Aula DNA Forense. Arthur Estivalet Svidzinski

Tamanho: px
Começar a partir da página:

Download "Aula DNA Forense. Arthur Estivalet Svidzinski"

Transcrição

1 Aula DNA Forense Arthur Estivalet Svidzinski

2 Odontologia. 1. Perícia odonto-legal, peritos, documentos médicos, laudos periciais, modelos e interpretação, ética odontológica. 2. Perícia odontológica nos foros civil, penal, trabalhista e administrativo. 3. Documentação odontológica. 4. Marcas de mordidas: metodologias de coleta e estudo comparativo. 5. Crimes de lesões corporais: art. 129 do CPB e as perícias odontológicas das lesões do aparelho estomatogmático. 6. Os arcos dentários na identificação. 7. Estimativa do sexo, idade e estatura por meio do estudo dos dentes. 8. Biotipologia. 9. Técnicas de identificação utilizando o DNA. 10. Técnicas de biologia molecular: técnica de PCR, PCR em tempo real, eletroforese, sequenciamento de DNA. 11. Traumatologia forense: energias de ordem mecânica, energias de ordem física, energias de ordem química, energias de ordem físico-química. 12. Estimativa de sexo, estatura, idade, fenótipo, cor da pele, por meio do estudo do crânio. 13. Noções de tanatologia. 14. Sexologia forense: estupro e atentado violento ao pudor.

3 9. Técnicas de identificação utilizando o DNA. 10. Técnicas de biologia molecular: técnica de PCR, PCR em tempo real, eletroforese, sequenciamento de DNA.

4 1.3. Biologia Molecular: transcrição, tradução, replicação, mutação, recombinação e reparo do DNA, expressão gênica Técnicas de Biologia Molecular: técnica de PCR, PCR em tempo real, eletroforese, sequenciamento de DNA; técnicas de identificação usando o DNA Genética e genética de populações: teorema de Hardy-Weinberg, estrutura de populações, análise filogenética, padrões de herança genética, seleção natural, mutação, deriva, fluxo gênico.

5 Mendel

6 Watson e Crick

7

8 Bases Nitrogenadas

9 Bases Nitrogenadas

10

11

12 Genética Conceitos básicos Gene Sequência de DNA que codifica uma proteína Somente aproximadamente 1,5% do genoma humano é codificador

13 Genética Conceitos básicos E os outros 98,5%? O DNA não codificante é composto principalmente de sequências altamente repetitivas e aos poucos as suas funções vão sendo descobertas Por exmplo, as sequencias Alu e L1 representam 28% do genoma humano

14 Genética Conceitos básicos Tamanho do genoma de diferentes organismos Organismo Tamanho em pb Virus Fago ƛ 5,2 mil Escherichia coli 4,7 milhões Homo sapiens 3,2 bilhões Amoeba proteus 670 bilhões

15 Genética Conceitos básicos Número de cromossomos de diferentes organismos Organismo Número de cromossomos Drosófila 8 Minhoca 32 Homem 46 Borboleta 380

16 Genética Conceitos básicos No início do projeto genoma acreditava-se que o genoma humano codificava algo em torno de 100 a 120 mil genes. Hoje sabe-se que esse número não passa de 20 a 30 mil genes

17 Genética Conceitos básicos Cromossomos homólogos: Cromossomos que formam um par em espécies diplóides. Um homólogo é de origem materna e outro paterna

18 Genética Conceitos básicos Alelo Uma das versões de um mesmo gene Exemplo: Sistema ABO Alelos: IA, IB e i

19 Genética Conceitos básicos Genótipo: Conjunto de informações genéticas de um indivíduo Fenótipo: Conjunto de manifestações físicas relacionadas a essas informações

20 Genética Conceitos básicos Homozigose: Quando o indivíduo apresenta os alelos iguais: AA, ii, XX Heterozigose: Quando o indivíduo apresenta dois alelos diferentes: Aa, I Ai, XY

21 Genética Conceitos básicos

22 Genética Conceitos básicos Exemplo Genótipo Fenótipo IA IA Sangue tipo A IA i Sangue tipo A IA IB Sangue tipo AB ii Sangue tipo O

23 Genética Conceitos básicos Cruzamentos: Avaliação dos possíveis genótipos dos descendentes a partir do genótipo dos seus genitores.

24 Genética Conceitos básicos

25 A respeito da natureza química e da funcionalidade do DNA, julgue os itens subseqüentes: - O conteúdo informacional do DNA reside na seqüência em que suas unidades monoméricas estão ordenadas. - Espécimes de DNA isolados de diferentes tecidos da mesma pessoa possuem a mesma composição de bases. - Durante a desnaturação do DNA são quebradas as ligações covalentes presentes em sua estrutura. - Nas moléculas de DNA dos eucariotos, a ocorrência das bases G + C é aproximadamente igual à de T + A.

26 Reação de PCR Polimerase Chain Reaction Método de amplificação de DNA invitro

27 Ciclo Celular

28

29

30 Reação de PCR Utilizada em situações em que é preciso trabalhar com quantidades muito pequenas de DNA Amplifica sequências específicas de DNA Processo realizado em vários ciclos

31 Reação de PCR DNA a ser amplificado Primers Forward e Reverse dntps Nucleotídeos DNA Polimerase

32 Reação de PCR Primers: Iniciadores da duplicação de DNA

33 Reação de PCR Polimerase: Duplica uma fita simples de DNA Necessita de uma sequência iniciadora

34 Reação de PCR Taq Polimerase: Enzima polimerase do micro-organismo Thermus aquaticus Temperatura de duplicação de 70 a 72ºC Adiciona uma adenina ao final da duplicação da sequência de DNA

35 Reação de PCR

36 Reação de PCR 1ª Fase: Aquecimento a mais de 90ºC para a separação da dupla fita Separa tanto a Fita de DNA original quanto os produtos de amplificação

37 Reação de PCR

38 Reação de PCR 2ª Fase: Anelamento dos primers Hibridização Temperatura varia entre 40 a 70ºC conforme o par de primers Determina a especificidade da ligação

39 Reação de PCR

40 Reação de PCR 3ª Fase: Extensão dos primers Duplicação do DNA Temperatura ótima em torno de 72ºC

41 Reação de PCR

42 Reação de PCR

43 Reação de PCR

44 Reação de PCR Ao final da reação, a quantidade de DNA amplificado em relação ao DNA inicial é igual a 2n, sendo que n= número de ciclos da PCR Exemplo: PCR de 29 ciclos: 229= cópias para cada fita original

45 Reação de PCR

46 Reação de PCR Efeito Plateau: desvio da quantidade teórica Perda da atividade da Polimerase Acúmulo de inibidores Limitação dos componentes Competição entre produtos Pareamento Produto x Molde, Competição com anelamento do primer

47 Reação de PCR

48 Em uma investigação de estupro seguido de morte, na tentativa de identificação do criminoso por meio da técnica de reação em cadeia da polimerase (PCR), os investigadores coletaram material junto ao corpo da vítima. A respeito desse assunto, julgue os itens seguintes: - Sangue, cabelo e sêmen encontrados no local do crime constituem material com potencial para fornecimento de DNA para a realização da técnica de PCR. - A técnica de PCR possibilita a clonagem de seqüências específicas de DNA, de forma rápida, numerosa e sem a necessidade de uma célula viva. - Por ser bastante simples, a técnica de PCR dispensa o uso de luvas descartáveis, reagentes e soluções de alta qualidade ou micropipetas de uso exclusivo. - Independentemente da técnica de PCR, a presença de espermatozóides do criminoso em esfregaço vaginal da vítima de estupro possibilita a identificação inequívoca deste. - Além da molécula de DNA, o RNA também pode ser usado como molde original para a técnica de PCR.

49 Genética Forense Ramo da genética humana voltada para questões legais

50 Genética Forense Identificação Humana através do DNA Estabelecimento de vínculo genético

51 Genética Forense Quem é a vítima? Quem é o pai dessa criança? A quem pertence a mancha de sangue deixada em um local de crime? Quem deixou os espermatozóides no corpo da vítima?

52 Genética Forense Aplicações de DNA para fins forenses Justiça Cívil: Testes de paternidade Justiça Criminal: Identificação humana, crimes sexuais, crimes contra a vida, crimes contro o patrimônio, desastres de massa.

53 Perito Criminal - Polícia Federal 2004 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médicolegal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por alguma razão, o juiz determine a realização de perícia de caracteres dos arcos dentários, o que somente será possível se existirem caracteres teratológicos ou doenças de transmissão genética dominante no campo bucodentário, como a síndrome de Gorlin, que é hereditária autossômica dominante, com alta penetrância e expressividade variável.

54 Genética Forense Identificação Humana Necessidade do ser humano desde antiguidade Caracteres morfológicos Tatuagens Fotografias Impressões digitais Marcadores genéticos

55 Genética Forense Histórico Alec Jeffreys: Descobriu que o DNA apresentava regiões altamente repetitivas. Essas repetições variavam de indivíduo para indivíduo DNA fingerprint

56 Genética Forense

57 Genética Forense Polimorfismo Acúmulo de mutações durante diversas gerações Gerou sequências hipervariáveis no DNA humano não codificante Utilizadas para a diferenciação de indivíduos

58 Impressões digitais e outras pistas coletadas em cenas de crimes estão cedendo espaço para as análises de DNA nas investigações policiais. O DNA extraído de fios de cabelo, de pequenas amostras de sangue ou da saliva permite descobrir a identidade de criminosos. Ciência Hoje, n.º 169, mar./2001 (com adaptações). Tendo o texto acima como referência inicial e considerando as técnicas para identificação com base em ácidos nucléicos e os conceitos moleculares e genéticos a elas relacionados, julgue os itens a seguir: - Apesar de a identificação com a utilização de DNA ser um método bastante específico, algumas características genéticas, como o polimorfismo, são obstáculos a esse método. - A existência de quantidades restritas de amostra para identificação com base no DNA não inviabiliza o processo, pois técnicas como a de PCR amplificam a quantidade de ácidos nucléicos presentes.

59 Genética Forense DNA fingerprint Perfil de DNA obtido através da técnica de RFLP (restriction fragment length polymorphism) Utilizava enzimas de restrição para clivar a sequência de DNA, produzindo um padrão de fragmentos diferente em cada indivíduo

60 Genética Forense

61 Genética Forense

62 Genética Forense

63 Genética Forense

64 Genética Forense

65 Genética Forense

66 Genética Forense Em 1983 e 1986 duas mulheres foram estupradas e mortas em Narborough, Inglaterra Um homem confessou a autoria dos crimes, mas o seu perfil não batia com o sangue e o sêmen encontrados Exames de DNA em massa foram realizados com todos os homens do vilarejo (5.000 pessoas) mas o autor não foi encontrado

67 Genética Forense Aproximadamente 1 ano depois uma mulher ouviu em um bar um homem comentando que havia doado sangue no lugar do seu amigo Colin Pitchfork. O perfil deste homem era idêntico ao encontrado nos locais de crime. Foi o primeiro caso de condenação baseado em um exame de DNA

68 Genética Forense

69 Genética Forense Desvantagens Técnica muito demorada e trabalhosa Necessita de grande quantidade de DNA Dificuldade genéticos em se estabelecer Análise de misturas inviável vínculos

70 Genética Forense STRs Short Tandem Repeat Marcadores de DNA utilizados na genética forense atualmente

71 Genética Forense

72 Genética Forense STRs São pequenas sequências de DNA (2 a 8 bases) que se repetem inúmeras vezes. A quantidade de repetições da sequência varia de um indivíduo para o outro

73 Genética Forense Exemplo: Marcador X Alelo 1: AGCTAATCGATCGATCGATCGATCGATCGATCGGTGCA Alelo 2: AGCTAATCGATCGATCGATCGATCGATCGATCGATCGGT GCA

74 Genética Forense Marcador X Alelo 1: 7 repetições Alelo 2: 8 repetições Marcador X 7 8

75 Genética Forense Mãe Pai Criança

76 Genética Forense STRs Possuem um grande poder de diferenciação entre indivíduos e apresentam um tempo de análise relativamente rápido Possibilitam a análise de mais de um marcador ao mesmo tempo - Multiplex

77 Genética Forense Reação de PCR Multiplex É uma reação de PCR em que são amplificados diversos fragmentos do DNA de interesse ao invés de apenas um

78 Genética Forense Alelo Mãe Criança Suposto Pai TH TPOX D5S D7S D18S CSF1PO FGA vwa Amelog. X X X X X Y

79 Genética Forense STRs Sequências de 4 e 5 repetições são amplificadas facilmente e sofrem menos com degradação de DNA e amplificação diferencial Fazem parte de uma classe de marcadores geneicos chamados de microssatélites

80 Genética Forense

81 Genética Forense

82 Genética Forense

83 Genética Forense

84 Genética Forense

85 Genética Forense Amelogenina: Gene que codifica proteínas presentes no esmalte do dente. No cromossomo X um íntron desse gene apresenta uma deleção de 6 bp, o que não acontece no cromossomo Y.

86 A análise de DNA teve sua primeira aplicação no contexto criminal em 1986 e, desde então, tem experimentado um enorme desenvolvimento, caracterizando-se como uma especialidade das ciências forenses. A esse respeito, julgue os itens a seguir. - De forma geral, as regiões codificantes do genoma humano são altamente polimórficas. - As repetições curtas em tandem (STR) fazem parte de uma classe de marcadores que reúne características altamente desejáveis na identificação humana. - Quando comparados aos marcadores genéticos, alguns marcadores protéicos polimórficos têm expressão tecido-específica e, conseqüentemente, aplicação limitada a algumas categorias de material biológico. - Os marcadores de DNA, quando comparados aos marcadores convencionais, possibilitam a identificação de vestígios em elevado estado de putrefação ou submetidos a altas temperaturas.

87 Rotina de DNA forense Processos, reagentes e equipamentos na rotina de um laboratório de DNA forense

88 Rotina de DNA forense Tudo começa fora do laboratório Coleta das amostras

89 Rotina de DNA forense A coleta das amostras é importantíssima para a qualidade do resultado final

90 Rotina de DNA forense Origens diversas: Local de crime Vítimas Suspeitos Roupas e objetos Partes em um processo

91 Rotina de DNA forense Materiais biológicos mais utilizados coletados em pessoas vivas: Sangue Swab mucosa oral Pelos

92 O modelo do DNA, proposto em 1953, por Watson e Crick, com base na seqüência linear de nucleotídeos, rendeu a seus autores o Prêmio Nobel em É graças ao DNA que cada pessoa é caracterizada como um indivíduo singular. Com base nos estudos sobre o DNA, julgue os itens que se seguem: - Somente a partir da década de 80 do século XX, o DNA passou a ser usado legalmente para justificar uma condenação. - As principais técnicas laboratoriais usadas para comparar e avaliar fragmentos de material de DNA são as análises de polimorfismo de comprimento dos fragmentos de restrição (RFLP) e a reação em cadeia da polimerase (PCR). - Freqüentemente, os tecidos moles da cavidade bucal são boas fontes de DNA. Entretanto, a saliva não pode ser usada como fonte para estudo do DNA, por ser destituída de células, ao contrário dos tecidos bucais.

93 Rotina de DNA forense Materiais biológicos mais utilizados coletados em cadáveres: Sangue Swab mucosa bexiga Músculo e Cartilagem Ossos e dentes

94 Rotina de DNA forense Materiais biológicos coletados de suportes: Roupas Projétil Armas Cigarro Veículo

95 Rotina de DNA forense Coleta e conservação: Os vestígios encontrados em locais de crime devem ser corretamente coletados, preservados, transportados e armazenados antes de serem examinados em laboratório

96 Rotina de DNA forense Cadeia de custódia: É um processo usado para manter e documentar a história cronológica de um vestígio, desde a sua coleta em um local de crime até o resultado final dos exames

97 Rotina de DNA forense Caso O. J. Simpson

98 Rotina de DNA forense Caso O. J. Simpson

99 Rotina de DNA forense Caso O. J. Simpson

100 Rotina de DNA forense

101 Em uma cidade dos Estados Unidos da América (EUA), a polícia local encontrou uma cena de crime farta em evidências: muito sangue, peças de vestuário, pegadas e uma trilha de sangue que revelava o caminho seguido pelo criminoso. Seguindo essas pistas, os policiais chegaram à casa do ex-marido de Nicole, o astro de cinema e ídolo do futebol norte-americano O. J. Simpson, obtendo ali mais evidências: manchas de sangue em seu carro, nas suas meias e no chão do jardim. Exames de DNA comprovaram que esse sangue era das vítimas. Assim, a promotoria acreditava ter nas mãos um caso fechado, que não poderia ser contestado, mas foi surpreendida pela estratégia dos advogados de O. J. Simpson: o questionamento das provas. As câmeras de televisão flagraram o principal perito da polícia coletando amostras sem luvas, policiais manipulando evidências sem trocar as luvas e muitas pessoas circulando na cena do crime, que não tinha sido bem isolada. Ciência Hoje, vol. 29, n.º 169 (com adaptações). Considerando a situação descrita no texto acima, que relata dados referentes a um caso de homicídio ocorrido nos EUA em 1994, julgue os itens a seguir.

102 - As metodologias de RFLP e PCR, que são fundamentadas no mesmo princípio e requerem a mesma quantidade de amostra, diferindo apenas quanto às enzimas utilizadas, poderiam ter sido aplicadas à situação descrita. - Na situação descrita, a tipagem sanguínea seria suficiente para a precisa identificação das vítimas a partir de manchas de sangue, não sendo necessário o uso de exames de DNA. - Na situação considerada, material úmido coletado pelo perito para análise de padrões de DNA deveria ser armazenado em sacos plásticos hermeticamente fechados, pois microrganismos capazes de contaminar a amostra não sobrevivem em tais condições.

103 Rotina de DNA forense Cuidados na coleta de material biológico: Usar luvas e máscaras Evitar conversar sobre as amostras Coletar quantidade suficiente para os exames evitando ao máximo contaminação

104 Rotina de DNA forense Cuidados na biológico: preservação do material Secar os suportes utilizados para a coleta Manter as amostras em baixa temperatura (congeladas)

105 Rotina de DNA forense Testes de natureza das amostras Sangue: Imunológicos, sorológicos, luminol Esperma: PSA, fosfatase alcalina Globulina humana

106 Rotina de DNA forense Extração Tem o objetivo de retirar o material celular do suporte, lisar as células e eliminar todo o conteúdo celular deixando apenas o DNA

107 Rotina de DNA forense Extração Protocolos diferentes para cada tipo de amostra

108 Rotina de DNA forense Sangue Amostra padrão para coletas de referências Extração simplificada Pouca variação entre diferentes amostras

109 Rotina de DNA forense Papel FTA

110 Rotina de DNA forense Swab de mucosa oral Alternativa menos invasiva ao sangue Muito utilizada para coleta em crianças Coleta necessita ser bem feita para se obter boa quantidade de células Coleta menos especializada

111 Rotina de DNA forense Swab de mucosa oral

112 Rotina de DNA forense Swab de mucosa oral

113 Rotina de DNA forense Pelos Praticamente não se usa a coleta de pelos e fios de cabelo para amostras de referência, devido a dificuldade de se trabalhar com esse tipo de amostra

114 Rotina de DNA forense Pelos

115 Rotina de DNA forense Amostras Forenses Diversos protocolos diferentes de extração Extração orgânica Fenol-Clorofórmio mais usada, por ser barata e extrair grande quantidade Desvantagem: Mais trabalhosa, muitas etapas, reagentes perigosos e o produto final não é tão limpo

116 Rotina de DNA forense

117 Rotina de DNA forense

118 Rotina de DNA forense

119 Rotina de DNA forense

120 Rotina de DNA forense Amostras Forenses 1ª Etapa: Amostra incubada com um tampão de lavagem e lise celular 2ª Etapa: Extração com Fenol-clorofórmio 3ª Etapa: Precipitação com álcool 4ª Etapa: Centrifugação e ressuspenção em H 2O

121

122

123

124 Rotina de DNA forense

125 Rotina de DNA forense Extração diferencial Utilizada em casos de crimes sexuais Objetivo é realizar uma lise diferencial das células epiteliais femininas e dos espermatozóides Utiliza dois detergentes de membrana diferentes

126 Rotina de DNA forense Extração diferencial

127 Rotina de DNA forense Extração com Chelex Resina que tem afinidade por DNA Extração mais rápida e com menos etapas do que a orgânica Produto final em menor quantidade e mais sujo do que orgânica.

128

129 Rotina de DNA forense Extração com kit comerciais Kits de extração prontos, otimizados para um grupo ou amostras específicas Extração mais rápida e produto mais limpo, porém mais cara e menor quantidade.

130 Rotina de DNA forense Extração com kit comerciais

131 Rotina de DNA forense Quantificação Importante para avaliar a quantidade de DNA presente em uma amostra Técnicas modernas também passam informação sobre a presença de inibidores de PCR

132 Rotina de DNA forense Quantificação

133 Quantificação através de PCR-RT

134 PCR em tempo real Modificação da técnica de PCR que a torna quantitativa Utilizada para detecção de alelos em DNA genômicos, diagnóstico de doenças, identificação de organismos transgênicos, identificação de patógenos em alimentos

135 PCR em tempo real

136 PCR em tempo real

137 qpcr

138 qpcr

139 Rotina de DNA forense Quantificação Amostra Protocolo Ct Qtd (ng) C-9856 Humano Masculino 29,58 28,49 3,324 3,129 IPC 27,31

140 PCR em tempo real permite quantificar o DNA presente em uma amostra Permite também distinguir a fonte de DNA em humana e masculina Padrão interno permite avaliar a presença ou não de inibidores Possibilita ajuste da concentração ideal de DNA

141 Rotina de DNA forense Amplificação

142 Amplificação

143 Amplificação

144 Amplificação Primers: Forward e Reverse (sense - antisense Se o produto for submetido à eletroforese capilar, os primers são marcados com um fluoróforo A amplificação ocorre sempre no sentido 5`- 3`

145 Rotina de DNA forense Amplificação

146 Amplificação

147 Amplificação

148 Parâmetros dos ciclos 1. Temperatura e Tempo de desnaturação Falta de desnaturação do molde é uma causa comum de falha na PCR Tipicamente 94ºC por 30 s Tempo de desnaturação muito longo reduz a meia vida da enzima

149 Parâmetros dos ciclos 2. Temperatura e Tempo de anelamento Temperatura de anelamento = 5oC abaixo do Tm real dos primers Tempo de anelamento = 15 a 30 s Tempo de extensão: função tamanho do AMPLICON 1 minuto é suficiente 1,2 kb Longo, reduz a meia vida da enzima

150 Efeito Plateau: desvio da quantidade teórica Eficiência teórica x Eficiência Real

151

152 Principais fatores contribuintes Perda da atividade da Polimerase Acúmulo de inibidores Limitação dos componentes Competição entre produtos Pareamento Produto x Molde, Competição com anelamento do primer

153 Rotina de DNA forense Amplificação Componente Volume H2O 5,5 цl Reaction Mix 12,5 цl Primer Set 10,5 цl Taq Gold 0,5 цl Volume total 22,0 цl DNA (0,5 a 1,25 ng) 5,0 цl

154 Rotina de DNA forense Amplificação

155 Rotina de DNA forense Eletroforese

156 Rotina de DNA forense Eletroforese

157

158 Eletroforese Para separação de fragmentos de DNA são utilizados dois tipos de gel: Agarose e Poliacrilamida Agarose utilizado para fragmentos maiores e poliacrilamida pra amplicons menores (como os de STR)

159 Eletroforese A eletroforese em gel trabalha com DNA tanto na forma fita simples quanto fita dupla Para conseguir que o DNA fique estável na forma de fita simples são utilizados agentes desnaturantes como por exemplo Uréia e Formamida

160

161

162

163

164

165

166 Eletroforese Capilar Separação dos amplicons de DNA em um capilar ao invés do gel Possui diversas vantagens como maior poder de resolução, corrida mais rápida, potencial para automação, utiliza pequenas quantidades de amostra, visualização do resultado imediata

167 Rotina de DNA forense Eletroforese

168 Rotina de DNA forense

169

170

171

172

173

174

175

176

177

178

179

180

181

182

183

184

185

186

187

188

189 Resumo Quantificação Recebimento Armazenamento Genotipagem Eletroforese Extração Amplificação

190 Sequenciamento Técnicas utilizadas para descobrir a sequencia das bases de um fragmento de DNA não conhecido

191 Sequenciamento

192

193

194

195

196

197

198

199

200 Sequenciamento de Nova Geração Novas metodologias que permitiram aumentar muitas vezes a capacidade de sequenciamento, abrindo a possibilidade para novos estudos que eram inviáveis com as tecnologias mais antigas

201

202 Marcadores dos Cromossomos X e Y

203 Cromossomo Y

204 Cromossomo Y Linhagem Patrilínea 90% da população brasileira possui Y de origem européia Estudo da origem populacional

205 Cromossomo Y

206 Cromossomo Y

207 Cromossomo Y Muito útil em crimes sexuais Reconstituições de paternidade com filhos homens ou com parentes homens Marcadores de linhagem, não indivíduos específicos

208 Cromossomo Y

209 Cromossomo Y

210 Cromossomo Y

211 Cromossomo Y O resultado do matching do Y não identifica indivíduo, mas sim uma linhagem! Resultado forte nos casos de exclusão e fraco nas inclusões.

212 Cromossomo X

213 Cromossomo X Principal uso: Casos de paternidade deficientes, com apenas um genitor (principalmente suposto pai ausente) Complementar em casos de identificação humana e mutação de autossômicos

214 DNA Mitocondrial

215 DNA Mitocondrial

216 DNA Mitocondrial Cromossomo mitocondrial 16,569 bp, centenas de cópias por célula Útil para amostras com alto grau de degradação e em baixíssima quantidade

217 DNA Mitocondrial Cromossomo característico da linhagem materna, passado da mãe para os filhos Membros de uma mesma família possuem o mesmo haplótipo, a não ser que tenham ocorrido mutações

218 DNA Mitocondrial

219 DNA Mitocondrial Desvantagens Baixo poder de discriminação Estudo caro e trabalhoso

220 Sobre a utilização de DNA mitocondrial como fonte de material para análises de DNA é correto afirmar que: (A) é freqüentemente utilizado em casos de determinação de paternidade, pois está presente em grande quantidade no espermatozóide; (B) sua utilização não é indicada para materiais resultantes de incêndios ou explosões, pois só há uma cópia de DNA mitocondrial. (C) é indicado nos casos em que a quantidade de material celular é reduzida, como nos resíduos fecais e material calcinado, pois as células possuem grande número de cópias do DNA mitocondrial em relação ao nuclear; (D) não permite a realização de estudos evolutivos em materiais muito degradados, como as múmias, pois é menos resistente que o nuclear. (E) a análise do DNA mitocondrial humano não é recomendada às aplicações forenses, pois possui muitas regiões desconhecidas e é tão grande quanto o DNA nuclear.

221 DNA Mitocondrial

222 SNPs

223 SNPs

224 SNPs

225 SNPs

226 SNPs

227 MUITO OBRIGADO E BOA SORTE!

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Os exames. de DNA nos tribunais

Os exames. de DNA nos tribunais Avanços científicos ocorridos nas últimas décadas alteraram as investigações policiais: se antes as impressões digitais e outras pistas eram usadas para desvendar os crimes, hoje pode-se extrair DNA de

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA

LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA IDENTIFICAÇÃO HUMANA Identificação pelo DNA - Identificação Médico-Legal - Perícias Odontológicas VOLUME II Editora Millennium CAMPINAS/SP

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Base de Dados de Perfis Genéticos

Base de Dados de Perfis Genéticos Base de Dados de Perfis Genéticos Faculdade de Medicina, Universidade de Lisboa Instituto Nacional de Medicina Legal Cadeira: Medicina Legal e Ciências Forenses Janeiro de 2010 Introdução Definição Conjunto

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Modelos BioMatemáticos

Modelos BioMatemáticos Modelos BioMatemáticos http://correio.fc.ul.pt/~mcg/aulas/biopop/ Pedro J.N. Silva Sala 4.1.16 Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Pedro.Silva@fc.ul.pt Genética

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

LOCALÍSTICA FORENSE. Rogéria M. Ventura, Ph D FMU - 2011

LOCALÍSTICA FORENSE. Rogéria M. Ventura, Ph D FMU - 2011 LOCALÍSTICA FORENSE Rogéria M. Ventura, Ph D FMU - 2011 PERÍCIA CRIMINAL INVESTIGAÇÃO DO CRIME Chegada do perito investigador ao local do crime e certificação da preservação; Reconhecimento inicial da

Leia mais

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA?

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? A análise em DNA é o meio mais preciso disponível atualmente para a determinação de paternidades ou maternidades duvidosas. É a extrema sensibilidade

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

DNA profiling parte 2

DNA profiling parte 2 Faculdade Milton Campos Curso Lato Sensu em Medicina Legal Disciplina: Bioinformática e Investigação Criminal Professor: Eduardo Campos dos Santos DNA profiling parte 2 Belo Horizonte Outubro/Novembro

Leia mais

Genética Molecular Técnicas aplicadas a produção animal

Genética Molecular Técnicas aplicadas a produção animal MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA PROGRAMA DE PÓS-GRADUAÇÃO EM ZOOTECNIA Genética Molecular Técnicas aplicadas a produção

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC PROPOSTA DE IMPLANTAÇAO DE COLETA DE MATERIAL GENÉTICO PARA ANÁLISE DE VÍNCULO DE PATERNIDADE PELO DNA, DURANTE

Leia mais

Atividade prática Quem é o pai? Quem é o criminoso?

Atividade prática Quem é o pai? Quem é o criminoso? Aluno: nº Atividade prática Quem é o pai? Quem é o criminoso? OBJETIVOS Compreender a importância prática da Engenharia Genética na identificação das pessoas. Conhecer os princípios básicos da manipulação

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose.

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose. BIO 6E aula 16 16.01. A pleiotropia ocorre quando um gene influencia mais de uma característica. Em genes que estão localizados no mesmo par de cromossomos porém distante um do outro, a maioria dos gametas

Leia mais

Áudio. GUIA DO PROFESSOR Mendel, o pai da genética - Parte I. Os fundamentos da hereditariedade: Biografia de Gregor Mendel

Áudio. GUIA DO PROFESSOR Mendel, o pai da genética - Parte I. Os fundamentos da hereditariedade: Biografia de Gregor Mendel Mendel, o pai da genética - Parte I Conteúdos: Tempo: Objetivos: Descrição: Produções Relacionadas: Os fundamentos da hereditariedade: Biografia de Gregor Mendel 5 minutos para cada áudio. Avaliar se o

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA RAZÃO DE PROBABILIDADE BAYESIANA COMO EVIDÊNCIA PARA TESTE DE VÍNCULO DE PATERNIDADE Curitiba 2012 I Dianna Lo Wai Yan Maurício Fernandes do Nascimento

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII Título do Podcast Área Segmento Duração Por que você se parece com sua avó? A genética vai ajudá-lo a entender como isso é possível! Ciências Ciências da Natureza

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA OS FUNDAMENTOS DA HEREDITARIEDADE EXPERIMENTO Teste de paternidade 1. Resumo Essa aula propõe a simulação de um teste de paternidade por meio da análise de

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Genética Conceitos Básicos

Genética Conceitos Básicos Genética Conceitos Básicos O que é genética? É o estudo dos genes e de sua transmissão para as gerações futuras. É dividida em: Genética Clássica Mendel (1856 1865) Genética Moderna Watson e Crick (1953).

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

PADRONIZAÇÃO DE EXAMES DE DNA EM PERÍCIAS CRIMINAIS

PADRONIZAÇÃO DE EXAMES DE DNA EM PERÍCIAS CRIMINAIS PADRONIZAÇÃO DE EXAMES DE DNA EM PERÍCIAS CRIMINAIS 1) Objetivos a) Assegurar a qualidade, integridade e segurança em exames periciais envolvendo a utilização de DNA; b) Estabelecer os procedimentos para

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário que a mutação esteja em homozigose (doença autossômica

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores.

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores. BIO V7 CAP 19 19.01 O genótipo do casal III-2 e III-3 é X A X a x X a y. Fazendo o cruzamento os filhos podem ser: X A X a, X A Y, X a X a, X a Y. Como se pode observar qual é o masculino e qual é o feminino,

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais