Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Tamanho: px
Começar a partir da página:

Download "Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo"

Transcrição

1 Todos os direitos reservados à DNA Goes to School, Inc Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica de PCR foi criada em 1985 pelo Dr. Kary Mullis, nos Estados Unidos. Esta técnica é uma das grandes responsáveis por todo o avanço na área de biomedicina destes últimos 20 anos. Aparelho de PCR Uma das principais características encontradas no genoma de organismos eucariotos são as chamadas seqüências de repetição, constituídas, como o nome sugere, por seqüências de DNA repetitivo. O DNA repetitivo é composto por seqüências de nucleotídeos de vários tamanhos e composições diferentes que aparecem com muita freqüência em nosso genoma, tanto de forma consecutiva (as chamadas seqüências em tandem) ou como seqüências dispersas. Os segmentos de DNA encontrados no genoma que não estão repetidos são chamados de DNA cópia única (single copy DNA). A proporção de DNA repetitivo no genoma varia de acordo com a taxonomia do organismo. Enquanto em leveduras o DNA repetitivo representa 20% do genoma deste organismo, em mamíferos este número pode chegar até a 60%. Em algumas plantas, 80% do genoma é formado por DNA repetitivo. A maioria das seqüências repetitivas não dispersas é tão uniforme que quando todo o DNA é submetido à separação usandose um gradiente de densidade, estas seqüências formam uma banda visível no tubo que se distingue claramente do resto do DNA presente no organismo em questão. Esta banda foi denominada DNA satélite e é formada pelas seqüências repetitivas não dispersas. Os cientistas acreditam que estas seqüências não possuem uma função definida, sendo o resultado de um acúmulo de seqüências geradas ao longo da história evolutiva dos organismos, já que as mesmas não estão sujeitas à seleção natural. Outra classe de seqüências repetitiva são as chamadas seqüências de repetição dispersas, já que elas podem ser encontradas em todo o genoma, como nos íntrons de genes, nas regiões intragênicas e também nas regiões onde não há genes propriamente ditos. Estas seqüências podem ser curtas (500 pb), sendo, neste caso, chamadas de SINES (short interspersed repeated sequences), ou longas, que são as chamadas seqüências LINES (long interspersed repeated sequences). As interspersed repeated sequences apresentam algumas características semelhantes aos genes que transcrevem os RNA-transportadores. O tipo mais conhecido de seqüência SINE é o das seqüências Alu. Estas seqüências possuem este nome devido à presença de um sítio de restrição para a enzima Alu I. Aproximadamente 1 milhão de membros da família Alu estão distribuídos pelo genoma dos primatas. As seqüências Alu caracterizam-se também por seu tamanho de aproximadamente 300 pares de bases e acredita-se que tenham surgido no genoma dos primatas há 65 milhões de anos. Neste módulo, investigaremos uma seqüência da família Alu encontrada no oitavo íntron do gene de ativação de tecido plasminogênico (PLAT), localizado no cromossomo 8. Esta seqüência não tem qualquer associação com doenças genéticas ou com nenhum tipo de susceptibilidade. Ela é apenas um marcador genético muito útil para estudo de populações, pois indivíduos diferentes podem ou não apresentar esta inserção em seus genomas. 1

2 Uma outra categoria de seqüência de repetição encontrada no genoma dos eucariotos são as chamadas seqüências de repetição, ou DNA repetitivo, ou ainda VNTRs (do inglês Variable Number of Tandem Repeat). Estas seqüências de DNA contêm várias cópias consecutivas de uma unidade de seqüência, uma atrás da outra, como vagões de trem. Em uma população, podemos encontrar alelos diferentes desta mesma seqüência entre os indivíduos onde a diferença entre eles está apenas no número de vezes em que a unidade se repete. Assim, estas seqüências são altamente polimórficas Para facilitar a compreensão, tome como exemplo a seqüência ATCG como uma unidade de seqüência de um microssatélite. Se um alelo possuir esta unidade repetindo-se de modo consecutivo 3 vezes, teremos a seguinte seqüência ATCGATCGATCG (alelo 1) gerando um fragmento de 12 pares de bases. Agora tome como exemplo um outro alelo onde esta mesma unidade se repete por 4 vezes. Deste modo, o fragmento gerado será ATCGATCGATCGATCG (alelo 2) com 15 pares de bases. Estes dois alelos poderão ser diferenciados de acordo com seus respectivos tamanhos. São justamente estas diferenças no número de repetições destas seqüências que resultam na detecção de diferentes alelos, ou seja, fragmentos de tamanhos diferentes, no genoma humano de diferentes indivíduos. Em genomas de eucariotos, estas seqüências estão distribuídas ao acaso e constituem a classe mais polimórfica de marcadores moleculares disponível. Estas repetições podem estar localizadas dentro de genes ou podem se localizar em regiões que não contêm genes. Estas regiões ainda são de função desconhecida. Estas seqüências repetitivas são utilizadas em testes de paternidade por DNA por serem altamente polimórficas, o que diminui muito a possibilidade de que dois indivíduos não relacionados tenham o mesmo genótipo, isto é, os mesmos alelos. Nestes casos, várias regiões diferentes do genoma são utilizadas, isto é, fragmentos de DNA repetitivo espalhados pelo genoma. Para se chegar a um número que reflita a possibilidade de que um indivíduo seja de fato o pai em questão, todos os resultados são multiplicados e avaliados. Esquema do funcionamento da técnica de PCR 2 A PCR pode ser usada para se determinar a paternidade biológica de um indivíduo.

3 Reação em Cadeia da Polimerase O princípio básico da PCR está na capacidade de, a partir de quantidades mínimas de DNA, multiplicar uma determinada seqüência, de modo que esta se torne majoritária na amostra. O material inicial para análise através da técnica de PCR pode ser obtido a partir de diferentes tecidos. Estes tecidos podem ser o sangue, que proporciona uma grande quantidade de DNA, ou até mesmo fios de cabelo ou células da boca. Numa reação de PCR, o fragmento de DNA que desejamos multiplicar (ou amplificar) é chamado de fragmento alvo ou DNA molde (e os oligonucleotídeos que utilizamos são chamados de primers), ou iniciadores. Na realidade, os primers nada mais são do que pequenos fragmentos de DNA complementares às extremidades da região que se pretende amplificar. Estes primers são produzidos rapidamente e vendidos por companhias de biotecnologia específicas. A técnica de PCR tem provocado grande impacto nas principais áreas da biotecnologia: mapeamento gênico, clonagem e seqüenciamento de DNA, e detecção da expressão gênica. Atualmente, a PCR é utilizada para o diagnóstico de doenças genéticas, bem como na detecção de material genético presente em pequenas quantidades na amostra em análise. Como exemplo, temos a detecção e identificação de material genético de vírus como o HIV ou o vírus da hepatite, assim como a detecção de organismos geneticamente modificados em produtos alimentícios. O método pelo qual a PCR funciona é descrito em seguida: dois pequenos fragmentos de DNA, tipicamente de 20 pares de bases, são sintetizados em laboratório. Esses são os primers, que são complementares a cada uma das extremidades da seqüência de DNA de interesse. Num tubo de reação são adicionados os primers, os nucleotídeos livres (adenina, guanina, timina e citosina), o DNA que se quer analisar (DNA molde) e uma enzima especial resistente ao calor chamada Taq DNA polimerase, que promove a síntese de DNA. A mistura é aquecida a 95 C, causando a separação das duas fitas de DNA. Em seguida, a mistura é esfriada até 55 C ou 65 C, temperatura na qual os primers se ligam às regiões complementares das fitas de DNA que estão separadas. Neste momento, dentro do tubo de reação, todo o DNA está na forma de fita simples, menos as duas pequenas regiões nas quais os primers de 20 pares de bases se ligaram nos dois lados da seqüência de DNA de interesse. A temperatura é então elevada a 72 C, e a Taq DNA polimerase começa a sintetizar um novo DNA, começando nas regiões em dupla fita, local onde cada um dos primers se ligou ao DNA molde. A Taq irá promover a síntese de DNA somente a partir da região em dupla fita. A síntese ocorre em uma taxa de aproximadamente 20 nucleotídeos/segundo, e em cerca de 30 segundos a 1 minuto uma nova cópia do fragmento que se quer analisar é sintetizada. A reação agora é novamente aquecida a 95 C, causando novamente a separação de todo DNA em fitas simples. Ao final do primeiro ciclo há duas fitas da molécula original de DNA, mais duas cópias da região de interesse. A temperatura é novamente reduzida, e agora os primers irão se ligar aos 4 sítios nas novas duas cópias e também na molécula original de DNA. A temperatura do ciclo é novamente elevada a 72 C e as 4 fitas individuais são copiadas em 8. Esses ciclos são repetidos geralmente 30 vezes, num aparelho chamado termociclador. Ao final dos ciclos de amplificação existem, aproximadamente, 1 milhão de cópias do segmento de DNA de interesse para cada molécula molde originária da amostra inicial. É assim que podemos selecionar um fragmento específico dentro de um genoma. Quando são usados primers específicos em uma reação em cadeia da polimerase (PCR), fragmentos específicos no genoma do organismo são amplificados. É por este tipo de análise que podemos observar diferenças entre indivíduos. Estas análises podem ser feitas utilizando-se o DNA repetitivo, ou VNTRs, já mencionados anteriormente. De acordo com o número de repetições da seqüência que são observadas, ou seja, das bandas de diferentes tamanhos visualizadas em gel de agarose (ou poliacrilamida), podemos identificar o grau de parentesco ou até a origem da amostra em análise. A técnica de PCR tem sido muito aplicada em estudos forenses devido à pouca disponibilidade de material em situações criminais. Além disso, devido à alta sensibilidade desta técnica, torna-se possível a amplificação de DNA a partir de até mesmo uma única célula, e o DNA obtido não precisa necessariamente estar íntegro. No entanto, a grande sensibilidade desta técnica apresenta também desvantagens, pois o risco de contaminação por uma molécula de DNA não presente na amostra de interesse se torna grande, sendo recomendado bastante cuidado em casos forenses e em todos os estudos moleculares. 3

4 Variabilidade na população humana Todos os seres vivos, incluindo seres humanos, apresentam grande variabilidade entre si. Podemos notar a variabilidade em uma população (indivíduos da mesma espécies) ou ainda entre espécies, gêneros e, enfim, classes diferentes. Variações também podem ser observadas dentro do genoma de um mesmo indivíduo quando este é heterozigoto para um determinado gene ou fragmento de DNA. Diferentes indivíduos podem apresentar diferentes alelos de um mesmo gene. No caso da seqüência Alu que iremos trabalhar, diferentes indivíduos podem apresentar ou não esta inserção em seu genoma. Nesta aula iremos realizar a PCR para amplificar os dois alelos para a inserção Alu conhecida como TPA25, de 300 pares de bases, encontrada ou não no cromossomo 8. Para isso iremos trabalhar com o DNA das células da bochecha extraído anteriormente e cada indivíduo realizará a reação de PCR com seu próprio DNA. Em seguida, iremos realizar uma eletroforese em gel de agarose para observarmos a freqüência de cada um dos dois alelos (com a inserção +, sem a inserção -). O PCR poderá gerar fragmentos de dois tamanhos diferentes, 570 pb (quando há presença da inserção) e 260 pb (quando não há presença da inserção). É preciso que fique claro que esta região com a qual iremos trabalhar não tem nenhuma implicação médica, étnica ou racial. É apenas uma região polimórfica do genoma humano. A técnica de estabelecimento de vínculo genético a partir de sequências repetidas do genoma foi desenvolvida pelo pesquisador inglês Alec Jaffrey em Atividade de Laboratório Reação de PCR Adicione de primer ao tubo de PCR Adicione do tubo contendo o DNA extraído de bochecha As seqüências dos primers utilizados são: #1-5' GTGAAAAGCAAGGTCTACCAG 3' Ciclo de PCR #2-5' GACACCGAGTCCATCTTGAC 3' 95 C inicial por 5 minutos 94 C 1 min 60 C 1 min Este ciclo se repete por 30 vezes. 72 C 1 min 72 C finais por 5 minutos 4 C finais até a amostra ser utilizada na eletroforese de gel de agarose. 4

5 O Princípio de Hardy-Weinberg O Princípio de Hardy-Weinberg é um modelo matemático simples que demonstra que as freqüências genotípicas de uma população se mantêm constante quando não há nenhuma força evolutiva atuando sobre a mesma. Para que o princípio possa ser demonstrado, a população em questão deve estar em equilíbrio genético, devendo ela apresentar as seguintes características: 1) Não pode haver a ocorrência de mutações; 2) Não pode haver fluxo gênico entre diferentes populações; 3) A população analisada deve ser grande o suficiente para que não ocorram desvios estatísticos; 4) Os cruzamentos devem ocorrer ao acaso, não havendo preferência de acasalamento; 5) Não pode haver atuação da seleção natural. Este tipo de população é chamada de população ideal e, na realidade, poucas são as populações que preenchem as condições descritas acima. No entanto, o principio de Hardy-Weinberg é muito útil para se estudarem populações e os mecanismos evolutivos que violam o princípio. Por exemplo, se uma população X apresenta determinadas freqüências genotípicas na geração 1 (que corresponde ao momento em que os cientistas colhem os dados) e se na geração 5 estas freqüências estão alteradas, então o cientista pode concluir que uma, ou mais, das condições descritas anteriormente foi violada. Com esta informação o geneticista evolutivo pode estudar quais são as forças evolutivas que estão atuando na população. Embora a população humana não obedeça a todas as condições exigidas pela lei de Hardy- Weinberg, esta pode ser aplicada a populações humanas com uma boa dose de correção. Na realidade, a única condição à que a população humana realmente obedece é a de ser grande, já que estamos todos sujeitos à ação da seleção natural (um bom exemplo é o que ocorre com a incidência do gene da anemia falciforme na África, onde ele oferece parcial proteção à malária), a incidência de ocorrência de mutações está na faixa de um em 100 mil gametas, além do fato de muitos casamentos não ocorrerem ao acaso, mas sim de acordo com critérios religiosos, culturais ou mesmo delimitados por questões geográficas. O modelo matemático postula que as freqüências alélicas de uma população em equilíbrio genético irão se comportar de acordo com a fórmula p 2 +2pq+q 2 =1 Este modelo é mais usado em sistemas dimórficos, ou seja, que possuam apenas dois alelos, mas pode ser expandido também para os casos de polialelia. Em sistemas dimórficos, cada uma das três classes representa um dos três genótipos possíveis, representados pelos dois possíveis homozigotos e o heterozigoto. Diferentes populações podem apresentar freqüências gênicas bem diferentes. Observe, por exemplo, o artigo de Tishkoff e colaboradores. Tishkoff e colaboradores estudaram o dimorfismo da seqüência Alu do locus PLAT em 27 populações humanas diferentes, distribuídas geograficamente. Além de estudar as populações humanas, o grupo também investigou este dimorfismo em 24 chimpanzés, 5 gorilas, 5 orangotangos e 4 gibões, não encontrando a presença desta inserção em nenhum destes primatas. Por outro lado, em todas as 27 populações humanas estudadas observou-se a presença dos dois alelos, e em 25 populações não havia uma predominância de um ou outro alelo que apresentasse uma freqüência maior que 75%. Perguntas 1) Em relação ao surgimento desta inserção Alu, que conclusão você tiraria da observação de que esta inserção não pôde ser encontrada em nenhum dos primatas analisados, podendo, no entanto, ser encontrada em todas as 27 populações humanas estudadas? 2) Você poderia indicar, através da análise da tabela 2 do artigo de Tishkoff e colaboradores, quais as duas populações humanas cujas freqüências de um dos alelos é menor que 25%? 5

6 Eletroforese em gel de agarose Utilize do volume da reação de PCR para a eletroforese. O gel utilizado é de 2%, para que possa possibilitar uma boa resolução de fragmentos pequenos. Pipete de tampão de corrida em sua amostra. Aplique sua amostra no gel. O gel deve correr a 100 volts por aproximadamente 1 hora, ou até que o corante azul do tampão de corrida esteja a aproximadamente 2 cm do final do gel. Após a corrida o gel deve ser corado com papelote de azul de metileno. Análise dos Resultados A seqüência Alu se integrou na população ao acaso, sendo, deste modo, um bom instrumento para se estudar a genética de populações e determinar se a população está ou não em equilíbrio. Esta análise se faz aplicando-se o princípio de Hardy-Wienberg. Após corar o gel, observe o genótipo de cada indivíduo de seu grupo. Você poderá observar que alguns indivíduos são homozigotos enquanto outros são heterozigotos. Em nosso exercício, nós iremos designar por p 2 os indivíduos homozigotos que possuem a inserção Alu TPA25 em seu genomas, e nós os chamaremos de indivíduos (+/+). Os indivíduos heterozigotos (+/-) correspondem à classe 2pq, e a outra classe de homozigotos (-/-) corresponde à classe q 2. Através da determinação dos genótipos observados neste grupo, podemos calcular as freqüências alélicas. Para tal, complete a tabela abaixo. Tabela 1 Freqüências genotípicas observadas Classes Quantidade de Genótipos Freqüência (genótipos/total) Homozigotos (+/+) p 2 = Heterozigoto (+/-) pq= Homozigoto (-/-) q 2 = Total= Tabela 2 Cálculo das Freqüências Alélicas Alelo Quantidade Freqüência Alélica total p alelos total q alelos p/total= q/total= Total alelos= 6

7 Testando o Equilíbrio de Hardy-Weinberg Para saber se o nosso grupo está em Equilíbrio de Hardy-Weinberg é necessário que nós apliquemos um teste estatístico, que será capaz de nos informar se as freqüências genotípicas que observamos em nosso grupo são significativamente diferentes, ou não, daquela esperada. Neste caso, nós aplicaremos o teste qui-quadrado. Este teste é utilizado para se testar uma hipótese, a hipótese nula. Neste caso, nós partimos do princípio de que o nosso grupo está em Equilíbrio de Hardy-Weinberg, sendo esta é a hipótese que iremos testar. De acordo com o resultado obtido no teste qui-quadrado, poderemos então dizer se nosso grupo está (a hipótese nula é confirmada) ou não (a hipótese nula é rejeitada) em equilíbrio para a inserção TPA 25. Quando trabalhamos com apenas dois alelos temos somente 1 grau de liberdade. O valor crítico do qui-quadrado neste caso é Se o valor do qui-quadrado for igual ou maior que 3.84, então há probabilidade de que a hipótese nula seja rejeitada ( porque as diferenças entre as freqüências observadas e as freqüências esperadas são significativas e não apenas obra do acaso). Se o valor do qui-quadrado, por outro lado, for menor que 3.84, então dizemos que há 95% de probabilidade de que a diferença entre a freqüência observada e a freqüência esperada seja simples acaso. Neste caso, nós aceitamos a hipótese de que a população está em equilíbrio. Fórmula do qui-quadrado Graus de liberdade Problema onde o é a freqüência genotípica observada e e a freqüência genotípica esperada. Baseado nas freqüências de p (+) e q (-) encontrada em nosso grupo, cálcule as freqüências genotípicas esperadas, segundo a teoria de Hardy-Weinberg. Em seguida, aplique o teste qui-quadrado e descubra se nosso grupo está ou não em equilíbrio para o locus em questão. A estimativa de um parâmetro pode estar baseada em um diferente número de informações. Em cálculos de distribuição, o conceito de graus de liberdade está associado ao número de parâmetros que podem variar independentemente. Por exemplo, quando trabalhamos com dois alelos, p e q, se um dos parâmetros varia o outro necessariamente também irá variar, porque p + q= 1. Ou seja, quando p é 0,9, q é 0,1. Se p varia de 0,9 para 0,7, q também varia na mesma proporção. Assim, quando trabalhamos com dois alelos, temos apenas um grau de liberdade, porque apenas um dos parâmetros pode variar, sendo necessariamente acompanhado por uma variação no outro parâmetro (alelo). Já quando se trabalha com sistemas de 3 alelos, têm-se 2 graus de liberdade, já que dois dos parâmetros (alelos) podem variar de qualquer forma, sendo que o terceiro terá que se ajustar de acordo com as variações dos outros dois. 7

8 Um pouco de história Modelos matemáticos têm sido utilizados em genética desde o final do século XIX. Um dos primeiros e mais populares modelos matemáticos para o estudo de genética de populações foi introduzido por Godfrey Harold Hardy, um matemático de Cambridge. Em 1908, Hardy enviou uma carta ao editor da revista Science onde ele contestava a idéia de que uma característica genética dominante teria a tendência de se espalhar pela população ao longo das gerações, enquanto uma característica recessiva teria a tendência a desaparecer. Para contestar tal idéia, Hardy demonstrou que não havendo a atuação da evolução, as freqüências genotípicas se manteriam em equilíbrio ao longo da evolução. De acordo com Hardy, somente a presença de forças evolutivas poderia alterar as freqüências genotípicas. Através de um simples modelo matemático, Hardy demonstrou que a atuação apenas dos mecanismos mendelianos não poderia alterar as freqüências gênicas de uma população. A equação apresentada no artigo intitulado Mendelian proportions in a mixed population representou o primeiro passo para a formulação do equilíbrio de Hardy-Weinberg e o conseqüente nascimento da genética de populações. No entanto, por quase 40 anos esta equação ficou conhecida apenas como Lei de Hardy. Em 1943, Curt Stern, do Departamento de Zoologia da Universidade de Rochester, enviou uma carta à mesma revista Science onde informou que em 13 de janeiro de 1908, Wilhelm Weinberg havia apresentado uma palestra em que demonstrava o mesmo equilíbrio proposto por Hardy, na mesma época. Assim como os trabalhos de Mendel, a palestra de Weinberg havia sido publicada numa obscura revista científica e ficou desconhecida por quase 40 anos. Curt Stern então sugeriu que seria uma questão de justiça e de reconhecimento ao trabalho de Weinberg, que a equação passasse a levar o nome dos dois cientistas. Desde então a equação tem sido conhecida como Equilíbrio de Hardy-Weinberg. Referências G. H. Hardy, Mendelian proportions in a mixed population. Sci. New Ser. 28, (1908). Curt Stern. The Hardy-Weinberg Law Science, New Series, Vol. 97, No. 2510: (Feb. 5, 1943). Para saber mais sobre o Equilíbrio de Hardy-Weinberg, visite os links abaixo How to Use Hardy-Weinberg to Find Gene Frequencies in a Wild Population MODELO DE HARDY-WEINBERG 8

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Capítulo 2 Endogamia. Acasalamentos Preferenciais. Introdução

Capítulo 2 Endogamia. Acasalamentos Preferenciais. Introdução Capítulo 2 Endogamia Acasalamentos Preferenciais Introdução No capítulo anterior foi demonstrado que se os acasalamentos forem aleatórios, as populações têm proporções genotípicas equivalentes às calculadas

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Genética de Populações Genética Básica - Bio 240 Profa. Karla Yotoko Capítulo 1 Introdução à Genética de Populações Equilíbrio de Hardy-Weinberg

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos.

Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Ambiente Genótipo Caixa Preta Fenótipo Complexidade A grande maioria

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq)

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq) QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL Questão 01 O agente oxidante mais importante em águas naturais é, sem a menor dúvida, o oxigênio molecular dissolvido, O 2. O equilíbrio entre o oxigênio

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Modelagem de um Ambiente para Análise de DNA em Genética Forense

Modelagem de um Ambiente para Análise de DNA em Genética Forense Dissertação de Mestrado Modelagem de um Ambiente para Análise de DNA em Genética Forense FelipeJosédeQueirozSarmento Biólogo felipesarmento@yahoo.com.br Orientadora: Prof a.dr a. Eliana Silva de Almeida

Leia mais

Complexidade. Fenótipo é qualquer característica mensurável.

Complexidade. Fenótipo é qualquer característica mensurável. Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Isto se tornou um problema sério para o Mendelismo e para a teoria

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Genética clássica: mono, di e polihibridismo, alelismo múltiplo. A PRIMEIRA LEI DE MENDEL OU PRINCÍPIO DA

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores.

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores. BIO V7 CAP 19 19.01 O genótipo do casal III-2 e III-3 é X A X a x X a y. Fazendo o cruzamento os filhos podem ser: X A X a, X A Y, X a X a, X a Y. Como se pode observar qual é o masculino e qual é o feminino,

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA O O uso uso deste deste material material é é autorizado autorizado desde desde que que sejam sejam atribuídos atribuídos os os direitos direitos

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA OS FUNDAMENTOS DA HEREDITARIEDADE EXPERIMENTO Teste de paternidade 1. Resumo Essa aula propõe a simulação de um teste de paternidade por meio da análise de

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Modelos BioMatemáticos

Modelos BioMatemáticos Modelos BioMatemáticos http://correio.fc.ul.pt/~mcg/aulas/biopop/ Pedro J.N. Silva Sala 4.1.16 Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Pedro.Silva@fc.ul.pt Genética

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO Cynthia Germoglio Farias de Melo cynthia_fariasm@hotmail.com Rayner Anderson Ferreira do Nascimento raynerbiomedicina@gmail.com

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO CUNHA, Marielton dos Passos 1 ; OLIVEIRA, Bruno Francesco Rodrigues de 1 ; RESENDE, Isa Murielly

Leia mais

Genética Conceitos Básicos

Genética Conceitos Básicos Genética Conceitos Básicos O que é genética? É o estudo dos genes e de sua transmissão para as gerações futuras. É dividida em: Genética Clássica Mendel (1856 1865) Genética Moderna Watson e Crick (1953).

Leia mais

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA UNIVERSIDADE FEDERAL RURAL DA AMAZÔNIA DISCIPLINA DE GENÉTICA GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA Profa. Dra. Mônica Gusmão Engenheira Agrônoma Profa. Mônica Gusmão PERGUNTAS FUNDAMENTAIS DOS PADRÕES

Leia mais

A Genética Mendeliana

A Genética Mendeliana MATERIAL DE APOIO A Genética Mendeliana O conceito de um fator hereditário como determinante das características de um indivíduo foi introduzido primeiramente por Gregor Mendel em 1865, embora ele não

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Contextualizando. Capítulo 2

Contextualizando. Capítulo 2 Capítulo 2 A Teoria Sintética Introdução Você já deve ter notado que para Darwin estar correto é preciso uma condição básica: tem de haver diferenças entre os organismos de uma determinada espécie, de

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

HERANÇA MONOGÊNICA 1ª LEI DE MENDEL. Gregor Mendel : => Nasceu na Morávia, império Austro-húngaro. Gregor Mendel

HERANÇA MONOGÊNICA 1ª LEI DE MENDEL. Gregor Mendel : => Nasceu na Morávia, império Austro-húngaro. Gregor Mendel Genética Mendeliana: aquela determinada por um ou poucos genes, cuja epressão não é influenciada ou é pouco afetada pelo meio. HERANÇA MONOGÊNICA => Conceito de gene (mas não o termo) => foi proposto pela

Leia mais

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel 1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel Quadrado de Punnet Segregação fenotípica 3/4 Preto 1/4 marron

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

(baseado em 1 avaliações)

(baseado em 1 avaliações) Experimento cadastrado por Luara augusta batista em 01/08/2011 Classificação Total de exibições: 2029 (até 07/08/2012) (baseado em 1 avaliações) Palavras-chave: mendel, ervilhas, segunda lei de mendel,

Leia mais

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO DO MATERIAL GENÉTICO CELULAR Massa compacta, ocupando um volume limitado As suas variadas actividades, tal como replicação e transcrição, têm

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA RAZÃO DE PROBABILIDADE BAYESIANA COMO EVIDÊNCIA PARA TESTE DE VÍNCULO DE PATERNIDADE Curitiba 2012 I Dianna Lo Wai Yan Maurício Fernandes do Nascimento

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Áudio. GUIA DO PROFESSOR Mendel, o pai da genética - Parte I. Os fundamentos da hereditariedade: Biografia de Gregor Mendel

Áudio. GUIA DO PROFESSOR Mendel, o pai da genética - Parte I. Os fundamentos da hereditariedade: Biografia de Gregor Mendel Mendel, o pai da genética - Parte I Conteúdos: Tempo: Objetivos: Descrição: Produções Relacionadas: Os fundamentos da hereditariedade: Biografia de Gregor Mendel 5 minutos para cada áudio. Avaliar se o

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Atividade prática Quem é o pai? Quem é o criminoso?

Atividade prática Quem é o pai? Quem é o criminoso? Aluno: nº Atividade prática Quem é o pai? Quem é o criminoso? OBJETIVOS Compreender a importância prática da Engenharia Genética na identificação das pessoas. Conhecer os princípios básicos da manipulação

Leia mais

Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações

Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações GENÉTICA DE POPULAÇÕES Quando estudamos, em determinada família ou linhagem, o modo

Leia mais

Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia

Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia Todos os direitos reservados ao O DNA vai à Escola. 2008 www.odnavaiaescola.org Conteúdo deste módulo Polimorfismo de DNA Técnica de eletroforese de DNA Teste de DNA Enzimas de restrição Apostila da Oficina

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais