Exercício 3 PCR Reação em Cadeia da Polimerase

Tamanho: px
Começar a partir da página:

Download "Exercício 3 PCR Reação em Cadeia da Polimerase"

Transcrição

1 Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter em mãos apenas uma gota de sangue ou de saliva para testar; um evolucionista pode querer analisar um exemplar de um museu sem destruí-lo. Mesmo que se tenha uma grande quantidade de tecido, seria trabalhoso purificar o DNA em larga escala. Em 1985, foi introduzida uma técnica revolucionária. Esta técnica permite gerar uma grande quantidade de cópias de um fragmento de DNA específico. Ela foi inventada por um cientista de indústria farmacêutica chamado Kary Mullis, que teve sua inspiração inicial numa noite em 1983 quando ele estava dirigindo e pensando sobre um problema técnico que ele estava enfrentando em seu trabalho. A essência da idéia de Mullis é o seguinte: se você pudesse colocar em um tubo uma reação na qual a DNA polimerase duplicasse uma única fita-molde de DNA em 2 moléculas, estas em 4, então em 8, 16, 32, etc, você teria um número virtualmente infinito de cópias da molécula original. Cada ciclo da síntese de DNA dobraria o número de moléculas iniciais: uma reação em cadeia produzindo fragmentos específicos de DNA. A nova técnica de Mullis foi chamada de reação em cadeia da polimerase (Polymerase Chain Reaction) ou PCR. Naturalmente, Mullis fez mais do que apenas perceber que a DNA polimerase pode copiar uma hélice de DNA em duas. Você também já sabia disto. O que ele fez foi imaginar como realizar a reação in vitro e como utilizar esta reação para copiar um segmento de DNA de interesse. O método de Mullis se baseia nas características das enzimas DNA polimerases e no processo de hibridação. Lembre-se de que as DNA polimerases devem ter um iniciador (primer) pareado a uma fita molde para sintetizar uma fita complementar e também que a hibridação é um processo espontâneo no qual as bases formam pares complementares. Você pode separar duas fitas de uma hélice pelo calor, mas se resfriá-las, elas tornarão a se unir. Mas como Mullis utilizou a DNA polimerase e a hibridação para realizar a reação em cadeia de síntese do DNA? Siga a Figura 1 durante a explicação.

2 Primeiro você deve decidir qual segmento do DNA você deseja duplicar (os pesquisadores dizem amplificar ao invés de duplicar porque eles estão fazendo muitas cópias). Então você sintetiza duas moléculas de DNA de fitas simples curtas (20 a 28 nucleotídeos) e complementares às extremidades do segmento que você escolheu. Estas duas moléculas pequenas devem ter características específicas. Observe o início da figura 1 (ciclo 1). Estão esquematizadas uma fita dupla de DNA e duas cópias de duas moléculas pequenas de DNA de fita simples. Cada uma das moléculas de fita simples é complementar a apenas uma fita do DNA parental e cada uma é complementar apenas à porção final do segmento. Além disso, se você imaginar estas moléculas pequenas pareadas às regiões complementares respectivas na fita-dupla, os seus finais 3' vão apontar um para o outro. Estas moléculas pequenas e de fita-simples são chamadas de iniciadores (primers). Para realizar a PCR uma grande quantidade de iniciadores e de molécula-molde são misturadas em um tubo contendo um tampão e muitos deoxinucleotídeos trifosfatados. Esta mistura é aquecida até quase a ponto de ebulição e então as fitas das moléculasmolde desnaturam (se separam uma da outra). Depois, esta mistura é resfriada. Eventualmente, as fitas da molécula parental de DNA se reúnem, mas como há uma grande quantidade de iniciadores na mistura, alguns deles encontram seus sítios complementares nas fitas-molde antes que estas se reúnam (Hibridação do primer com a fita-molde na figura 1). Agora a DNA polimerase é adicionada à reação. Os iniciadores hibridados à molécula-molde são os pré-requisitos para que a DNA polimerase inicie a síntese do DNA. A DNA polimerase começa a adicionar os deoxinucletídeos no final 3' dos iniciadores, formando uma nova fita complementar (Síntese do DNA na figura 1). Após um curto espaço de tempo, a mistura é novamente aquecida. Agora, as duas fitas-molde novas desnaturam, resultando em quatro fitas-simples (Desnaturação no ciclo 2 da figura 1). A mistura é resfriada e os iniciadores se hibridam às moléculas de fita simples (Hibridação, ciclo 2). A DNA polimerase é adicionada à reação e os deoxinucleotídeos são adicionados ao final 3' dos iniciadores hibridados, formando quatro moléculas de fita-dupla (Síntese de DNA, ciclo 2). Note que duas das fitas recém-sintetizadas começam e terminam nos sítios de hibridação dos iniciadores. Este processo de desnaturação, hibridação e síntese de DNA se repete de 25 a 45 vezes, resultando em um grande número de moléculas. A grande maioria das moléculas recém-sintetizadas vai de um sítio de hibridação do iniciador ao outro.

3 Então, o pesquisador pode escolher qual segmento será amplificado através da escolha dos iniciadores. Hoje a PCR é utilizada rotineiramente para muitos propósitos diferentes: para amplificar um fragmento específico de DNA para clonagem, para gerar um fingerprint de uma amostra muito pequena de DNA, para o diagnóstico de doenças, etc. Um aperfeiçoamento técnico do processo tornou a PCR muito mais fácil. Você notou que a DNA polimerase foi adicionada antes de cada síntese de DNA? Isto porque as primeiras PCR utilizavam a DNA polimerase da Escherichia coli, a qual é inativada sob alta temperatura. Então, a enzima deveria ser acrescentada a cada ciclo de síntese. Posteriormente, foram isoladas enzimas de microrganismos que vivem em águas oceânicas profundas. Estas enzimas não são inativadas pelo calor e resistem às temperaturas elevadas necessárias para a síntese do DNA. Hoje a PCR é realizada com DNA polimerases resistentes ao calor, e então é adicionada apenas uma vez no início da reação. A DNA polimerase mais utilizada é a Taq DNA polimerase (proveniente da bactéria Thermus aquaticus). Quando a PCR foi desenvolvida, utilizava-se três banhos-maria com as temperaturas necessárias para desnaturação, hibridação e síntese do DNA. Os pesquisadores transferiam os tubos de um banho para outro. Posteriormente foi desenvolvida uma máquina que altera rapidamente as temperaturas necessárias, chamada de termociclador. Hoje a PCR é realizada através da adição de DNA, iniciadores, tampão, deoxinucleotídeos e DNA polimerase em um tubo e este é levado ao termociclador, que pode ser programado com as temperaturas e o número de ciclos necessários, e espera-se até que os ciclos tenham sido completados (cerca de 2 a 4 horas). Porém, só se aprende a fazer PCR com a prática. E por isso você vai simular uma PCR e um teste diagnóstico baseado em PCR no papel (você pode pintar o DNAmolde, os iniciadores e as moléculas recém-sintetizadas para facilitar a sua compreensão).

4 Ciclo 1 Ciclo 2 Fita-dupla de DNA parental Desnaturação 5 3 TCGAA TCGAA 3 5 Iniciadores de fita simples 3 GGGCC 5 Desnaturação Hibridação Hibridação 5 3 GGGCC 5 Síntese do DNA Síntese do DNA 3 GGGCC 3 GGGCC 3 GGGCC Figura 1. PCR 3 GGGCC TCGAA 5 etc

5 Questões 1. O que um cientista deveria saber antes de desenvolver um teste de diagnóstico baseado na PCR para o vírus X? 2. Como um cientista pode se assegurar de que os iniciadores que ele desenvolveu vão hibridar apenas com o segmento de DNA que ele deseja amplificar? 3. Escreva uma expressão matemática que prediz o número de moléculas geradas a partir de uma única fita-dupla de DNA após n ciclos de síntese. 4. Prediga o número de fitas de DNA produzidas que não são delimitadas pelos iniciadores e que seriam geradas a partir de uma molécula de DNA de fita-dupla após n ciclos de síntese. 5. Você poderia amplificar um DNA utilizando apenas um iniciador? Quais seriam os produtos após um ciclo? Dois ciclos? Quatro ciclos?

6 Molécula de DNA parental e iniciadores para a PCR 5 TACGATGTCAAAGTTAGCTTAGTCA 3 5 TACGATGTCAAAGTTAGCTTAGTCA 3 5 TACGATGTCAAAGTTAGCTTAGTCA 3 5 TACGATGTCAAAGTTAGCTTAGTCA

7 Amostras de DNA e iniciadores para o diagnóstico baseado na PCR

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

O complexo maquinário de replicação e suas enzimas

O complexo maquinário de replicação e suas enzimas O complexo maquinário de replicação e suas enzimas AULA 10 objetivos Ao final desta aula, você deverá ser capaz de: Apresentar os diferentes componentes do maquinário de replicação. Conhecer as diferentes

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Escola Secundária Dr. Manuel Gomes de Almeida

Escola Secundária Dr. Manuel Gomes de Almeida Escola Secundária Dr. Manuel Gomes de Almeida Ficha de trabalho de Biologia - 12º Ano Fermentação e actividade enzimática Nome: N º: Turma: Data: 1. A figura 1 representa um tipo de fermentação. Figura

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

PROF. KELTON WADSON OLIMPÍADA 8º SÉRIE ASSUNTO: TRANSFORMAÇÕES DE ESTADOS DA MATÉRIA.

PROF. KELTON WADSON OLIMPÍADA 8º SÉRIE ASSUNTO: TRANSFORMAÇÕES DE ESTADOS DA MATÉRIA. PROF. KELTON WADSON OLIMPÍADA 8º SÉRIE ASSUNTO: TRANSFORMAÇÕES DE ESTADOS DA MATÉRIA. 1)Considere os seguintes dados obtidos sobre propriedades de amostras de alguns materiais. Com respeito a estes materiais,

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

II AS OLIMPÍADAS DE BIOTECNOLOGIA

II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA FINAL 14 de Maio de 2007 Nas folhas de respostas preencha o cabeçalho com os seus dados e os da escola que representa. A prova tem a duração de 30 minutos. Cada resposta

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE ZOOLOGIA E GENÉTICA

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE ZOOLOGIA E GENÉTICA MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE ZOOLOGIA E GENÉTICA Março 2008 Texto Didático (revisado em agosto 2008) Drª Judith Viégas, Profª Adjunta BIOLOGIA

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA REPLICAÇÃO DO Plano de Aula -Composição e estrutura do - e Hereditariedade -Processo de replicação REPLICAÇÃO DO Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DIVISÃO CELULAR E REPLICAÇÃO Bibliografia

Leia mais

Produção de Proteínas Recombinantes em Escherichia coli

Produção de Proteínas Recombinantes em Escherichia coli Produção de Proteínas Recombinantes em Escherichia coli Prof. Dr. Catarina Akiko Miyamoto 1 Resumo A produção de proteínas recombinantes para fins terapêuticos, veterinários, e agro-pecuários tem se mostrado

Leia mais

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA OS FUNDAMENTOS DA HEREDITARIEDADE EXPERIMENTO Teste de paternidade 1. Resumo Essa aula propõe a simulação de um teste de paternidade por meio da análise de

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D e-mail:melmenezes@dnanalise.com.br DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

PLANO DE AÇÃO Prevenção da Disseminação de Enterobactérias Resistentes a Carbapenens (ERC) no HIAE. Serviço de Controle de Infecção Hospitalar

PLANO DE AÇÃO Prevenção da Disseminação de Enterobactérias Resistentes a Carbapenens (ERC) no HIAE. Serviço de Controle de Infecção Hospitalar PLANO DE AÇÃO Prevenção da Disseminação de Enterobactérias Resistentes a Carbapenens (ERC) no HIAE Serviço de Controle de Infecção Hospitalar Fev 2011 1 Como prevenir a disseminação de Enterobactérias

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

II AS OLIMPÍADAS DE BIOTECNOLOGIA

II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA Duração da prova: 120 minutos 2007 1ª ELIMINATÓRIA Na folha de respostas preencha o cabeçalho com os seus dados e os da escola que representa. O teste tem a duração de

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

AMPLIFICAÇÃO DE DNA PELA TÉCNICA DE PCR REALIZADA EM SALA DE AULA UTILIZANDO MOLDES DE PAPEL

AMPLIFICAÇÃO DE DNA PELA TÉCNICA DE PCR REALIZADA EM SALA DE AULA UTILIZANDO MOLDES DE PAPEL AMPLIFICAÇÃO DE DNA PELA TÉCNICA DE PCR REALIZADA EM SALA DE AULA UTILIZANDO MOLDES DE PAPEL 1. Introdução 1 Lanusse Andrade Fernades (UEG) Lanusse.biologia@gmail.com Flávio Monteiro Ayres (UEG) flavioayres@yahoo.com

Leia mais