Sequenciamento de DNA

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Sequenciamento de DNA"


1 Sequenciamento de DNA

2 Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008)

3 Método de Sanger Reação de síntese de DNA por uma DNA polimerase

4 A incorporação de um dideoxinucleotídeo interrompe a síntese da nova fita

5 Figure 8-50b Molecular Biology of the Cell ( Garland Science 2008)

6 Atualmente usamos dideoxinucleotídeos marcados com corantes fluorescentes de diferentes cores. Quando um dideoxinucleotídeo é incorporado, a síntese da fita é interrompida, e a coloração é dada pela última base incorporada

7 94 o C Milhões de cópias de DNA dupla fita a ser sequenciado 5 CGAAGTCGAGCCAGTTAAACGGCCATGGTACCAATGA 3 3 GCTTCAGCTCGGTCAATTTGCCGGTACCATGGTTACT 5 55 o C O primer seleciona a fita 3 GCTTCAGCTCGGTCAATTTGCCGGTACCATGGTTACT 5 5 CGAAG 3 dctp dctp dctp ddctp dgtp datp dttp dgtp datp dttp dgtp datp dttp ddgtp ddatp ddttp 5 CGAAGTC 5 CGAAGTCG 5 CGAAGTCGA 5 CGAAGTCGAG 5 CGAAGTCGAGC 5 CGAAGTCGAGCC 5 CGAAGTCGAGCCA 5 CGAAGTCGAGCCAG 5 CGAAGTCGAGCCAGT 5 CGAAGTCGAGCCAGTT Muitas cópias de cada um desses comprimentos A cor define a base que terminou o seguimento

8 Eletroforese em capilares. Um sistema de detecção a laser identifica a base marcada e envia a informação a um computador


10 Phred 10: P = 10% Phred 20: P = 1% Phred 56: P = 0,00025% Usualmente o cutoff usado é 20

11 Se tem dois alelos diferentes, algumas das fitas-templates terão um nucleotídeo e as outras um outro distinto na mesma posição

12 Next Generation Sequencing (NGS) Purificação do DNA ou RNA-cDNA Ligação a um substrato Amplificação por PCR para gerar uma representação clonal da molécula original a ser sequenciada Sequenciamento (Polimerase ou ligase) Química para gerar sinais luminosos Registros dos sinais com métodos de detecção ultrasensíveis

13 Aplicações de sequenciamento de próxima geração Deep-Sequencing Novo sequenciamento Resenquenciamento Hi-C ChIP-Seq RNA Seq Montagem Mapeamento Mapeamento Mapeamento Mapeamento Anotação SNPS / INDEL outras variantes Reconstituição 3D Detecção de Sítios de ligação Montagem dos transcritos Detecção de local de splice Quantificação Genoma Cromatina Transcriptoma Filogenia/Evolução/Ecologia Diferenças genéticas individuais Organização genômica Arquitetura genômica 3D Interações entre ácidos Nucléicos e Proteínas Atividade genômica Interações entre ácidos nucléicos e proteínas Abundância de transcritos Vias co-reguladas Clusters genênicos co-regulados

14 Hi-C

15 ChIP-Seq

16 Enriquecimento das amostras com as sequências de interesse: captura Primers específicos para as sequências de interesse são prepardos em microgotas DNA genômico fragmentado associado aos demais reagentes para PCR

17 Captura em fase sólida Microarrays com as sequências de interesse

18 Sondas de RNA com as sequências de interesse marcadas com biotina

19 Enriquecimento por MIPs (molecular Inversion Probes) a) Azul: sequência padrão Coloridos: sequências específicas a serem selecionadas O Espaço é preenchido com DNA polimerase e ligase b) Azul: sequencias complementares a sítios de restrição (coquetel de enzimas) Coloridos: segmentos de DNA digeridos com as enzimas de restrição

20 PET sequencing strategy: modo de envidenciar a ligação entre duas Pared-end tag: PET extremidades de um segmento de DNA Segmento de DNA genômico Tags No sítio de inserção, o vetor tem sítio para uma enzima de restrição que corta à frente do sítio de reconhecimento Ex: EcoP151, que corta 27 pb adiante Meio da molécula de DNA genômico é eliminado As extremidades são ligadas Vector---Tag---Tag--Vector O Vetor é digerido, restando os segmentos de DNA correspondentes à extremidade de um segmento para ser sequenciado

21 Tag Linker Tag Pair-ended sem vetor

22 Análise do princípio de funcionamento de dois sequenciadores de última geração Life Technologies: SOLID Illumina/Solexa

23 SOLID Preparo da amostra - DNA genômico ou cdna Extração do DNA Fragmentação ((300 a 700 pb) Ligação de adaptadores seleção de fragmentos com ambos os adaptadores

24 Amplificação de fragmentos de DNA isolados

25 Sequenciamento





30 Técnica de sequenciamento: Azul: AA CC GG TT Vermelho: AT CG GC TA Verde: AC CA GT TG Laranja: AG CT GT TG

31 Vermelho: AT CG GC TA Ligação do adaptador com duas bases complementares à template Lavagem dos adaptadores não ligados. Leitura da florescência

32 O Fosfato 5 dos primers que não foram estendidos é retirado. Estes não serão sequenciados. Clivagem do adaptador com remoção do fluoróforo e criação de um 5 P

33 Nova adição de adaptadores, ligação, lavagem, leitura, clivagem. (n ciclos) Remoção da fita sequenciada em algumas posições. Adição de novo primer de sequenciamento, encurtado em uma base.

34 Primeira adição dos 4 probes e ligação do complementar. Complementar foi vermelho na primeira vez anteriormente Vermelho: AT CG GC TA Azul: AA CC GG TT segunda, na primeira vez, tem que ser o primeiro na segunda vez.





39 Illumina/Alexa a) Preparo da amostra: igual ao anterior b) Amplificação das moléculas: em cada uma das extremidades dos segmentos existem sequências complementares aos primers fixados na lâmina Bridge amplification



42 Leitura 1 Leitura 2 Leitura 3 Leitura 4 Leitura 5 Leitura 6

43 M. Nowrousian, 2010

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais


SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais Sibele Borsuk Sibele Borsuk Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA Sibele Borsuk Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D

Rachel Siqueira de Queiroz Simões, Ph.D Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Toxigenomics: Principles and aplication. Dr. André D. Luchessi

Toxigenomics: Principles and aplication. Dr. André D. Luchessi Toxigenomics: Principles and aplication Dr. André D. Luchessi NATAL DACT - PPgCF PROGRAMA DO CURSO TOXIGENÔMICA DEFINIÇÃO Em termos gerais toxigenômica são os estudos que envolvem

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins ( Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Análises moleculares - DNA

Análises moleculares - DNA Análises moleculares - DNA Como o mapeamento genético contribui para a genética médica? A caracterização de um gene e suas mutações aumenta a compreensão da doença Aplicações: -Desenvolvimento de diagnóstico

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Durante décadas o método de Sanger foi praticamente a única opção utilizada para sequenciamento de DNA Nos últimos anos surgiram novas tecnologias de sequenciamento

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais


MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais


SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

PCR Reação de Polimerase em Cadeia. Termociclador

PCR Reação de Polimerase em Cadeia. Termociclador PCR Reação de Polimerase em Cadeia Termociclador REAÇÃO EM CADEIA DA POLIMERASE (PCR) Técnica que permite a amplificação da quantidade de DNA específico utilizando a enzima Taq DNA polimerase, sequências

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Seqüenciamento de DNA

Seqüenciamento de DNA Seqüenciamento de DNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Recombinant DNA James Watson & Michael Gilman Guia de Rotas na Tecnologia do Gene Matthew Walker & Ralph Rapley

Leia mais


CONCEITOS DE BIOLOGIA MOLECULAR. Jorge Mondego CONCEITOS DE BIOLOGIA MOLECULAR Jorge Mondego Biologia Molecular Genome Transcriptome The OME -Era Proteome Metabolome - Entendimento da fisiologia e reprodução de microorganismos - Entendimento dos mecanismos

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais


PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Química de Ácidos Nucleicos

Química de Ácidos Nucleicos Biologia Molecular O termo Biologia Molecular é usualmente aplicado à Química de Ácidos Nucleicos Ácido Deoxirribonucleico - DNA Ácido Ribonucleico RNA Ciência Genômica A informação genética de todos os

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF PCR Desenvolvida

Leia mais

Sequenciamento de Nova Geração (NGS) Msc. Frederico Schmitt Kremer // doutorando PPGB

Sequenciamento de Nova Geração (NGS) Msc. Frederico Schmitt Kremer // doutorando PPGB Sequenciamento de Nova Geração (NGS) Msc. Frederico Schmitt Kremer // doutorando PPGB Nos episódios anteriores... Sequenciamento Clássico Engloba os métodos desenvolvidos por Sanger et al (1977) e Maxam

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais


CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Seqüenciamento (continuação )

Seqüenciamento (continuação ) Seqüenciamento (continuação ) Embrapa Recursos Genéticos e Biotecnologia Novas metodologias promissoras (2001) Seqüenciamento por hibridização Khrapko et al. (1989). FEBS Lett. 256: 118-122

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Diagnóstico Molecular da Tuberculose. Profa Dra. Cristiane Cunha Frota

Diagnóstico Molecular da Tuberculose. Profa Dra. Cristiane Cunha Frota Diagnóstico Molecular da Tuberculose Profa Dra. Cristiane Cunha Frota Complexo M. tuberculosis (MTB) - evolução Brosch et al., PNAS, 2002 Complexo MTB (10 espécies) Patógenos associados ao Homem: M. tuberculosis

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Princípios e Aplicações da Técnica de PCR

Princípios e Aplicações da Técnica de PCR Universidade Federal de Santa Catarina Centro de Ciências Biológicas XVIII Semana Acadêmica da Biologia- UFSC Curso teórico-prático Princípios e Aplicações da Técnica de PCR Prof. Dr. Rafael D Rosa Departamento

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

Técnicas de análise de DNA e RNA

Técnicas de análise de DNA e RNA Técnicas de análise de DNA e RNA Fundamento e aplicação das técnicas de análise de DNA Extracção, purificação, quantificação e detecção de ácidos nucleicos Electroforese convencional em gel de agarose

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS)

Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS) Universidade Estadual Paulista Júlio de Mesquita Filho Faculdade de Ciências Agrárias e Veterinárias Campus de Jaboticabal Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS) Dr. Camila

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais



Leia mais

Hibridação de ácidos nucleicos. de cromossomo a chip de DNA

Hibridação de ácidos nucleicos. de cromossomo a chip de DNA Hibridação de ácidos nucleicos de cromossomo a chip de DNA Hibridação de ácidos nucleicos Pareamento complementar de bases entre duas fitas simples de ácido nucleico DNA DNA RNA RNA DNA - RNA Hibridação

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais


Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e Perguntas para o roteiro de aula Professora: Drª Marilda S. Gonçalves Propriedades físico-químicas dos ácidos nucléicos 1) Descreva as principais características estruturais gerais das moléculas de DNA

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

Sequenciamento do DNA e suas aplicações

Sequenciamento do DNA e suas aplicações Sequenciamento do DNA e suas aplicações Prof. Dr. Júlio César Borges Alunos: Anderson da Silva Aguiar Bárbara Vieira Pinto Edvair Paula Moreira Filho Instituto de Química de São Carlos - IQSC Universidade

Leia mais

Fases do Ciclo Celular

Fases do Ciclo Celular Ciclo Celular Fases do Ciclo Celular Todas as células passam por um ciclo de vida que, assim como a vida de um organismo complexo, apresenta diferentes fases e é irreversível. Duração do ciclo celular

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: Blog:

Leia mais

Sequenciamento de genomas: princípios e métodos clássicos

Sequenciamento de genomas: princípios e métodos clássicos Sequenciamento de genomas: princípios e métodos clássicos Cesar Martins ( Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP Sequenciamento

Leia mais