BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

Tamanho: px
Começar a partir da página:

Download "BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO =============================================================================================="

Transcrição

1 PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os nucleotídeos são constituídos por uma molécula de desoxirribose (D), uma molécula de ácido fosfórico (P) e uma base nitrogenada (adenina, guanina, timina ou citosina). A ligação entre os nucleotídeos ocorre pela interação entre as bases nitrogenadas específicas, resultando em uma molécula ordenada e bem definida, o DNA. De acordo com essas informações, a estrutura plana que representa um fragmento de DNA e o tipo de ligação química responsável pela interação entre as bases nitrogenadas são, respectivamente, (A) (B) (C) (D) (E) Página 1 de 5-12/07/2014-5:52

2 02- Observe a sequência de bases nitrogenadas de um fragmento de DNA apresentado a seguir. TACAAGGTTCTTTGACTATAATTAGCATTC A sequência resultante da transcrição deste fragmento é composta de: (A) 30% de timina. (B) 40% de timina. (C) 60% de timina. (D) 30% de uracila. (E) 40% de uracila. 03- As tetraciclinas constituem uma classe de antibióticos produzidos por bactérias do gênero Streptomyces. Elas atuam impedindo que o RNA transportador se fixe ao ribossomo nas células bacterianas. Em qual processo biológico este antibiótico atua? (A) Transcrição. (C) Replicação do DNA. (E) Recombinação. (B) Síntese Proteica. (D) Divisão celular. 04- Com relação ao DNA e ao RNA, é correto afirmar o seguinte: (A) Ambos são dupla fita em todos os seres vivos. (B) Ambos são constituídos de ribonucleotídeos. (C) Ambos são polímeros de nucleotídeos. (D) Ambos contêm a base U, uracila. (E) Ambos contêm a base T, timina. 05- Em uma das fitas de DNA de uma espécie de vírus encontram-se 90 Adeninas e 130 Citosinas. Sabendo-se ainda que nesta fita ocorre um total de 200 bases púricas e 200 bases pirimídicas, assinale a alternativa CORRETA. (A) Na dupla fita de DNA ocorrem 180 Adeninas. (B) Na dupla fita de DNA ocorrem 140 Guaninas. (C) Na fita complementar ocorrem 300 bases púricas e 100 bases pirimídicas. (D) Na fita complementar ocorrem 70 Adeninas e 110 Citosinas. (E) Não é possível determinar a composição de bases nitrogenadas da fita complementar. 06- Os ácidos nucleicos são polímeros que atuam no armazenamento, na transmissão e no uso da informação genética. Com base na estrutura e função destes polímeros, assinale com (V) VERDADEIRO ou (F) FALSO as afirmações abaixo. ( ) Seus monômeros são denominados nucleotídeos. ( ) Seus monômeros estão unidos por meio de ligações fosfodiésteres. ( ) Suas bases nitrogenadas estão diretamente ligadas aos fosfatos. ( ) Suas bases nitrogenadas podem ser púricas ou pirimídicas. A sequência correta de preenchimento dos parênteses, de cima para baixo, é: (A) V V F V. (B) V F V F. (C) F V V F. (D) F F V V. (E) V F F V. 07- Em 1953, James Watson e Francis Crick descreveram a estrutura do DNA (ácido desoxirribonucleico). O DNA armazena as informações genéticas que coordenam o desenvolvimento e o funcionamento dos seres vivos em unidades chamadas genes. Sua estrutura é formada por um longo polímero de unidades simples de nucleotídeos (monômeros), e sua cadeia principal, por moléculas de açúcares e fosfato intercaladas, unidas por ligações fosfodiéster. Ligada a cada molécula de açúcar, está uma das quatro bases nitrogenadas, cuja sequência, ao longo da molécula de DNA, constitui a informação genética. A leitura dessas sequências é realizada pelo RNA mensageiro (ácido ribonucleico), que copia parte da cadeia de DNA por um processo chamado transcrição, e, posteriormente, a informação contida neste é "traduzida" em proteínas pela tradução. Embora a maior parte do RNA produzido seja utilizada na síntese de proteínas, pode também ter função estrutural (RNA ribossômico), que faz parte da constituição dos ribossomos. Das bases nitrogenadas listadas abaixo, qual ocorre exclusivamente na estrutura do DNA? (A) Adenina. (C) Timina. (E) Citosina. (B) Uracila. (D) Guanina. Página 2 de 5-12/07/2014-5:52

3 08- Os atletas obtêm sucesso através de muito treinamento, entretanto as características genéticas de cada indivíduo colaboram para um resultado final positivo. No esquema, as bases do DNA que dão origem ao RNA mensageiro, no sentido da seta, são: (A) C A U G A C G U. (B) A U A C U G C A. (C) G T A C U G C A. (D) C A T G A C G T. (E) A G C T C T A T. 09- É possível marcar determinadas proteínas com um isótopo radioativo, a fim de rastrear sua passagem através da célula, desde a síntese até a excreção. O gráfico abaixo ilustra o rastreamento da passagem de uma proteína marcada radioativamente por três compartimentos celulares. Indique a sequência do percurso seguido por essa proteína através dos três compartimentos celulares citados e a função de cada um dos compartimentos durante o percurso. R.: Página 3 de 5-12/07/2014-5:52

4 10- Em 1962, o prêmio Nobel de Fisiologia e Medicina foi concedido aos cientistas Francis Crick, Maurice Wilkins (britânicos) e James Watson (norte-americano) por suas pesquisas que determinaram a estrutura molecular do DNA. Sobre o DNA, são feitas as seguintes afirmativas: I. Possui estrutura em dupla hélice, encontrada no núcleo celular, e sua importância reside no fato de que ele carrega os genes. II. No emparelhamento das fitas de DNA; se em uma fita tivermos a sequência de bases AATTTCG, na outra teremos TTAAAGC. III. É formado por uma pentose denominada desoxiribose e pelas bases nitrogenadas adenina, timina, citosina, guanina e uracila. IV. Em alguns vírus, são encontrados ácidos nucleicos do tipo DNA espalhados no citoplasma viral. Estão CORRETAS apenas as afirmativas: (A) I e II. (C) III e IV. (B) I, II e III. (D) I, III e IV. 11- As proteínas são substâncias essenciais da estrutura das células vivas e podem ser formadas por um ou mais polipeptídios. O processo de síntese de uma cadeia polipeptídica consiste em unir aminoácidos de acordo com a sequência de códons de RNAm. Como essa sequência é determinada pelas bases de DNA que serviu de molde ao RNAm, a síntese de proteínas é denominada: (A) duplicação semiconservativa. (C) tradução gênica. (B) transcrição gênica. (D) programação genética. 12- O segmento CGATAGACT de uma fita de DNA, após o processo de transcrição, origina a cadeia: (A) GUTATUTGA. (B) GCUAUCUGA. (C) GCTUTCTGU. (D) UCTATCTUA. (E) GCTATCTGA. 13- Uma molécula de RNA mensageiro apresenta a seguinte sequência de bases nitrogenadas: UUU GUG CCC AAA. Assinale a alternativa que contém a sequência de bases do segmento da molécula de DNA que deu origem a esse RNA: (A) AAA CAC GGG TTT. (C) AAA CTC GGG TTT. (E) AAA CAC CCC UUT. (B) TTT CAC GGG UUU. (D) TTT GAG GGG TTT. 14- No esquema, os números 1, 2 e 3 substituem, respectivamente: (A) repressão gênica, transcrição, replicação. (C) amplificação gênica, repressão, tradução. (E) transcrição, replicação, tradução. (B) replicação, tradução, transcrição. (D) replicação, transcrição, tradução. 15- Com relação à composição química, as moléculas de DNA e RNA diferem entre si quanto ao tipo de: (A) açúcar, apenas. (B) base nitrogenada, apenas. (C) base nitrogenada e de açúcar, apenas. (D) base nitrogenada e de fosfato, apenas. (E) base nitrogenada, de açúcar e de fosfato. Página 4 de 5-12/07/2014-5:52

5 01- (A) 02- (D) 03- (B) 04- (C) 05- (D) 06- (A) 07- (C) 08- (D) GABARITO No DNA, a estrutura plana revela o pareamento de adenina (A) com timina, (T) e de guanina (G) com citosina (C). As interações que unem as duas cadeias polinucleotídicas são pontes de hidrogênio. O RNA mensageiro transcrito apresentará a sequência AUGUUCCAAGAAACUGAUAUUAAUCGUAAG e 30 nucleotídeos, dos quais nove são uracila nucleotídeos. Portanto, o segmento de RNAm possui 30% de uracila. A fixação do RNA transportador ao ribossomo é fundamental para o transporte do aminoácido e a formação da cadeia polipeptídica. Logo, ao impedir a fixação do RNA transportador ao ribossomo, as tetraciclinas atuam impedindo a síntese de proteínas. O DNA e o RNA são macromoléculas (polímeros) constituídas pelo encadeamento de unidades estruturais denominadas nucleotídeos. No DNA, são bases púricas: adenina e guanina, e bases pirimídicas: citosina e guanina. Se na fita em questão ocorrem 90 adeninas, então haverá 110 guaninas (total de 200 púricas) nesta mesma fita há 130 citosinas e 70 timinas (total de 200 pirimídicas). A partir dessas informações, encontraremos na fita complementar 70 adeninas e 110 citosinas. Em nucleotídeos formadores dos ácidos nucleicos, as bases nitrogenadas estão ligadas ao açúcar, ribose ou desoxirribose. A base pirimídica timina aparece na molécula de DNA. Os nucleotídeos da cadeia ativa do DNA que originou o RNA são portadores das seguintes bases nitrogenadas: CATGACGT. 09- Retículo endoplasmático granular (REG), complexo golgiense (CG) e vesículas de secreção (VS) REG: síntese das proteínas; CG: envolvimento das proteínas por suas membranas; VS: fusão com a membrana plasmática, liberando as proteínas para fora da célula. 10- (A) 11- (C) 12- (B) 13- (A) 14- (D) 15- (C) O DNA é formado por duas cadeias polinucleotídicas pareadas e antiparalelas. As bases nitrogenadas presentes nessa macromolécula são: adenina, timina, guanina e citosina. Os vírus são micro-organismos acelulares desprovidos de membrana plasmática, citoplasma ou núcleo. Eles são constituídos, basicamente, por uma cápsula proteica revestindo o material genético composto por DNA ou RNA. A síntese de uma proteína consiste na tradução dos códons do RNA mensageiro na forma de uma sequência de aminoácidos. Cada códon do RNAm é uma sequência de três nucleotídeos que determina a posição exata do aminoácido na cadeia polipeptídica. Página 5 de 5-12/07/2014-5:52 FM/1407/BANCO DE QUESTOES/BIOLOGIA /BIOLOGIA - 1a SERIE - ENSINO MEDIO - 2a ETAPA PARTE 1 - ACIDO NUCLEICO - LEONARDO MARISCAL.doc

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP 1. (Fuvest 2014) Observe a figura abaixo, que representa o emparelhamento de duas bases nitrogenadas. 3. (Unesp 2013) Em 2012, assim como em anos anteriores, o Ministério da Saúde promoveu a campanha para

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

Biologia Professor Vianna 1ª série / 1º trimestre

Biologia Professor Vianna 1ª série / 1º trimestre Biologia Professor Vianna 1ª série / 1º trimestre Módulo 3 ÁCIDOS NUCLEICOS E CITOLOGIA 1 Os itens abaixo referem-se à estrutura, composição e função dos ácidos nucleicos. Estrutura: I) Dupla hélice; II)

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

NÚCLEO e DIVISÃO CELULAR

NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Aula 2 Unidades fundamentais dos ácidos nucléicos

Aula 2 Unidades fundamentais dos ácidos nucléicos Biologia Molecular Básica Módulo I Básico Aula 2 Unidades fundamentais dos ácidos nucléicos Prezado professor, nesta aula você vai estudar os nucleotídeos que formam os blocos constituintes dos ácidos

Leia mais

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Teste de avaliação Nome ----------------------------------------------------------------------- Numero -------------------------------

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica INBEQMeDI Instituto Nacional de Biotecnologia Estrutural e Química Medicinal em Doenças Infecciosas Coordenadoria de Educação e Difusão de Ciências Telefone: (16) 3373-9159 Rua 9 de julho, 1205 - Centro

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial)

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial) São moléculas formadas por unidades complexas chamadas nucleotídeos. Cada nucleotídeo é um grupamento molecular formado por três subunidades: uma base nitrogenada, uma pentose e um grupamento fosfato.

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

2014 - PRISE I GABARITO SUGERIDO E COMENTADO

2014 - PRISE I GABARITO SUGERIDO E COMENTADO 014 - PRISE I PORTUGUÊS 1 - C - B 3 - D 4 - C 5 - A 6 - B 7 - C LITERATURA 8 - C 9 E 10 - B 11 A 1 - B 13 C 14 B HISTÓRIA 15 - A 16 C 17 - E 1º Lugar do Brasil no ENEM 01 Colégio Elite Belém e Vila Dos

Leia mais

Conceitos Básicos de Biologia Molecular

Conceitos Básicos de Biologia Molecular Conceitos Básicos de Biologia Molecular Marcílio C. P. de Souto DIMAp/UFRN Tópicos Introdução Célula e macro-moléculas Proteínas e Ácidos nucléicos Ácidos Nucléicos Componentes DNA x RNA Estabilidade do

Leia mais

AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS

AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS Apesar da diversidade entre os seres vivos, todos guardam muitas semelhanças, pois apresentam material genético (DNA) em que são encontradas todas as informações

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

4GENÉTICA MOLECULAR MIRNA DUARTE BARROS

4GENÉTICA MOLECULAR MIRNA DUARTE BARROS 4GENÉTICA MOLECULAR MIRNA DUARTE BARROS 190 Capítulo 4 191 GENÉTICA MOLECULAR MIRNA DUARTE BARROS INTRODUÇÃO O dogma central da Genética Molecular define um paradigma que envolve polímeros de nucleotídeos,

Leia mais

Ácidos nucleicos. Disponível em: . Acesso em: 21 fev

Ácidos nucleicos. Disponível em: <http://carmelourso.files.wordpress.com/2011/08/3d-dna-cover.jpg>. Acesso em: 21 fev Ácidos nucleicos Ácidos nucleicos Disponível em: . Acesso em: 21 fev. 2012. Núcleo celular Define as características morfofisiológicas da

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA Aluno: Módulo I Professor: Leandro Parussolo Unidade Curricular: Biologia Celular ATIVIDADE

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos 01 - (IBMEC RJ) O núcleo celular foi descoberto pelo pesquisador escocês Robert Brown, que o reconheceu como componente fundamental das células. O nome escolhido para essa organela expressa bem essa ideia:

Leia mais

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide.

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide. Resumo de Biologia Crescimento e renovação celular As células são unidades estruturais e funcionais dos organismos. Utilizando o seu programa genético, produzem moléculas específicos que permitem o crescimento

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA 1- As acetabularias (fotografia à esquerda) são algas verdes marinhas, com 2 a 3 cm de altura, constituídas por uma base ou pé, onde está o núcleo, e um caulículo, na extremidade do qual se diferencia

Leia mais

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais