho: px
Começar a partir da página:

Download "PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva"

Transcrição

1 PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva

2 Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in vitro de cadeias de DNA. Em poucos anos, o sequenciamento e a síntese de oligonucleotídeos tornaram-se rotina nos laboratórios de pesquisa; Karl Mullis (1983) Técnica de PCR polymerase chain reaction possibilita a amplificação in vitro de ácidos nucléicos. O advento da PCR acelerou os estudos de genomas de vários organismos, pois possibilitou a clonagem e o sequenciamento de DNA. Karl Mullis (1987) Patenteou a técnica e vendeu para a empresa Hoffmann-La Roche em 1991.

3 Kary Mullis 1983 (Prêmio Nobel 1993)

4 Princípios da técnica de PCR Síntese enzimática in vitro de cópias de DNA a partir da seqüência alvo; A especificidade é dada pelo uso de primers (iniciadores) específicos para o gene ou região do DNA de interesse; A utilização de dois primers delimitam o alvo e a repetição dos ciclos da PCR dá origem a bilhões de cópias do alvo.

5 Amplificação de seqüências pela Reação em cadeia da polimerase (PCR) Uma DNA polimerase resiste a temperatura, a Taq polimerase, da bactéria Thermus aquaticus é usada para catalisar o crescimento a partir de primers de DNA. Pares de primers em filamentos opostos são ampliados um em cada direção ao outro. Após o término da replicação do segmento entre dois primer (um ciclo), dois novos dúplices são desnaturados por aquecimento unifilamentares. para gerar moldes

6 Etapas da PCR 1) Desnaturação abertura da dupla fita do DNA (94 C/100 C) 2) Anelamento (hibridização) dos primers em T C mais baixa 3) Reação de polimerização (síntese) da fita complementar pela Taq DNA polimerase Repetição por 30 a 40 ciclos animação

7 Reação de PCR em Termociclador

8 Eletroforese em gel de agarose visualização dos amplicons (fragmentos amplificados)

9 Variações da PCR RT-PCR Nested-PCR PCR Multiplex RAPD (Random Amplified Polymorphic DNA) Real time PCR ( PCR em tempo real)

10 RT PCR Reverse Transcriptase Polymerase Chain Reaction

11 RT PCR

12 RT PCR

13 Cycle threshold Limiar da fase exponencial

14 Fluoróforos: absorvem e emitem luz em λ específico

15 Taq-Man (Fluoróforo + Quencher)

16 Taq-Man

17 Molecular Beacon : primers em estrutura secundária Diferentes cores

18 Marcadores moleculares Marcador molecular é todo e qualquer fenótipo molecular oriundo de um gene expresso (como em isoenzimas) ou de um segmento específico de DNA (expresso ou não). Marcadores genéticos são unidades herdáveis Quando o comportamento do marcador segue as leis de herança de Mendel (quando analisado o seu comportamento em uma população segregante), ele pode adicionalmente ser definido como um marcador genético.

19 A molécula de DNA sofre alterações (mutações). As mutações são mais toleradas quando acontecem em regiões nãocodificantes, e as mutações tornam-se estáveis, sendo transmitidas aos seus descentes. Como é muito grande a variação no número e no tipo de mutações estáveis do DNA fenômeno conhecido como polimorfismo genético é possível identificar uma pessoa com base no seu padrão de polimorfismo. Para reconhecer os locos (sítios) onde ocorrem essas mutações, há diferentes técnicas. marcadores cromossoma

20 Origem do Polimorfismo Molecular 1. Mutações pontuais - SNPs A. ATCTCGTGATTCCTAGTCGTA TAGAGCACTAAGGGATCAGCAT B. ATCTCGTGATTATAGTCGTA TAGAGCACTAATATCAGCAT ex. Sítio EcoRI 2. Pequenas deleções e/ou inserções - InDels A. ATCTCGTCTAGTCGTA TAGAGCAGATCAGCAT B. ATCTCGT---GTCGTA TAGAGCA---CAGCAT

21 Classificação de Marcadores Moleculares

22 Marcadores de DNA (moleculares) Vantagens: - Não é objeto de influências ambientais; - Potencialmente ilimitado em número; Desvantagem: Maior desvantagem é a necessidade de técnicas e equipamentos mais complexos.

23 Marcadores moleculares Hibridação RFLP (Restriction Fragment Length Polymorphism) Minissatélites VNTR (Variable Number of Tandem Repeats) Amplificação de DNA (Técnica de PCR) RAPD (Random Amplified Polymorphic DNA) SCAR (Sequence Characterized Amplified Regions) Microssatélites SSR (Simple Sequence Repeats) AFLP (Amplified Fragment Length Polymorphism) - SNPs (Single Nucleotide Polymorphism)

24 RFLP - Restriction Fragment Length Polymorphism RFLP examina diferença em tamanho de fragmentos de restrição de DNA específicos Polimorfismo deriva de mutação pontual, inserção, deleção Utiliza-se DNA celular total Requer DNA puro de alto peso molecular

25 Polimorfismo evidenciado pela fragmentação do DNA com enzimas de restrição e observado pela hibridização de sondas marcadas de DNA (Southern blots) com radioatividade ou compostos que desencadeiam uma reação luminescência. Para que o polimorfismo seja detectado, é necessário que as seqüências de nucleotídeos nas fitas de DNA de dois ou mais indivíduos comparados sejam distintas.

26 Metodologia de RFLP 1. Digerir DNA em fragmentos pequenos 2. Separação dos fragmentos por gel eletroforese 3. Transferência de fragmentos de DNA para filtro

27 Metodologia de RFLP 4. Visualização dos fragmentos de DNA sondas marcadas (32P) ou a frio 5. Análise dos resultados bandas analisadas para alelos e/ou presença/ausência diferenças em padrão de bandas reflete diferenças genéticas A escolha de sonda/enzima de restrição é crucial

28 Digestão de DNA Genômico e Separação em Gel digestão 2 3 DNA Separação em gel

29 Eletroforese

30 Transferência para Membrana de Nylon ou Nitrocelulose

31 MARCAÇÃO DA SONDA (EX.: MATERIAL RADIOATIVO [32P] γatp,[32p] αdntp)

32 Hibridização com sondas radioativas em Nylon ou Nitrocelulose

33 Exposição em filme de Raios-X Hibridização com sonda marcada

34 Aplicação dos RFLPs na medicina forense

35 Interpretação de resultados Sítio alvo para sonda 6 Sítio de restrição Inserção

36 Marcador RFLP na anemia falciforme

37 Análise de Diversidade e Filogenia por RFLP A B C Kb A B C

38 RAPD - Random Polymorphic DNA Amplificação Randômica de DNA Polimórfico Utiliza um único primer ao invés de um par de primers. O primer único tem seqüência arbitrária, e portanto sua seqüência alvo é desconhecida. Uma característica fundamental dos marcadores RAPD é o fato deles se comportarem como marcadores dominantes. Dominância do ponto de vista da interpretação relativa entre genótipo e fenótipo de um indivíduo. Embora a grande maioria dos marcadores RAPD possuam comportamento "dominante", existe a possibilidade de se amplificar marcadores co-dominantes, ou seja, amplificar ambos os alelos de um loco.

39 Características do RAPD: Obtenção de "fingerprinters' (impressões digitais) genômicos de indivíduos, variedades e populações. Análise estrutural e diversidade genética em populações de melhoramento e bancos de germoplasma. Estabelecimento de relacionamentos filogenéticos entre diferentes espécies. Construção de mapas genéticos de alta cobertura genômica econômico. e a localização de genes de interesse

40 Base genética dos marcadores RAPD

41 - escada 100 pb - E. acervulina - E. tenella - E. maxima - E. praecox - E. mitis - E. brunetti - E. necatrix - Conrrole RAPD inter-específico de Eimeria 600 pb - J-20

42 VNTR - Variable Number of Tandem Repeats Número variável de repetições seriadas Características do VNTR: Seqüências repetitivas agrupadas ou espalhadas ao longo do genoma. São constituídas por blocos cujo número de unidades repetitivas é variável, gerando polimorfismos. Blocos de unidades repetitivas formadas por 1 a 4 pb no locus hipervariável são conhecidas como microssatélites. Unidades de 5 a cerca de 100 pb são denominadas minissatélites.

43 Características do VNTR: São observados através de digestões do DNA genômico seguidas de ensaios de Southern blot com sondas homólogas às regiões do minissatélite. Obtém-se um padrão de múltiplas bandas devido ao caráter multilocus. Os padrões de múltiplas bandas constituem os chamados DNA fingerprints e permitem discriminar indivíduos e estabelecer graus de parentesco e consangüinidade.

44 Características do VNTR: São obtidos através de PCR de loci específicos. Cada "ilha" microssatélite, independente do elemento repetido (CA, TG, ATG etc.) constitui um loco genético altamente variável, multialélico, de grande conteúdo informativo. A análise de vários loci permite estabelecer relações de paternidade e identificação personalizada, através dos alelos encontrados nos indivíduos. Não requerem Southern blots. A análise consiste no PCR de vários loci, eletroforese em gel e interpretação.

45

46 Vantagens e limitações dos marcadores microssatélites A expressão co-dominante e o multialeslismo, os marcadores SSR (seqüências simples repetidas = microssatélites) são os que possuem o mais elevado conteúdo de informações de polimorfismo na terminologia de marcadores moleculares. Os SSR são muito mais freqüentes e distribuídos ao acaso, permitindo a mais completa cobertura de qualquer genoma eucarioto. A maior limitação da tecnologia microssatélite é a grande quantidade de trabalho necessário para o desenvolvimento prévio dos marcadores.

47 Modelos Eletroforese em gel Análise de casos moleculares Seminários

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Genética Molecular Técnicas aplicadas a produção animal

Genética Molecular Técnicas aplicadas a produção animal MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA PROGRAMA DE PÓS-GRADUAÇÃO EM ZOOTECNIA Genética Molecular Técnicas aplicadas a produção

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA O O uso uso deste deste material material é é autorizado autorizado desde desde que que sejam sejam atribuídos atribuídos os os direitos direitos

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Aula DNA Forense. Arthur Estivalet Svidzinski

Aula DNA Forense. Arthur Estivalet Svidzinski Aula DNA Forense Arthur Estivalet Svidzinski Odontologia. 1. Perícia odonto-legal, peritos, documentos médicos, laudos periciais, modelos e interpretação, ética odontológica. 2. Perícia odontológica nos

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel 1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel Quadrado de Punnet Segregação fenotípica 3/4 Preto 1/4 marron

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

Os exames. de DNA nos tribunais

Os exames. de DNA nos tribunais Avanços científicos ocorridos nas últimas décadas alteraram as investigações policiais: se antes as impressões digitais e outras pistas eram usadas para desvendar os crimes, hoje pode-se extrair DNA de

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA Biotecnologia O que é isso??? É qualquer técnica que utilize organismos vivos ou suas partes, para fazer ou modificar produtos, melhorar plantas ou animais

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM)

RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM) RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM) DUARTE J.M., PACHECO C.A.P., CARNEIRO N.P., GUIMARÃES C.T., GUIMARÃES

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis Natália Sanches Xavier (PIBIC/CNPq-FA-UEM), Rosilene Fressatti Cardoso

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA Reação em Cadeia de Polimerase IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA MsC. Ingrid Thaís Beltrame Botelho doutoranda ingridthaisbb@hotmail.com O que é PCR? Amplificação de um segmento específico

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Mutações somáticas x Mutações germinativas Tipos de mutações MUTAÇÃO GENÔMICA:

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Investigação de paternidade na ausência do suposto pai. Paternity testing father is absent

Investigação de paternidade na ausência do suposto pai. Paternity testing father is absent Saúde, Ética & Justiça, 5/7(1-2):6-11, 2000-2002. Investigação de paternidade na ausência do suposto pai Paternity testing father is absent Silvia O. SAMPAIO 1 ; J.R.R. PINHO 2 ; C.B. GRANJA 3 ; A.C. GOLDBERG

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D e-mail:melmenezes@dnanalise.com.br DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais