DNA A molécula da vida. Prof. Biel Série: 9º ano

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "DNA A molécula da vida. Prof. Biel Série: 9º ano"


1 DNA A molécula da vida Prof. Biel Série: 9º ano

2 DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação genética dos indivíduos.

3 DNA FINGER-PRINTING No genoma humano existem sequências de DNA repetitivas que são reconhecidas e cortadas por determinadas enzimas de restrição. Estas enzimas dividem o DNA em fragmentos cujas dimensões e composição de nucleotídeos variam de pessoa para pessoa e refletem as diferenças entre os alelos. Diferentes fragmentos de DNA movimentam-se de modo diferente quando submetidos a eletroforese (técnica em que determinadas moléculas são sujeitas à ação de um campo elétrico num meio poroso) e o resultado é um padrão de bandas que difere de indivíduo para indivíduo.



6 Composição dos seres vivos Moléculas inorgânicas.

7 Composição dos seres vivos Moléculas orgânicas. 1) Não específicas: carboidratos e lipídios. 2) Específicas: proteínas e ácidos nucleicos.

8 Ácidos nucleicos Macromoléculas formadas por subunidades repetidas: os nucleotídeos. Ácido desoxirribonucleico: DNA. Ácido ribonucleico: RNA. Nucleotídeo: formados por três componentes, um grupo fosfato (ácido), uma pentose e uma base nitrogenada.

9 Nucleotídeos do DNA Grupo fosfato. Pentose: carboidrato de cinco carbonos. DNA: Desoxirribose. Bases nitrogenadas: RNA: Ribose. Adenina (A) Timina (T) Citosina (C) Guanina (G)

10 DNA Helicoidal 1953 Watson e Crick (segredo da vida). Descobrem a estrutura de dupla-hélice do DNA. Notamos que o pareamento específico que postulamos sugere um possível mecanismo de cópia para o material genético.

11 Estrutura do DNA É um ácido nucleico formado por duas cadeias de nucleotídeos antiparalelas dispostas helicoidalmente. As duas cadeias são unidas através de pontes de hidrogênio entre as bases nitrogenadas.

12 DNA


14 Pareamento de bases



17 Replicação do DNA Processo semiconsevativo.

18 Replicação do DNA

19 Replicação do DNA

20 Replicação do DNA

21 Função da replicação

22 DNA no núcleo celular Um cromossomo : uma molécula de DNA. Genoma: o conjunto de cromossomos de uma dada espécie. Genoma Humano: 46 cromossomos: 44 CROMOSSOMOS AUTOSSÔMICOS (22 pares). 2 CROMOSSOMAS SEXUAIS (XX ou XY). Total: 6 x 10 9 pares de nucleotídeos.

23 Diferenciação celular

24 Controle das características hereditárias

25 Cromossomo

26 Gene

27 Gene

28 Resumindo

29 Material genético Hereditariedade. Variabilidade.

30 Fecundação

31 Variabilidade genética

32 DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação genética dos indivíduos.

33 DNA FINGER-PRINTING No genoma humano existem sequências de DNA repetitivas que são reconhecidas e cortadas por determinadas enzimas de restrição. Estas enzimas dividem o DNA em fragmentos cujas dimensões e composição de nucleotídeos variam de pessoa para pessoa e refletem as diferenças entre os alelos. Diferentes fragmentos de DNA movimentam-se de modo diferente quando submetidos a eletroforese (técnica em que determinadas moléculas são sujeitas à ação de um campo elétrico num meio poroso) e o resultado é um padrão de bandas que difere de indivíduo para indivíduo.

34 Sequências repetitivas Exemplos de sequências: Repetição de 1 base: GTAAAAAAAAAAAAAAAGGAT Repetição de 2 bases: GTCACACACACACACACAGGAT Repetição de 3 bases: GTCACCACCACCACCACCACGGAT Repetição de 4 bases: GTCAGACAGACAGACAGAGGAT

35 DNA FINGER-PRINTING 1) Coleta de amostras biológicas que podem ser saliva, sangue, esperma e cabelo com raiz, entre outros. 2) Extração e purificação do DNA. 3) Corte com enzimas de restrição (tesouras moleculares que reconhecem e cortam sequências específicas do DNA). 4) Eletroforese: onde, através de uma corrente elétrica, são separados os fragmentos de DNA por tamanho. A partir daí, é formada uma espécie de código de barras que é a identificação individual e intransferível de cada indivíduo.

36 Enzimas de restrição.

37 Eletroforese





42 DNA FINGER-PRINTING Com base no estudo de uma bateria de sequências repetitivas, é possível obter perfis genéticos específicos, muito úteis na investigação de paternidade, identificação de vítimas e criminosos

43 Teste de paternidade

44 Teste de paternidade

45 Teste de paternidade

46 Criminalística (CSI)

47 Polymerase Chain Reaction (PCR)

48 Criminalística

49 Obrigado

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais


GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais


COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais


2014 - PRISE I GABARITO SUGERIDO E COMENTADO 014 - PRISE I PORTUGUÊS 1 - C - B 3 - D 4 - C 5 - A 6 - B 7 - C LITERATURA 8 - C 9 E 10 - B 11 A 1 - B 13 C 14 B HISTÓRIA 15 - A 16 C 17 - E 1º Lugar do Brasil no ENEM 01 Colégio Elite Belém e Vila Dos

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Biologia Professor Vianna 1ª série / 1º trimestre

Biologia Professor Vianna 1ª série / 1º trimestre Biologia Professor Vianna 1ª série / 1º trimestre Módulo 3 ÁCIDOS NUCLEICOS E CITOLOGIA 1 Os itens abaixo referem-se à estrutura, composição e função dos ácidos nucleicos. Estrutura: I) Dupla hélice; II)

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Atividade prática Quem é o pai? Quem é o criminoso?

Atividade prática Quem é o pai? Quem é o criminoso? Aluno: nº Atividade prática Quem é o pai? Quem é o criminoso? OBJETIVOS Compreender a importância prática da Engenharia Genética na identificação das pessoas. Conhecer os princípios básicos da manipulação

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais


GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais


BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais


16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down)

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Aplicações: IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Mapeamento genético e identificação: mapeamento de genes

Leia mais

Núcleo e Divisões Celulares

Núcleo e Divisões Celulares UNIDADE 2 ORIGEM DA VIDA E BIOLOGIA CELULAR CAPÍTULO 10 Aula 1 Núcleo: estrutura e composição Cromossomos, genes e DNA 1. NÚCLEO: NÚMERO E FORMA Células eucarióticas Cromossomos DNA + proteínas (histonas)

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais


DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais


GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais


DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP 1. (Fuvest 2014) Observe a figura abaixo, que representa o emparelhamento de duas bases nitrogenadas. 3. (Unesp 2013) Em 2012, assim como em anos anteriores, o Ministério da Saúde promoveu a campanha para

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais


ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA ESTRUTURA DO DNA E ORGANIZAÇAO DA CROMATINA ATIVIDADE BIOLÓGICA 1 Qual é a natureza química da molécula responsável por estocar a informação genética??? CARACTERÍSTICAS 1. Estocar a informação e transmitir

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais


CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

DNA. Dados relevantes para a compreensão da sua estrutura.

DNA. Dados relevantes para a compreensão da sua estrutura. DN Dados relevantes para a compreensão da sua estrutura. DN: dados relevantes para a compreensão da sua estrutura. Em 1950, Erwin hargaff, ao estudar amostras de DN de diversas espécies, constatou que

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a):

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): Trabalho de Recuperação Data: / /15 1. O sistema endócrino é formado por glândulas endócrinas e de secreção

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais


SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII Título do Podcast Área Segmento Duração Por que você se parece com sua avó? A genética vai ajudá-lo a entender como isso é possível! Ciências Ciências da Natureza

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

Aula 2 Unidades fundamentais dos ácidos nucléicos

Aula 2 Unidades fundamentais dos ácidos nucléicos Biologia Molecular Básica Módulo I Básico Aula 2 Unidades fundamentais dos ácidos nucléicos Prezado professor, nesta aula você vai estudar os nucleotídeos que formam os blocos constituintes dos ácidos

Leia mais

A Estrutura da molécula de DNA. Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular

A Estrutura da molécula de DNA. Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular Page 1 of 5 A Estrutura da molécula de DNA Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular Em 1869, o bioquímico suíço Friedtich Mieschner aventou pela primeira vez

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos 01 - (IBMEC RJ) O núcleo celular foi descoberto pelo pesquisador escocês Robert Brown, que o reconheceu como componente fundamental das células. O nome escolhido para essa organela expressa bem essa ideia:

Leia mais

A base molecular da vida Constituintes da matéria-viva

A base molecular da vida Constituintes da matéria-viva A base molecular da vida Constituintes da matéria-viva Principais elementos químicos dos seres vivos Quando se analisa a matéria-viva que constitui os seres vivos, encontram-se principalmente os seguintes

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798)

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798) Ácidos Nucleicos MO640A - Biologia Computacional Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia Grandes Eventos da Genética 1865 Genes são elementos particulados 1871 Descoberta dos

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial)

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial) São moléculas formadas por unidades complexas chamadas nucleotídeos. Cada nucleotídeo é um grupamento molecular formado por três subunidades: uma base nitrogenada, uma pentose e um grupamento fosfato.

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais


ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais


NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 Introdução a Biologia i Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Corpo Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Ácidos nucleicos. Disponível em: <http://carmelourso.files.wordpress.com/2011/08/3d-dna-cover.jpg>. Acesso em: 21 fev

Ácidos nucleicos. Disponível em: <http://carmelourso.files.wordpress.com/2011/08/3d-dna-cover.jpg>. Acesso em: 21 fev Ácidos nucleicos Ácidos nucleicos Disponível em: . Acesso em: 21 fev. 2012. Núcleo celular Define as características morfofisiológicas da

Leia mais



Leia mais

Projeto Genoma Humano. Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira.

Projeto Genoma Humano. Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira. Projeto Genoma Humano Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira. Instituição: Faculdade Alfredo Nasser Email: kellyguedes@hotmail.com.br Palavra chave ( projeto genoma humano,

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais