Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014

Tamanho: px
Começar a partir da página:

Download "Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014"

Transcrição

1 Biologia Molecular Caderno de relatórios Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva Docentes: Dr. Cláudio Sunkel, Prof. Mariana Osswald 1

2 Extração de DNA genómico de Drosophila Melanogaster Objetivos Purificação de DNA genómico de Drosophila melagnoster; avaliação dos efeitos da ação de tratamentos físicos distintos na integridade do DNA isolado. Alterações ao procedimento experimental Durante o isolamento do DNA foi suprimido o passo da sua lavagem ( adicionar ao DNA precipitado 500 l de uma solução de lavagem de etanol 70% (frio) e centrifugar a rpm durante 2 minutos a 4 o C ). Na análise espectrofotométrica, foram colocados na cuvette 690 l de água ultra-pura e 10 l da amostra de DNA (resultando numa diluição a 70x e não 140x como descrito no procedimento). No estudo da ação dos diferentes tratamentos físicos na integridade do DNA genómico, foram colocados em todos os tubos eppendorf 9 l da amostra de gdna, em vez de 10 l. O tubo sujeito a aquecimento a 95 o C sofreu este processo durante 5 minutos (e não 10). g/ml) -1 cm -1 l = 1 cm Abs = ε c l = 0.02 * 1 * c c = 5.2 g/ml Antes da diluição a 70x : c = 5.2 * 70 = 364 g/ml Concentração de DNA na amostra Cálculo dos pesos moleculares das amostras Resultados experimentais Determinação da concentração e grau de pureza do DNA por espectrofotometria Abs 260 nm = Abs 280 nm = Abs 260 nm Abs 280 nm = 1.70 Grau de pureza da amostra Figura 1 Eletroforese em gel de agarose. Marcador de pares de bases (1); gdna (DNA genómico) (2); gdna vortexado intensamente (3); gdna aquecido a 95ºC (4); gdna pipetado múltiplas vezes (5); os poços de (6) a (10) são referentes aos trabalhos Extração de DNA plasmídico de Escherichia coli e Análise eletroforética de DNA digerido com enzimas de restrição. 2

3 Log (PM) Licenciatura em Bioquímica Tabela 1 Valores referentes aos pesos moleculares do marcador, à distância migrada de cada banda e ao logaritmo dos pesos moleculares. PM / pb d migrada /cm log (PM) A partir da regressão linear do logaritmo dos pesos moleculares (log PM) em função da distância migrada (d) obtém-se a seguinte equação: log (PM) = d r 2 = log(pm) = d R² = Distância migrada / cm Gráfico 1 Representação gráfica da distância migrada pelos marcadores de peso molecular em função do logaritmo do seu peso molecular e respetiva regressão linear. Tabela 2 Distâncias migradas por cada banda dos poços 2 a 5 e respetivo peso molecular obtido a partir da reta supra-referida. Poço Distância migrada/cm Peso molecular /Pb Não se observam bandas neste poço Discussão dos resultados/ Conclusão Devido às ligações duplas das bases azotadas, o DNA absorve radiação ultravioleta a 260 nm (tal como certos tipos de RNA). Deste modo, o método espectrofotométrico pode ser usado com alguma fiabilidade na determinação da concentração de DNA numa amostra. A concentração obtida foi de 364 g/ml. É de relevância determinar-se o grau de pureza da amostra, dado pela divisão entre a absorvância a 260 nm (proporcional à quantidade de DNA) e a absorvância a 280 nm (proporcional à quantidade de fenol e proteínas, cujos resíduos aromáticos são responsáveis pela absorção). Obteve-se um grau de pureza de 1.70, concluindo-se que a amostra se encontrava, possivelmente, contaminada com proteínas e fenol (valor inferior a 1.8; seria pura caso o grau de pureza estivesse contido entre 1.8 e 2.2). Uma alternativa a este método seria a utilização da fluorescência: o brometo de etídeo intercalado entre as bases da cadeia dos ácidos nucleicos emite fluorescência (cuja intensidade é proporcional à massa total de DNA), que quando comparada com uma série de padrões com quantidade de DNA conhecida, permite estimar a quantidade na amostra em estudo. 3

4 Pela análise eletroforética, conclui-se que o DNA genómico da Drosophila melagnoster tinha um peso molecular de cerca de Pb (é o componente mais pesado da amostra, logo migra uma menor distância no gel, correspondendo à primeira banda dos poços 2, 3 e 5). A presença de outras bandas nestes poços pode indicar a existência de contaminação (para além da com proteínas e fenol, determinada pelo método anteriormente descrito, o RNA também pode estar presente, uma vez que contém bases azotadas, logo, o brometo de etídeo intercala-se entre elas): a última banda dos poços 2, 3 e 5 poderá corresponder à presença de mrna e trna, enquanto que as bandas intermédias, um pouco difusas, poderão ser relativas à presença de rrna (das subunidades ribossomais grande e pequena), já que para além de mais pesado (e, portanto, movimenta-se menos), é também o RNA mais abundante, daí a maior intensidade das bandas. Nos poços 3 e 5, essas bandas poderão também corresponder a possível DNA fragmentado. De modo a eliminar-se a contaminação com RNA, poderia ter-se recorrido à adição de RNAses, que degradariam o RNA, tornando a amostra de DNA mais pura. Quanto ao poço 4, o facto de se ter submetido a amostra a elevadas temperaturas poderá ter levado ao supercoiling do gdna, fenómeno que o torna mais pequeno e, por isso, há uma maior migração no gel, o que explica o facto de não se observar nenhuma banda nesse poço (poderá ter corrido mais que o marcador de pesos moleculares). Por outro lado, também há a hipótese das incorrecta pipetagem no poço, levando à dispersão da amostra no gel antes da eletroforese começar. Assim, partindo da primeira possibilidade em relação ao poço 4, e dada a semelhança entre os poços 2, 3 e 5, pode concluirse que apenas as altas temperaturas podem destruir o gdna, ao contrário dos outros tratamentos físicos, múltiplas pipetagens e vórtex vigoroso, que não aftam a integridade do gdna. 4

5 Extração de DNA plasmídico de Escherichia coli Objetivo Preparar em pequena escala o plasmídeo psk polo de Escherichia coli (E.coli), separando e isolando o DNA plasmídico da bactéria. Alterações ao procedimento experimental Após se colocar 1.5 ml de cultura num tubo Eppendorf, procedeu-se à centrifugação a velocidade máxima durante apenas 1 minuto e não durante 3 minutos como descrito no protocolo. Avançou-se o passo de deixar incubar 5 minutos à temperatura ambiente após adicionar 4 L de lisozima ao sedimento. Já no último passo relativo à extração do DNA plasmídico aplicaram-se 10 L de amostra (ao invés dos 5 L referidos no protocolo) com 5 L de tampão de aplicação. Na preparação do gel de agarose, não se adicionou 1 L de brometo de etídeo mas sim 3 L Resultados experimentais Figura 1 Eletroforese em gel de agarose. Marcador de pares de bases (1); os poços de (2) a (5) são referentes ao trabalho Extração de DNA genómico de Drosophila Melanogaster ; DNA plasmídico (6); os poços de (7) a (10) dizem respeito ao trabalho Análise eletroforética de DNA digerido com enzimas de restrição Discussão dos resultados/ Conclusão De acordo com a observação da Figura 1, é possível afirmar que o DNA plasmídico revela ter um menor peso molecular que o DNA genómico, uma vez que foi o que apresentou uma banda de maior migração no gel, o que seria de esperar na medida em que estas porções de material genético são pequenos fragmentos do DNA bacteriano circular. Pela análise dos resultados obtidos por eletroforese, observa-se a existência de 2 bandas embora muito ténues - no poço 6, a nossa amostra de DNA plasmídico. Relativamente à banda que migrou menos, infere-se que poderá corresponder a dsdna (double-stranded DNA). Por outro lado, a banda de interesse, aquela que migrou mais no poço 6 que corresponde a DNA plasmídico parcialmente purificado, (cccdna - covalently closed circular DNA), é a que apresenta menor peso molecular, uma vez que se trata de uma forma mais compacta de DNA plasmídico dado o super-enrolamento (supercoilling effect) que lhe confere uma estrutura de menor raio hidrodinâmico que lhe permite uma maior mobilidade ao longo dos poros do gel de agarose. Por outro lado, ainda pode haver a possibilidade do DNA plasmídico estar contaminado com fragmentos de RNA uma vez que este migra distâncias próximas do DNA plasmídico dado o seu pequeno tamanho, além de a banda detetada com menor peso ser larga. Pode dizer-se que a banda apresenta um peso molecular na ordem dos pb, sendo este o

6 Caderno de relatórios de Biologia Molecular intervalo de valores para o peso do DNA plasmídico, podendo conter vestígios de RNA. Uma forma de tirar dúvidas relativamente a este parâmetro e de concluir com certeza a ausência de RNA seria a realização do tratamento da amostra com RNAses que degradam o RNA e realizar nova eletroforese. 6

7 Análise eletroforética de DNA digerido com enzimas de restrição Objetivos Estudar a ação das enzimas de restrição EcoR I e Hind III na digestão de uma amostra de DNA plasmídico e analisar o resultado dos cortes através da eletroforese em gel de agarose. Alterações ao procedimento experimental Na preparação das amostras, procedeu-se à preparação de 4 tubos Eppendorf diferentes. O primeiro tubo o de controlo continha apenas 2 L de DNA plasmídico e os restantes 18 L de água pura; o segundo tubo com EcoR I foi preparado de acordo com o protocolo assim como o terceiro tubo tubo com Hind III -; o último tubo Eppendorf preparado com as duas enzimas de restrição continha 2 L de DNA plasmídico, 2 L de tampão, 1 L de EcoR I e 1 L de Hind III e, por fim, 14 L de água pura. A incubação a 37ºC durou apenas 45 minutos (aproximadamente). Resultados experimentais Figura 1 Eletroforese em gel de agarose. Marcador de pares de bases (1); os poços de (2) a (5) são referentes ao trabalho Extração de DNA genómico de Drosophila Melanogaster ; DNA plasmídico (6); DNA plasmídico não digerido (7); DNA digerido com EcoR I (8); DNA digerido com Hind III (9); DNA digerido com EcoR I e com Hind III (10) Tabela 1 Valores referentes aos pesos moleculares referentes ao marcador, à distância migrada de cada banda e ao logaritmo dos pesos moleculares PM / pb d migrada /cm log (PM) A partir da regressão linear do logaritmo dos pesos moleculares (log PM) em função da distância migrada (d) obtém-se a seguinte equação: log (PM) = d r 2 = Aplicando a equação obtida às bandas correspondentes às amostras obtêm-se os pesos moleculares apresentados na tabela 4.

8 Tabela 2 Valores referentes às distâncias de migração das bandas das amostras e respetivos pesos moleculares o peso molecular do fragmento inserido é de aproximadamente 1200 pb. Controlo EcoR I d migrada /cm PM/ pb Hind III Hind III + EcoR I Discussão dos resultados e Conclusão Analisando o gel de agarose da figura 3, verifica-se que no poço 7 se identificam 2 bandas e uma terceira muito ténue, sendo as 3 bandas referentes às 3 formas de DNA plasmídico: DNA circular, DNA linear de cadeia dupla e DNA superenrolado. No poço 8 com DNA digerido com EcorI observam-se duas bandas, o que indica que existem dois locais de corte no plasmídeo recombinante. Originam-se, assim, dois fragmentos com pesos moleculares de, aproximadamente, 5000 e 1200 pb. Pode concluir-se que apenas existe um local de corte para a enzima de restrição HindIII analisando o poço 9 -, originando uma banda correspondente a um fragmento de DNA com peso molecular de cerca de 5600 pb. A presença de uma única banda (correspondendo a um local de corte) indica que o plasmídeo perde a sua conformação circular e adquire uma conformação linear Tendo sido o plasmídeo digerido com as duas enzimas (EcorI e HindIII) poço 10 observam-se três bandas, indo de encontro ao esperado. A inserção do gene polo foi feita entre um corte de EcoRI e HindIII. Assim, conclui-se que 8

9 Elaboração do mapa de restrição de um plasmídeo recombinante Objetivos Elaborar o mapa de restrição de um plasmídeo recombinante que contém um gene que codifica para uma subunidade da NADH desidrogenase. Proceder-se à análise dos pesos moleculares dos fragmentos obtidos após digestão dos plasmídeos com as enzimas de restrição Sal I, Hind III, Pst I, Xho I, Pvu II, Sac I e BamHI. Alterações ao procedimento experimental Não houve quaisquer alterações ao procedimento experimental. Figura 2 Eletroforese onde se inseriu o fragmento L Resultados experimentais Tabela 1 Valores referentes aos pesos moleculares referentes ao marcador, à distância migrada de cada banda e ao logaritmo dos pesos moleculares do fragmento L Figura 1 Eletroforese onde se inseriu o fragmento R PM / pb d migrada /cm log (PM) Reta de calibração: log (PM) = d

10 Log (PM) Log(PM) Licenciatura em Bioquímica y = x R² = Distância migrada / cm Gráfico 1 Representação gráfica da distância migrada pelos marcadores de peso molecular em função do logaritmo do seu peso molecular e respetiva regressão linear (correspondente à eletroforese relativa ao fragmento L) y = x R² = Distância migrada / cm Gráfico 2 Representação gráfica da distância migrada pelos marcadores de peso molecular em função do logaritmo do seu peso molecular e respetiva regressão linear (correspondente à eletroforese relativa ao fragmento R) Tabela 2 Valores referentes aos pesos moleculares referentes ao marcador, à distância migrada de cada banda e ao logaritmo dos pesos moleculares do fragmento R PM / pb d migrada /cm log (PM) Reta de calibração: log (PM) = d Tabela 3 Enzimas de restrição utilizadas, distâncias migradas e respetivos pesos moleculares das bandas dos fragmentos R e L Fragmento L Fragmento R Enzima PM/ PM/ d migrada /cm d pb migrada /cm pb BamHI Sal I Hind III Pst I Xho I Pvu II Sac I Xho I Sac I

11 Construção do mapa de restrição do vector pgem-3 com os fragmentos L e R Exemplo para o fragmento L Em primeiro lugar, é possível determinar o peso molecular do pgem-3 (sem o fragmento inserido), através do corte do plasmídeo com a enzima de restrição BamH I (apresenta apenas uma banda, cujo peso molecular corresponderá ao do pgem-3): 3427 pb. Observando o poço relativo à restrição da Sal I, nota-se que um dos fragmentos correu uma distância muito semelhante ao pgem-3 no poço correspondente à ação da enzima referida anteriormente. Logo, esse corresponderá ao vetor (cujo peso molecular é coincidente com o obtido pela restrição da BamH I) e o outro componente será o fragmento L. Portanto, como base na tabela 3, este tem 3754 pb de peso molecular. Tendo conhecimento que a Sal I corta o pgem-3 na posição 25, já é, então, possível saber onde se situa o fragmento, uma vez que foi inserido nesse local de corte. O segundo corte situa-se no local 3779 (3754 pb + 25 pb). Relativamente à enzima Hind lll, sabe-se que esta cisa em dois locais distintos, dado que se observam duas bandas na eletroforese. Sabe-se, ainda, que corta o pgem-3 no local 7. Assim, o outro local de corte irá situar-se no fragmento L (pois o vetor só é cortado uma única vez), a cerca de 2174 pb do primeiro, isto é, na posição 2181 (chegar-se-ia a uma posição semelhante caso fosse feito o processo inverso, isto é, pelo lado contrário ao dos ponteiros do relógio, subtraindo ao total o número de pares de bases do fragmento maior obtido). Quanto à enzima Pst l, tal como a Hind lll, também corta duas vezes o plasmídeo recombinante, uma delas na posição 23 do vetor e a outra no fragmento L, 1985 pb à frente do primeiro corte, portanto, no lugar Em relação à enzima de restrição Pvu II, como nas anteriores, verificou-se a existência de duas bandas. Como o primeiro corte se dá na posição 104 do vetor (a 79 pb do local de inserção do fragmento), então, localizar-se-á na posição 3858 (79 pb pb, nº de pares onde termina o fragmento). O outro local de corte será no fragmento, no local 3395 (3858 pb 463 pb). O poço relativo à restrição da enzima Sac I tem apenas uma banda, cuja distância migrada é a menor de todas as bandas observadas, logo, o fragmento terá maior número de pares de bases, pelo que se pode concluir que corresponderá ao plasmídeo recombinante (pgem-3 + fragmento L), que no seu total contém, segundo este raciocínio, 7099 pb. Sabendo que esta enzima digere o pgem-3 no local 56, o seu corte será na posição 3810 (56 pb 25 pb = 31 pb; 3779 pb + 31 pb = 3810 pb, uma dedução análoga à anterior). Por fim, como a Xho l não corta o pgem-3, não seria possível saber os seus dois locais de corte (visto que se observaram duas bandas no poço correspondente aos fragmentos obtidos após o seu corte) sem informação adicional, uma vez que ambos se situarão no fragmento, do qual não temos conhecimento. Assim, para a sua localização, é necessário recorrer aos resultados da restrição simultânea da Xho I e Sac I. Em conjunto, estas cortam em 3 sítios distintos, originando 3 fragmentos com diferentes pesos. Já se tendo determinado o local de corte da Sac I, verifica-se que um dos locais de corte da Xho I estará 1985 pb para trás desse, isto é, na posição 1825, e o segundo corte estará 1050 pb para trás desse, no local 775 (o peso molecular do fragmento obtido entre estes cortes, 1050 pb, é coincidente com o obtido com a restrição da Xho I isoladamente). Foi utilizado o mesmo método para a construção do mapa de restrição relativo ao plasmídeo recombinante resultante da inserção do fragmento R no pgem-3, uma vez que as enzimas de restrição usadas foram as mesmas. 11

12 Figura 3 Mapa de restrição resultante da ação de várias enzimas de restrição no plasmídeo recombinante (proveniente da inserção do fragmento L no vector pgem-3). Figura 4 Mapa de restrição resultante da ação de várias enzimas de restrição no plasmídeo recombinante (proveniente da inserção do fragmento L no vector pgem-3.

13 Discussão dos resultados/ Conclusão Neste trabalho prático foi possível compreender como se processa toda a metodologia para a construção de um mapa de restrição, desde a análise eletroforética à comparação dos pesos moleculares dos vários fragmentos, obtidos a partir da reta de calibração do gráfico Log (Peso Molecular) = f (distância migrada). estudo ganha extrema relevância quando se pretende, por exemplo, escolher fragmentos de DNA de menores dimensões para posterior subclonagem ou identificar fragmentos de DNA homólogos. De notar que este estudo permitiu uma análise relativa entre os cortes das várias enzimas de restrição, não sendo, portanto, de elevado rigor. Por exemplo, a soma dos pesos moleculares do vetor pgem-3 e de cada fragmento não é igual ao peso molecular do plasmídeo recombinante (pgem-3 e o fragmento nele inserido) que é dado, supostamente, pela restrição com Sac I (no caso do fragmento L, o peso molecular obtido para o fragmento resultante do corte com Sac I foi de 7099 pb e não 3427 pb pb = 7181 pb; no fragmento R obteve-se 7486 pb e 7561 pb, respetivamente). Por outro lado, a soma dos pesos moleculares dos fragmentos resultantes, no caso das enzimas que cisam mais do que uma vez, deveria ser a mesma em todos os casos e igual ao obtido com a restrição da Sac I. Contudo, embora não sejam exatamente iguais, não diferem significativamente. Estas observações revelam que, embora os resultados sejam relativamente aproximados, este é um bom método para determinar a localização física, ainda que relativa, dos locais de corte de várias enzimas. Este tipo de

14 PCR Polimerase Chain Reaction Objetivos Amplificar uma sequência de DNA genómico e de uma sequência de cdna por PCR. Analisar a eficiência e características do gdna e do cdna por eletroforese. Alterações ao procedimento experimental Na preparação das misturas de reação, adicionou-se 4 L de dntp s a cada tubo Eppendorf e não os 8 L referidos no protocolo. Realizaram-se 15 ciclos no amplificador termocíclico ao invés de 40 ciclos. Resultados experimentais Desenho dos primers O primer sense foi obtido através das regras existentes no protocolo e foi desenhado a partir da cadeia 5-3. Por sua vez, o primer antisense foi obtido a partir da cadeia 3-5 pois terá de ser complementar às bases que compõem a sequência escolhida, já que tem de a polimerizar. Extremidade 5 da sequência sense da porção para amplificar: 3 -CGGTTAACGGTTTTTCC-5 antisense primer Este primer, tal como o anterior, é constituído por 17 nucleótidos, dos quais 8 são citosinas ou guaninas (47% de G/C) e também apresenta uma temperatura de hibridação de 50ºC. Desta forma, o par de primers pode ser usado para efetuar PCR na medida em que ambos têm um número total de nucleótidos de 17 (dentro dos parâmetros entre 17 a 25 nucleótidos), o seu conteúdo em guaninas+citosinas está dentro do estipulado (entre 45 e 55%) e a T o m de ambos é a mesma. Portanto, estão reunidas as condições necessárias à realizaçãoo de uma PCR eficaz. Eletroforese De forma a avaliar a quantidade de produto obtido na PCR foi necessário efetuar uma eletroforese em gel de agarose 1%, apresentada abaixo na imagem 1: AGCTATGCTATGCTATGCTAGCCAGTCA GCTGAACGTG 3 5 GCTATGCTATGCTATGC 3 primer sense Este primer é constituído por 17 nucleótidos: 8 são citosinas ou guaninas (47% de G/C) e apresenta uma temperatura de hibridação de 50ºC. Extremidade 3 da sequência antisense: 3 AGATTAAGGTTCGGTTAACGGTTTTT CCTTGGC-5 Figura 1 Resultado da eletroforese respeitante à amplificação do produto obtido por PCR de cdna (2) e gdna (3), o poço 1 corresponde aos marcadores de peso molecular. 14

15 log (PM) Licenciatura em Bioquímica [Nota: A eletroforese apresentada corresponde ao PCR realizado na turma 2, uma vez que na nossa turma não existiam bandas relativas aos pesos moleculares, talvez porque aquando da aplicação no poço, a solução possa ter sido difundida no gel e não entrar toda no poço, não sendo observáveis bandas e, portanto, impossibilitanto o cálculo do peso molecular das amostras] Procedeu-se à medição das distâncias migradas pelo marcador de peso molecular, cujos valores se apresentam na Tabela 1: Tabela 1 Valores referentes aos pesos moleculares referentes ao marcador, à distância migrada de cada banda e ao logaritmo dos pesos PM / pb d migrada /cm log (PM) moleculares log (PM) = -0,3871 d + 4,6444 R² = 0, distância migrada / cm aos pontos e valor de coeficiente de correlação (R 2 ). Figura 2 Representação gráfica do logaritmo de pesos moleculares do marcador em função da distância percorrida, respetiva equação da regressão linear e valor de coeficiente de correlação Depois de medir as distâncias percorridas por cada uma das amostras, aplicou-se a equação obtida às bandas correspondentes às amostras obtendo-se os pesos moleculares sumariados na tabela 2. Tabela 2 Valores referentes à migração de cdna e gdna em gel de agarose e respetivo peso molecular d migrada /cm PM cdna 4,9 551 gdna 4,7 659 Realizando-se a regressão linear do logaritmo dos pesos moleculares (log PM) em função da distância migrada (d) obtém-se a seguinte representação gráfica, além da respetiva equação da regressão linear que mais se ajusta Discussão dos resultados/ Conclusão O primeiro ponto do trabalho prático era o desenho dos primers a serem usados na reação de PCR. O par de primers desenhados pode ser usado para efetuar PCR na medida em que ambos têm 15

16 um número total de nucleótidos de 17 (dentro dos parâmetros entre 17 a 25 nucleótidos), o seu conteúdo em guaninas+citosinas está dentro do estipulado (entre 45 e 55%) e a T o m de ambos é a mesma. Portanto, estão reunidas as condições necessárias à realização de uma PCR eficaz e obtenção de sucesso na amplificação. Para além disso, na extremidade 3 de ambos os primers detetam-se 2 resíduos G ou C, o que vai ajudar a uma correta hibridação neste local devido às fortes interações por pontes de hidrogénio entre os pares de bases G/C. Outro fator importante é a ausência de sequências complementares na mesma cadeia, para impedir a formação de estruturas secundárias e de homologias entre primers, evitando o emparelhamento entre eles. Estes dois aspetos referidos anteriormente são cruciais para que a formação de dímeros não ocorra, pois eles são sintetizados preferencialmente em relação a qualquer outro produto de PCR desejado. No ponto relativo à amplificação por PCR é importante referir que o gdna é mais pesado que o cdna (peso molecular mais elevado). Isto está relacionado com o facto de o cdna ser obtido por complementaridade de bases com o mrna através da ação da enzima transcriptase reversa. Assim, como não possui intrões, dado que estes são removidos durante o processamento do mrna (RNA splicing), o cdna apresenta apenas a região codificante, sendo mais leve. O mesmo não se passa com o gdna que possui intrões, exões e fragmentos reguladores da expressão génica, ou seja, tem na sua constituição toda a informação genética. Desta forma, é de esperar que a distância migraada pelo cdna seja maior na medida em que tem um número de bases inferior ao gdna. Além das bandas de interesse (as mais evidentes), existe o aparecimento de outras bandas de maior peso molecular (migram menor distância) e é importante fazer uma discussão consciente do seu aparecimento e a que correspondem. Relativamente ao cdna verificase o aparecimento de 3 bandas extra, enquanto que no gdna é possível observar apenas uma, além da mais evidente. Isto pode dever-se ao facto de, nas reações de PCR efetuadas, como foram realizados menos ciclos do que os devidos (foram realizados 15 em vez de 40), o gel foi muito mais corrido, levando ao aparecimento, além do produto obtido, da template que normalmente não é vísivel na eletroforese porque está bastante diluída, mas provavelmente foi o que aconteceu para a observação dessas bandas extra. Assim, as bandas mais ténues nos poços 2 e 3 podem deverse a fragmentos de DNA obtidos nos primeiros ciclos de PCR, pois neste caso o tamanho da cadeia ainda não é fixo. Já a banda mais intensa corresponde ao gene polo amplificado por PCR propriamente dito. 16

17 Transformação de Escherichia coli com DNA plasmídico Objetivos Transformar E.coli com DNA plasmídico. Transformar as células com plasmídeo pembl9, pembl9 CAT, pbr322 e pbr322 CAT. Avaliar a eficiência da transformação. Alterações ao procedimento experimental Não houve alterações ao procedimento experimental. Resultados experimentais Figura 3 -Placas com meios de cultura LA/Amp e Mac/Amp incubadas com plasmídeos pembl9- CAT Figura 1 - Placa com meio de cultura LA/Amp. Controlo Figura 4 - Placas com meios de cultura LA/Amp e LA/Amp/tet incubadas com plasmídeos pbr322 Figura 2 - Placas com meios de cultura LA/Amp e Mac/Amp incubadas com plasmídeos pembl9 Figura 5 - Placas com meios de cultura LA/Amp e LA/Amp/tet incubadas com plasmídeos pbr322-cat

18 Tabela 1 Contagem das colónias e avaliação da cor para as diferentes placas Figura 6 - Placa com meio de cultura Mac/Lac/Clo incubada com plasmídeos pbr322- CAT Meio de Nº de Plasmídeo Cor cultura colónias Controlo LA/Amp 0 - LA/Amp 700 Amarelo pembl9 Mac/Lac/Amp 500 Vermelho pembl9- CAT pbr322 pbr322- CAT LA/Amp 100 Amarelo Mac/Lac/Amp 50 Vermelho LA/Amp 25 Amarelo LA/Amp/Tet 0 Amarelo LA/Amp 100 Amarelo LA/Amp/Tet 0 Amarelo Tabela 2 Resultados observados aquando da transferência dos plasmídeos do seu meio inicial para o meio Mac/Clo. Plasmídeo Meio de Cultura Crescimento pbr CAT Mac/Clo Não pembl 9 Mac/Clo Não pembl 9 - CAT Mac/Clo Sim Figura 7 - Placa com meio de cultura Mac/Lac/Clo incubada com plasmídeos pembl9 Figura 8 - Placa com meio de cultura Mac/Lac/Clo incubada com plasmídeos pembl9- CAT Discussão dos resultados e Conclusão Analisando os resultados obtidos, verificase que ocorreu transformação das bactérias com os diferentes tipos de plasmídeos usados, pois nos meios contendo LA/Amp as colónias cresceram, ou seja, o gene de resistência à ampicilina foi incorporado e expresso com sucesso em todos os plasmídeos. Ainda, a disparidade de número de colónias que cresceram em LA/Amp nas placas com diferentes plasmídeos prende-se com o facto de uns serem mais resistentes que outros. Tal não se verficou apenas para o controlo, visto que neste caso as bactérias não tinham sido transformadas e, naturalmente, não possuíam a resistência ao antibiótico. 18

19 Além da resistência à ampicilina, o plasmídeo pembl9 possui o gene que codifica para a β-galactosidase, e então, quando está presente em meio Mac/Lac/Amp (contém lactose), crescem colónias de cor avermelhada. Assim, este meio induziu a expressão da β- galactosidase e a cor vermelha apresentada devese ao facto desta enzima dar origem a produtos acídicos (ácido pirúvico) durante a glicólise, o que faz diminuir o ph. Tal diminuição é detetada pelo indicador de MacConkey presente no meio em questão que, quando o ph apresenta valores baixos, indica a cor avermelhada. O mesmo não se verificou para o pembl9-cat, cujas colónias cresceram mas apresentam cor amarela/branca, uma vez o gene CAT, sendo inserido no meio do gene que codifica para a β-galactosidase, impediu expressão da β-galactosidase e assim, já não se observa a degradação da lactose com a consequente formação de ácidos. No que diz respeito às bactérias transformadas com o plasmídeo pbr322, que tinha na sua constituição genes que codificam para a resistência a dois antibióticos, a ampicilina e a tetraciclina, seria de esperar um crescimento tanto para o meio LA/Amp como para LA/Amp/tet. No entanto, tal não se verificou para o meio LA/Amp/tet, o que pode levar a inferir que, provavelmente, o gene de resistência à tetracicnlina não foi coreretamente inserido. Por outro lado, na presença do gene CAT, a sua inserção é feita no meio do gene que codifica para a resistência à tetraciclina, ou seja, a resistência não é expressa e as bactérias não sobrevivem ao meio contendo este antibiótico, observando-se que na placa contendo pbr322-cat em LA/Amp/tet não há crescimento de colónias, como seria de prever. Na placa contendo LA/Amp continua a haver crescimento das colónias na medida em que a inserção do gene CAT não implica a expressão do gene de resistência à ampicilina, uma vez que não é inserido na porção referente a esta resistência. Finalmente, é importante fazer referência à resistência das bactérias ao clorofenicol, que é induzida pela expressão do gene CAT. Sendo assim, seria de esperar crescimento em meio Mac/Clo das bactérias transformadas com pembl9-cat e pbr322-cat, enquanto que as com pembl9, por não ter sido inserido o gene CAT, não devem crescer pois não são resistentes ao clorofenicol. Contudo, apenas as bactérias transformadas com pembl 9 CAT cresceram. A razão para a ausência de crescimento de bactérias com pbr322 CAT poderá prender-se com um mau acondicionamento das colónias, uma transferência do meio inicial para o meio Mac/Clo pouco eficiente, além de se poder especular sobre o facto de as colónias transferidas serem, efetivamente, resistentes ao clorofenicol, na medida em que as bactérias transformadas com pbr322- CAT, apesar de terem o gene, podem não conseguir expressá-lo devido à falta dos elementos do promotor para se dar a transcrição. 19

20 Sequenciação de DNA Objetivos Sequenciar um gene pelo método de Sanger. Isolar uma proteína por métodos bioquímicos e determinar a sequência dos primeiros dez aminoácidos da região N-terminal. Alterações ao procedimento experimental Não houve alterações ao procedimento experimental. Resultados experimentais Sequência de aminoácidos: N terminal-ser-tyr-cys-leu-pro-met-ser-pro- Arg-Ala-C terminal Assim, temos diversas possibilidades para a sequência de nucleótidos que codifica esta sequência de aminoácidos: T/A C/G T/C/G/A T A T/C T G C/T C/T T A/G/C/T C C T/A/G/C A sequência reconhecida pela enzima de restrição EcoRI é : GAATTC A sequência reconhecida pela enzima de restrição HindIII é: AAGCTT Pela análise dos resultados da eletroforese (em anexo), é possível determinar a sequência de aminoácidos de 3 para 5 (cadeia antisense), pelo que é necessário, posteriormente, formar a cadeia complementar (cadeia sense 5 -> 3 ), obtendo-se assim as sequências: Sequência da amostra B 5 TAGCGAATTCATTATCCCGATCTAGTAA CGCATCCTCTAACTAGCGTGAATTATGTCATATTGCC TGCCCATGTCCCCGCGTGCGAAGCTTCGCCTA-3 Sequência da amostra C 5 -TAGCGAATTCAATCGACCCAGGTCACAACC TTCCGGCTCAAGCCTAACCTAGTTAAGACCCTATGTC TCCCCGAGCTAAGCTTCGCCTA-3 Os locais de restrição de EcoRI e HindIII estão sinalizados a azul e a verde, respetivamente; a cinzento está assinalado o codão de iniciação. O primer usado na amplificação por PCR hibridou com cada uma das sequências a negrito, sendo as sequências dos primers para cada um dos clones as seguintes: A- 3 - GGGTACAGCGGGGCA - 5 B- 3 - GGGTACAGGGGCGCA - 5 C- 3 GGATACAGAGGGGCT - 5 De modo a identificar qual dos clones codifica a sequência de aminoácidos pretendida, verifica-se qual a sequência (A, B ou C) que apresenta os codões que codificam para cada um dos aminoácidos da sequência. Assim verifica-se que o clone em causa é o B. 5 -TCATATTGCCTGCCCATGTCCCCGCGTGCG-3 N-terminal-Ser-Tyr-Cys-Leu-Pro-Met-Ser-Pro-Arg- Ala-C-terminal Sequência da amostra A 5 TAGCGAATTCACCAGGTTCCGAACATCGC CATTCCAGGGAACTCATTGAGTCTAGCCTAACTAACG ACCCATGTCGCCCCGTGAAAAGCTTCGCCTA-3 20

21 Discussão dos resultados/ Conclusão Pelo método de Sanger, foi possível determinar a sequência de nucleótidos correspondente à sequência de aminoácidos fornecida (obtida por espectroscopia de massa). Para além disso, foi descoberto o clone que codifica para a sequência de aminoácidos em causa. Pode, ainda, determinar-se a sequência dos primers utilizados em cada um dos PCR s dos diferentes clones. Analisando as sequências nucleotídicas, verificou-se a existência de uma sequência comum aos três: os dois primeiros nucleótidos são iguais, diferindo apenas no terceiro. Portanto, codificam o mesmo aminoácido, a prolina. O método de Sanger é o mais usado no que se refere à sequenciação de DNA. A determinação da sequência de um gene é de enorme relevância, dada a possibilidade de, a partir disso, se proceder à caracterização da estrutura genética, o que auxilia no estudo da regulação e expressão desse gene. Tais estudos são uma potencial ajuda ao nível do progresso das investigações em vários campos, como a medicina (no que toca à cura de diversas patologias, nomeadamente com origem genética). 21

22 Clonagem de cdna - γ-tub Objetivos Clonar o gene de cdna - γ-tub. Verificar experimentalmente o resultado da transformação de bactérias com DNA com diferentes tratamentos. Figura 1 Placas resultantes do crescimento de colónias de bactérias transformadas com a mistura reacional A e B, respetivamente. Alterações ao procedimento experimental A digestão e purificação do DNA foi realizada segundo o procedimento experimental sem qualquer alteração. No entanto para se proceder à ligação, prepararam-se 4 tubos (A, B, C e D) em vez de apenas um. Os tubos A, B, C e D continham os volumes indicados abaixo de vetor, insert, tampão (5x), T4 ligase e de água. Tabela 1 Volumes de vetor, insert, tampão, T4 ligase e água necessários à preparação dos 4 tubos A B C D Vetor 5 L 5 L - 5 L Insert 10 L 10 L 10 L - Tampão 4 L 4 L 4 L 4 L (5x) T4 ligase 1 L - 1 L 1 L Água - 1 L 5 L 10 L A transformação foi realizada em laboratório pelo que se assume que não tenha havido alterações ao procedimento experimental. Resultados experimentais Figura 2 Placas resultantes do crescimento de colónias de bactérias transformadas com a mistura reacional C e D, respetivamente Discussão dos resultados/ Conclusão A reação A corresponde ao conjunto de células incubadas em que se deveria verificar a clonagem do gene, no entanto isto não acontece pois não se verifica o aparecimento de colónias amarelas que, não expressando o gene LAC, não produzem -galactosidase e, por isso, não originam o abaixamento de ph. Observam-se, nesta placa, apenas colónias vermelhas, o que significa que produzem -galactosidase que degrada a lactose, originando ácidos, levando à dimnuição do ph (é este fator que provoca a cor vermelha das colónias). Assim, é possível concluir que as bactérias do tubo A não incorporaram cdna, na medida em que este é incorporado no meio do gene LAC, impedindo a sua expressão. Ora, se todas as colónias são vermelhas é porque o gene LAC é expresso. As placas B e C não apresentam colónias, conforme o esperado. Na primeira (placa B) não existe T4 ligase que permite que o insert se ligue

23 ao vetor ou que este recircularize, por isso, não se esperava o crescimento de colónias. Na segunda placa (C), não existe vetor pelo que também não se pode verificar o crescimento de colónias pois o insert não se pode ligar a si mesmo. No que diz respeito à placa D, observa-se o crescimento de colónias com cor vermelha. Nesta placa colocaram-se células sem insert pelo que as colónias que se observam correspondem ao vetor re-circularizado. As bactérias resistem à ampicilina e produzem -galactosidase, o que faz com que todas as colónias apresentem cor vermelha devido à diminuição do ph, como explicado para o caso da reação A, em que, não havendo cdna para ser incorporado, o gene LAC continua a ser expresso. Concuindo, a clonagem foi mal sucedida e isso pode dever-se a vários fatores: a purificação do DNA pode não ter corrido bem, o rácio entre a quantidade de insert e vetor pode não ter sido a mais indicada para o processo ocorrer da melhor forma e podem ter ocorrido problemas enzimáticos. No entanto, a inatividade da T4 ligase é um fator que não deverá ser usado para a argumentação na medida em que na placa D o vetor recircularizou, ou seja, a T4 ligase está ativa e portanto as bactérias cresceram nesse meio. 23

Relatórios de Biologia Molecular

Relatórios de Biologia Molecular Relatórios de Biologia Molecular 2013/2014 Professores: Dr. Claúdio Sunkel; Mariana Osswald Realizado por: Ana Isabel Sá; Ana Sofia Évora; Nuno Padrão 1 Extração de DNA genómico de Drosophila melanogaster

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resumo O propósito deste trabalho é testar a resistência de bactérias (Escherichia

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Prova de Química e Biologia

Prova de Química e Biologia Provas Especialmente Adequadas Destinadas a Avaliar a Capacidade para a Frequência dos Cursos Superiores do IPVC dos Maiores de 23 Anos Prova de Química e Biologia Prova modelo Prova Específica de Química

Leia mais

Escola Secundária Dr. Manuel Gomes de Almeida

Escola Secundária Dr. Manuel Gomes de Almeida Escola Secundária Dr. Manuel Gomes de Almeida Ficha de trabalho de Biologia - 12º Ano Fermentação e actividade enzimática Nome: N º: Turma: Data: 1. A figura 1 representa um tipo de fermentação. Figura

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Vanessa Diniz Barcelos Vasconcelos 2, Newton Portilho Carneiro 3 1 Trabalho financiado pelo CNPq/Fapemig

Leia mais