Relatórios de Biologia Molecular

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Relatórios de Biologia Molecular"

Transcrição

1 Relatórios de Biologia Molecular 2013/2014 Professores: Dr. Claúdio Sunkel; Mariana Osswald Realizado por: Ana Isabel Sá; Ana Sofia Évora; Nuno Padrão 1

2 Extração de DNA genómico de Drosophila melanogaster Objectivos Purificação de DNA genómico de Drosophila melanogaster e posterior avaliação das consequências da acção de diferentes tratamentos físicos na integridade do DNA isolado. Metedologia Procedimento Experimental Neste trabalho foram usadas uma colónia de moscas que foram tratadas com tampão de lise para proceder à libertação do material intracelular. Depois de homogeneizadas, foram centrifugadas e o sobrenadante recolhido. Toda esta fase do procedimento foi efectuada previamente, não tendo sido efectuado pelos alunos na aula. A fase de isolamento de DNA genómico e a fase seguinte, que consiste na determinação da concentração e grau de pureza do DNA foi efectuada sem alterações ao procedimento. A fase seguinte, que consiste na verificação da acção de tratamentos físicos sobre a integridade do DNA genómico sofreu algumas alterações ao procedimento, tais como a quantidade de amostra de DNA retirada ser de 9 μl em vez dos 10 μl propostos e o tempo de aquecimento em água para ebulição do DNA ter sido reduzido de 10 minutos para 5 minutos. Resultados Depois de isolado o DNA genómico, procedeu-se à determinação da sua concentração e grau de pureza. Mediu-se primeiramente a absorvância da amostra a dois comprimentos de onda: Tabela 1 Valores obtidos de absorvância da amostra a diferentes comprimentos de onda. Comprimento de Absorvância Onda (nm) Assim, para a concentração temos que a quantidade de radiação ultravioleta absorvida é directamente proporcional á quantidade de DNA na amostra. Usando a lei de Lambert-Beer para este efeito e sabendo a absortividade molar do DNA (ε= 0.02μg/mL.cm): Abs = ε l C Considerando l=1, a absortividade referida em cima e o valor de Absorvância a 260nm temos que: = 0.02 x 1 x C C = 5. 2 μg/ml Como a diluição foi de 5μL de amostra para 695μL de água: C = μg/ml 2

3 A razão Abs 260nm Abs 280nm dá nos o valor do grau de pureza, que tem de estar entre 1.8 e 2.2. λ A B C D Assim: Grau de pureza = = 1.65 A segunda parte do procedimento consistia na verificação da ação de tratamentos físicos sobre a integridade do DNA genómico. Assim, submeteu-se o DNA a 3 tratamentos: micropipetagem variadas vezes, vortexação e aquecimento até aos 95ºC com o objectivo de verificar se, ao submeter o DNA a estes tratamentos, este era alterado fisicamente. Para isso procedeu-se a uma electroforese para comparar a integridade do DNA genómico intacto e depois dos tratamentos referidos. Assim: λ Marcador de Peso Molecular Padrão A- DNA genómico sem tratamento B- DNAg Micropipetado C- DNAg Vortexado D- DNAg a 95ºC Figura 1 Eletroforese obtida. As várias bandas dos poços A a E são numeradas de cima para baixo, sendo a banda mais acima a número 1. 3

4 log (Peso Molecular) Relatório de Biologia Molecular Licenciatura de Bioquímica Tabela 2 Valores da distância migrada em cm do marcador de peso molecular (λ) e respectivos pesos moleculares. Tabela 3 Valores da distância migrada e respectivos pesos moleculares de cada banda dos 5 poços (A-E). Peso Molecular (Da) log (PM) Distancia (cm) , , , , , , , , , , , , , , , , , , , , , , ,7 Poço Banda Distancia Migrada (cm) Peso Molecular (Da) A 1 2, , , , ,35 866, , B 1 2, , ,3 1224, ,45 838, ,95 190, C 1 10,5 824, ,85 196, D 1 2, , , , ,55 810, E 1 5,5 4282, ,80-16,2 746, , ,5 4 3,5 3 2,5 2 1,5 1 0,5 0 Distância migrada = log(PM) R² = Distancia Migrada (cm) 4

5 Conclusões Este trabalho está dividido em 3 partes principais: extracção e purificação do DNA genómico da Drosophila melanogaster, determinação da concentração e grau de pureza deste mesmo DNA e ainda estudo da acção de vários tratamentos sobre a integridade da molécula em questão. Relativamente à primeira parte do procedimento, podemos dizer que tudo correu como esperado, menos na última fase, na qual em vez de se adicionar 900μL de etanol absoluto frio, usamos o etanol a 70%. Este erro pode justificar alguns valores fora do normal verificados aquando do cálculo grau de pureza e/ou concentração. Na segunda parte do procedimento, o valor da concentração foi de 722,8μg/mL, e o valor de grau de pureza foi de 1,65, valor que revela impurezas associadas ao DNA. Isto pode ser explicado pelo erro cometido na primeira fase do protocolo. Quanto à ultima parte, estudando a electroforese, podemos concluir que as bandas com maior peso molecular (perto das pares de bases) correspondem ao DNA genómico, mas contém elevado grau de impureza pois aparecem outras bandas nos vários poços com pesos moleculares inferiores, que podem corresponder a RNA que não foi eliminado (bandas mais migradas) ou mesmo DNA genómico que, devido a efeitos de supercoiling, migrou mais no gel de electroforese. O uso de RNAses pode ser uma mais valia para eliminar estes resíduos. Quanto aos tratamentos aplicados, concluímos que o único capaz de desnaturar o DNA foi o Vortex, resultado que não seria tanto de esperar como a desnaturação por aumento da temperatura, tratamento que, segundo a electroforese, desnaturou algum DNA pois a banda é menos intensa (no entanto, nesta, é ainda possível notar grande quantidade desta molécula, podendo isto dever-se à renaturação do DNA enquanto esperava para ser posto a correr no gel ou ao facto da temperatura não ter sido suficientemente elevada para desnaturar todo o DNA). As sucessivas micropipetagens não se traduziram em mudanças significativas no DNA, já que as bandas são muito similares às do DNA íntegro (poço A). 5

6 EXTRAÇÃO DE DNA PLASMÍDICO DE ESCHERICHIA COLLI Objectivos Resultados experimentais Preparação, em pequena escala, do plasmídeo psk-polo de E. Coli, sendo para isso necessária a separação de DNA plasmídico de DNA genómico da bactéria. Para o isolamento em questão, é seguido o procedimento de minipreparação de DNA por fervura rápida. Realização de uma eletroforese de DNA em gel de agarose, para apurar as dimensões do DNA plasmídico isolado, através da distância migrada pelos fragmentos. λ DNA plasmídico Metedologia Procedimento Experimental Relativamente ao primeiro passo do protocolo extração de DNA plasmídico de Escherichi Coli colocaram-se 1,5 ml da cultura de bactérias previamente crescida num tubo Eppendorf, centrifugando-se durante 1 minuto à velocidade máxima. Os passos seguintes foram realizados de acordo com as diretrizes do protocolo, até ao momento em que se obteve o centrifugado do sobrenadante ao qual se adicionou isopropano. Quando se obteve esse mesmo centrifugado, não foi realizado o passo de aspirar o sobrenadante com micropipeta nem secagem do sedimento: o que foi feito foi a ressupensão do DNA em 30 µl de água ultra-pura, retirando-se seguidamente 10 µl para um tubo Eppendorf novo, ao qual se adicionou igualmente 5 µl de tampão de aplicação. Por fim, esse mesmo tubo foi colocado no gelo. Figura 1 Resultados obtidos por eletroforese em gel de agarose. O poço relativo ao DNA plasmídico é o quinto (E), sendo que o primeiro observado corresponde aos marcadores de peso molecular (A). Recorrendo à reta de calibração obtida para esta mesma eletroforese e aos cálculos efetuados (apresentados na secção do relatório referente à extração de DNA genómico de Drosophila melanogaster-tabela 3 da mesma), verifica-se que o peso molecular do DNA Plasmídico se encontra entre os 126 e 747 Da, aproximadamente. 6

7 Conclusões Os plasmídeos bacterianos consistem em moléculas circulares extracromossómicas de cadeia dupla, de tal forma que é de esperar que tenha um menor peso molecular do que o DNA genómico o que é de facto verificado por observação dos resultados da eletroforese, em que o DNA genómico (poço A) apresenta uma menor migração que o DNA plasmídico (poço E), o que está diretamente relacionado com o peso molecular: quanto maior a quantidade de pares de bases, menor será a migração. Ainda recorrendo à análise do poço referente ao DNA plasmídico, é possível ver-se uma outra banda, de maior peso molecular, o que indica que o processo de isolamento do DNA plasmídico da bactéria não terá sido totalmente bemsucedido, sendo que tal pode significar a presença de RNA ou outro tipo de DNA, responsáveis pela contaminação da amostra. Mesmo se não tivesse ocorrido essa banda extra, não era possível dizer com toda a certeza que a amostra não estivesse contaminada, visto que a banda relativa ao DNA plasmídico é de grandes dimensões, e o RNA pode migrar para valores próximos do tipo de DNA em questão. Para nos certificarmos da ausência total de RNA na amostra, o que se deveria fazer era proceder-se ao tratamento com RNAses, repetindo-se em seguida a eletroforese Podemos então concluir, tendo em conta os resultados experimentalmente obtidos, que o DNA plasmídico terá entre 126 a 747 pb. 7

8 Análise Eletroforética de DNA digerido com enzimas de restrição Objetivos Análise da ação das enzimas EcoRI e HIndIII enzimas de restrição - numa amostra de DNA plasmídico e avaliação dos cortes efetuados por essas enzimas, através de uma eletroforese em gel de agarose. Realização de um mapa de restrição. de aplicação. Por fim, a um quarto tudo, adicionaram-se 20 L de DNA digerido com EcoRI e HindIII e 5 L de tampão de aplicação. Resultados Experimentais Metodologia Procedimento Experimental Seguiu-se o protocolo do Caderno das Aulas Prática 2014, de Biologia Molecular. Preparação das amostras: Foram preparados quatro tubos Eppendorf com diferentes composições. Para dois dos tubos foram pipetados 15 L de água destilada e esterilizada e adicionados, por esta ordem, 2 L de tampão de enzima de restrição 5x, 2 L de DNA plasmídico e adicionado 1 L de enzima de restrição EcoRI a um dos tubos e HindIII ao outro tubo. Para outro dos quatro tubos, foram pipetados 14 L de água, aos quais se adicionou 2 L de tampão de enzima de restrição 5x, 2 L de DNA plasmídico e 1 L de cada uma das enzimas de restrição já enunciadas. Por fim, no outro tubo, que serve de controlo, apenas foram adicionados 18 L de água destilada e esterilizada e 2 L de DNA plasmídico não digerido. Preparação das amostras para carregar o gel de eletroforese: Adicionou-se a um primeiro tubo de Eppendorf 5 L de DNA não digerido e 5 L de tampão de aplicação; no segundo, adicionou-se 20 L de DNA digerido com EcoRI e 5 L de tampão de aplicação; a um terceiro tubo, adicionaram-se 20 L de DNA plasmídico digerido com HindIII e 5 L de tampão Figura 1 Resultados obtidos no gel de eletroforese de agarose 1%, corrido a 100V. Poço 1 marcadores de peso molecular; Poço 2 DNA plasmídico não digerido; Poço 3 DNA plasmídico digerido com EcoRI; Poço 4 DNA plasmídico digerido com HindIII; Poço 5 - DNA plasmídico digerido com HindIII e EcoRI. Marcador PM /pb d migrada /cm , , , , , , , , ,20 8

9 dmigrada /cm Relatório de Biologia Molecular Licenciatura de Bioquímica , , , , ,80 Tabela 1 Valores referentes aos marcadores de peso molecular (em pb) e à distância migrada no gel de agarose (no poço 1). A partir do poço referente aos marcadores de peso molecular, foi possível aplicar a relação de linearidade entre o logaritmo do peso molecular e a distância migrada (em cm). Assim, por aplicação da regressão linear, obteve-se a representação gráfica apresentada na Figura 2 e a equação abaixo enunciada: D migrada = -2,9484Log(PM) + 13,646 D migrada = Log(PM) R² = Log(PM) Desta maneira, e recorrendo à equação supracitada foram calculados os valores do peso molecular dos fragmentos aparecidos nos resultados da eletroforese realizada nas nossas amostras. Os resultados estão apresentados na Tabela 2. Figura 2 Representação gráfica da distância migrada (em cm) em função do logaritmo dos PM e respetiva regressão linear. Amostra d migrada /cm Peso Molecular /pb Controlo EcoRI HindIII EcoRI + HindIII Tabela 2 Valores referentes às distâncias migradas pelos fragmentos de DNA plasmídico nas diferentes amostras corridas em gel de agarose 1%. Conclusões A análise dos resultados obtidos por eletroforese das amostras em gel de eletroforese, permite-nos identificar, para o poço correspondente à amostra de controlo, duas bandas. No poço 2, correspondente ao DNA plasmídico digerido com EcoRI, encontramos duas bandas, o que quer dizer que esta enzima de restrição encontra dois locais de corte no plasmídeo recombinante. Ao passo que, na amostra com HindIII, se verifica apenas a presença de uma banda, ou seja, o DNA plasmídico recombinante possui um único lugar de corte para esta enzima, sendo que o fragmento de DNA é, então, linear. Por fim, no último poço, correspondente à digestão pelas duas enzimas, encontramos três bandas, resultado concordante com o esperado. Isto porque o vetor psk-polo foi inserido no DNA plasmídico com o auxílio de ambas as enzimas de restrição, que cortaram o DNA em locais específicos para posterior recombinação com o vetor. Assim, é normal que estas duas enzimas cortem exatamente nesses mesmo locais o DNA plasmídico recombinante. Por outro lado, verificase que, para a enzima EcoRI terá de existir mais um lugar de corte, situado no fragmento inserido no DNA por recombinação, visto que, para o DNA plasmídico tínhamos um único local de corte com 9

10 esta enzima, e, nos resultados obtidos para o DNA recombinante com EcoRI se verificou a existência de duas bandas, e não uma única, como se esperaria, mostrando que o DNA foi cortado em dois locais, sendo um deles o mesmo que para o controlo e o outro um lugar no vetor inserido. A partir destas conclusões retiradas por observação dos resultados de eletroforese em gel de agarose, foi possível realizar um mapa de restrição para o plasmídeo recombinante. Concluindo o tamanho do fragmento inserido rondará os 1300 pb. E teorizando que o vetor terá, aproximadamente, 1800 pb ou, por outro lado, 3200 pb, não sendo possível, com apenas estes resultados e informações, definir o tamanho respetivo do fragmento e do plasmídeo. Caso que poderia ser corrigido se realizássemos eletroforese a apenas ao plasmídeo pb 1300 pb EcoRI EcoRI 1800 pb HindIII 1300 pb 1800 pb EcoRI EcoRI 3200 pb Figura 3 Representação esquemática do DNA plasmídico recombinante e possíveis localizações dos cortes das enzimas de restrição estudadas neste trabalho experimental. 10

11 Elaboração do mapa de restrição de um plasmídeo recombinante Objetivos É pretendido que se realize um mapa de restrição de um plasmídeo recombinante que contém um gene que codifica para uma subunidade da enzima NADH desidrogenase da cadeia respiratória, com base na análise do peso molecular dos fragmentos obtidos após digestão doplasmídeo recombinante com as enzimas de restrição SalI, HindIII, PstI, XholI, PvuII, SacI e BamHI, sendo que dois fragmentos de DNA (L e R) foram inseridos no plasmídeo pgem-3. Metodologia Procedimento Determinaram-se as distâncias migradas (em cm) pelos fragmentos nas várias amostras que correram por eletroforese, no gel de agarose. Foi obtida a reta (e equação) da regressão linear aplicada à representação gráfica da distância migrada em função do logaritmo dos pesos moleculares. Calculou-se, a partir da equação obtida, o valor dos pesos moleculares dos diferentes fragmentos. Realizou-se o mapa de restrição. Resultados Experimentais Figura 1 Resultados obtidos no gel de eletroforese de agarose 1% para o plasmídeo no qual se inseriu o fragmento L de DNA, e para o que se inseriu o fragmento R, respetivamente. Marcador PM /pb d migrada /cm , , , , , , ,10 Tabela 1 Valores referentes aos marcadores de peso molecular (em pb) e à distância migrada no gel de agarose (no poço 1) de cada um dos géis. A partir do poço referente aos marcadores de peso molecular, foi possível aplicar a relação de linearidade entre o logaritmo do peso molecular e a distância migrada (em cm). Assim, por aplicação da regressão linear, obteve-se a representação gráfica apresentada na Figura 2 e a equação abaixo enunciada: 11

12 d migrada /cm Relatório de Biologia Molecular Licenciatura de Bioquímica D migrada = -3,7841Log(PM) + 17,09 Desta maneira, e recorrendo à equação supracitada foram calculados os valores do peso molecular dos fragmentos aparecidos nos resultados da eletroforese realizada nas nossas amostras. Os resultados estão apresentados na Tabela 2. d migrada = Log(PM) R² = ,5 3 3,5 4 4,5 Log(PM) Figura 2 Representação gráfica da distância migrada (em cm) em função do logaritmo dos PM e respetiva regressão linear. O mesmo método se aplica para o gel de eletroforese aplicado ao plasmídeo no qual se inseriu o fragmento R, para o qual os valores de PM e distância migrada, assim como a respetiva reta de calibração são apresentados em seguida. Marcador PM /pb d migrada /cm Tabela 2 Valores referentes aos marcadores de peso molecular (em pb) e à distância migrada no gel de agarose (no poço 1) de cada um dos géis Figura 3 Representação gráfica da distância migrada (em cm) em função do logaritmo dos PM e respetiva regressão linear. Fragmento L d migrada PM /cm /pb Fragmento R dmigrada /cm PM /pb Enzima pgem -3x Bam III SalI SalI HindIII HindIII PstI PstI XholI XholI PvuII PvuII SacI XholI/SacI XholI/SacI XholI/SacI Tabela 3 Valores referentes às distâncias migradas pelos fragmentos de DNA plasmídico nas diferentes amostras corridas em gel de agarose 1%. Conclusões d migrada = log(PM) R² = ,5 3 3,5 4 4,5 O plasmídeo sem o fragmento tem, como se observa por análise da Tabela 2, um peso molecular de, aproximadamente, 3500pb, determinação feita por digestão do plasmídeo 12

13 pela enzima de restrição BamIII. Ora, o plasmídeo com o fragmento L possui um peso molecular de 7256pb (por análise da única banda correspondente à amostra digerida com SacI, cujo lugar de corte é na posição 56pb), enquanto que para o fragmento R tem um peso molecular de 8083pb, desta forma, os fragmentos terão 3727pb e 4606pb, respetivamente. Deve-se considerar que os fragmentos L e R foram inseridos no plasmídeo após digestão deste pela enzima SalI, cuja posição de corte é 25pb. Construção Mapa Restrição para o plasmídeo com fragmento L Para a enzima HindIII, pela literatura, sabemos que o plasmídeo contém um único local de corte (na posição 7pb) para esta enzima de restrição. Contudo, nos resultados obtidos por eletroforese, verifica-se a presença de duas bandas, o que não é concordante com a existência de um lugar de corte, mas sim de dois lugares e, desta maneira, se conclui que o segundo lugar de corte tem de existir no fragmento L inserido no plasmídeo, localizada a 2272pb (2265pb+7pb). O mesmo raciocínio se aplica para PstI, cuja posição de corte no plasmídeo é 23pb, logo, respetivamente teremos, um corte na posição a 2166pb; assim como para a enzima de restrição PvuI onde há também um único local de corte no plasmídeo (como indicado na literatura), e, da mesma forma, existe, obrigatoriamente, um outro local de corte no fragmento inserido. Considerando que o tamanho do fragmento inserido é de 3727pb, temos assim, cortes nas posições 3731pb e outro a 406pb de distância desse lugar, na posição 3325pb. estabelecermos a posição desses locais devemos usar também o poço correspondente à conjunção das duas enzimas XholI e SacI. Para SacI temos uma posição de corte no plasmídeo não recombinante a 56pb (logo, na posição 3783pb) e que os cortes para a enzima XhoI distam entre si 1042pb. Desta maneira, estabelece-se que os lugares de corte para Xhol se encontram nas posições 932pb e a 1865pb. Construção Mapa Restrição para o plasmídeo com fragmento R O mesmo método de resolução de mapa de restrição utilizado anteriormente pode ser aplicado ao plasmídeo no qual se inseriu o fragmento R. Neste, consideram-se as mesmas posições de corte para as enzimas que possuem esses locais no plasmídeo PGEM-3. A partir daqui é possível estabelecer as restantes posições de corte, repare-se para a enzima HindIII, cujas posições de corte são a posição 7pb (no plasmídeo) e a posição 917pb (910pb+7pb). Por outro lado, temos para, PstI temos um lugar de corte a 23pb e outro a 1312pb. O mesmo raciocínio é aplicado para a enzima PvuII, com um lugar de corte no plasmídeo 848pb. As enzimas XholI e SacI devem ser analisadas conjuntamente, considerando que a enzima XholI corta o fragmento R em dois locais que distam 1167pb entre si e que SacI corta na posição 56 do plasmídeo, logo, na posição 3533pb no plasmídeo recombinante, é possível estabelecer os seguintes locais de corte: 3388pb e 2221pb. Para a enzima de restrição XholI não estamos capazes de, apenas por análise do poço correspondente a esta enzima, indicar posições de corte no plasmídeo recombinante, já que não existem no plasmídeo inicial locais de corte para a enzima. O que nos indica que esses locais se encontram no fragmento L. Desta maneira, para 13

14 XhoI 932pb XhoI 1865pb PstI 2166pb HindIII 2272pb SalI 25pb PvuII 3325pb 3727pb SalI 3752pb PvuII 848pb HindIII 917pb PstI 1312pb SalI 25pb XhoI 2221pb 4606 pb XholI 3388pb SalI 4631pb Figura 2 Esquema do Mapa de Restrição para os plasmídeos recombinantes nos quais foram inseridos os fragmentos L e R, respetivamente. 14

15 Objectivos PCR Polimerase Chain Reaction Amplificação de um gene polo no cdna e gdna pelo processo de PCR e concluir sobre a presença de regiões intrónicas na sequência do gene. Verificação da eficiência deste processo e características por electroforese. Desenho de primers. Metedologia Procedimento Experimental/Resultados A primeira parte do protocolo prevía o desenho de primers de acordo com as sequências fornecidas e cálculo da temperatura de hibridação, que tem como expressão: Sequência Sense: T m = (nº G + C x 4 C) + (nº A + T x 2 C) 5 AGCTATGCTATGCTATGCTATGCCAGTCAGCTGAACGTG 3 Sequência Sense: Primer Forward T m = (10 x 4) + (9 x 2) = 58 C 5 TCTAATTCCAAGCCAATTGCCAAAAAGGAACCG 3 3 AGATTAAGGTTCGGTTAACGGTTTTTCCTTGGC 5 - Sequência Antisense Primer Reverse T m = (8 x 4) + (11 x 2) = 54 C A segunda parte consistia na amplificação do cdna e do gdna com os primers obtidos. Nesta fase experimental, houve algumas alterações ao protocolo, tais como o volume de dntps adicionado em ambos os ependorfs, que passou de 8μL para 4μL, e o volume de H 2 O adicionado em ambos os ependorfs, tendo sido de 31,75μL, para perfazer um volume total de 50μL. O número de ciclos no amplificador termocíclico foi reduzido de 40 para 15. No fim, procedeu-se à realização de uma electroforese para avaliação dos resultados. 15

16 log(pm) Relatório de Biologia Molecular Licenciatura de Bioquímica λ A B y = -0,2743x + 4,542 R² = 0, Distância percorrida (cm) Figura 2 Gráfico representativo do peso molecular consoante a distância percorrida do marcador padrão e respectiva recta de calibração. Tabela 1 Resultados de distância percorrida pelas bandas (DP) e respectivos pesos moleculares. Poço A cdna; Poço B - gdna Poço A Poço B DP(cm) 6,5 6,3 PM (pb) 574, , Figura 1 Resultado da electroforese realizada. λ Marcador de Peso Molecular Padrão; A cdna; B - gdna Nota: Este gel de electroforese não é o do grupo, visto que esse não continha o marcador de peso molecular padrão, indispensável ao cálculo dos pesos das bandas obtidas. Foi portanto usado o gel da turma PL1. 16

17 Conclusões Quanto à primeira parte do protocolo, o desenho dos primers cumpriu todos os requisitos impostos para o sucesso da aplicação dos mesmos na técnica de PCR. Pela electroforese obtida, podemos ver que o cdna percorreu maior distância em relação ao gdna, logo tem menor peso molecular, o que seria de esperar porque o cdna é obtido por transcriptase reversa a partir de uma molécula de mrna pós-tradução onde já não se encontram os intrões, logo o cdna não vai ter a sequência correspondente aos intrões e por isso, menor número de bases. A intensidade observável nas bandas é um bom indicador do sucesso do PCR pois podemos inferir qualitativamente (mas com pouco rigor) que a grande intensidade deve-se a grande quantidade de DNA, tanto genómico como clonal, o que prova a amplificação pretendida. As bandas observáveis com pesos moleculares maiores devem-se à diminuição do tempo dos ciclos no PCR, o que levou a que partes de cdna e gdna não fossem totalmente desnaturadas e por isso não sofreram nova hibridação e amplificação. Para além disso, e devido à mesma situação, o template pode não ter sido totalmente diluído, o que pode também justificar o aparecimento dessas bandas de maior peso molecular. 17

18 Transformação de Escherichia coli com DNA plasmídico Objetivos Transformar E. Colli com DNA plasmídico: transformar as células bacterinas com os plasmídeos pbr322, pbr322-cat, pembl9 e pembl9-cat. Avaliar a eficiência dessa transformação. Metedologia Procedimento Experimental Foram seguidos os passos delineados pelo Caderno de Aulas Práticas. Resultados Experimentais As figuras abaixo apresentadas correspondem às placas incubadas a 37ºC durante a noite. Figura 2 Placa com meio de cultura LA/Amp, correspondente à incubação de bactérias com o plasmídeo pembl9. Figura 1 Placa com meio de cultura LA/Amp. Figura 3 Placa com meio de cultura Mac/Amp, correspondente à incubação de bactérias com o plasmídeo pembl9. 18

19 Figura 4 Placa com meio de cultura LA/Amp, correspondente à incubação de bactérias com o plasmídeo pembl9-cat. Figura 5 Placa com meio de cultura Mac/Amp, correspondente à incubação de bactérias com o plasmídeo pembl9-cat. Figura 6 Placa com meio de cultura LA/Amp, correspondente à incubação de bactérias com o plasmídeo pbr322. Figura 7 Placa com meio de cultura LA/Amp/Tet, correspondente à incubação de bactérias com o plasmídeo pbr322. Figura 8 Placa com meio de cultura LA/Amp, correspondente à incubação de bactérias com o plasmídeo pbr322-cat. Figura 9 Placa com meio de cultura LA/Amp/Tet, correspondente à incubação de bactérias com o plasmídeo pbr322-cat. 19

20 Figura 10 Placa com meio de cultura Mac/Clo, correspondente à incubação de bactérias com o plasmídeo pembl9, previamente incubadas em LA/Amp. Figura 11 Placa com meio de cultura Mac/Clo correspondente à incubação de bactérias com o plasmídeo pembl9-cat, previamente incubadas em LA/Amp. Figura 12 Placa com meio de cultura Mac/Clo, correspondente à incubação de bactérias com o plasmídeo pbr322-cat, previamente incubadas em LA/Amp. 20

21 Conclusões Como seria de esperar, quando se expõe bactérias de E. Colli a um meio com LA/Ampicilina, e visto que as bactérias não possuem resistência ao antibiótico, não ocorre crescimento de colónias, constituíndo essa realização o controlo. Relativamente ao plasmídeo pembl9: No meio com LA/Amp, verifica-se crescimento de um grande número de colónias, com o tom amarelado. Uma vez que este plasmídeo tem inserido um gene de resistência à Ampicilina, tal possibilitou o crescimento das bactérias no meio em questão. No meio com Mac/Lac/Amp, continua a haver resistência ao antibiótico visto que se verifica crescimento de muitas colónias bacterianas. Por haver lactose no meio, é induzida a β- Galactosidade, ocorrendo assim a metabolização do substrato, com produção de substâncias acídicas, as quais farão variar o ph. O indicador neutral red presente no agar de MacConkey provoca uma variação de cor, visualizada nesta placa, a qual adquiriu a cor vermelha. No meio com Mac/Lac/Clo, verificou-se que não existiu crescimento de bactérias, isto porque o plasmídeo não possui resistência a este antibiótico específico (Cloranfenicol). Relativamente ao plasmídeo pembl9-cat: No meio com LA/Amp, verificou-se igualmente crescimento de colónias bacterianas, visto o plasmídeo ter o gene de resistência ao Antibiótico em questão. No meio com Mac/Lac/Amp, observam-se igualmente o crescimento de bactérias, isto porque a introdução do gene CAT não influencia a resistência à Ampicilina. Verifica-se o tom avermelhado da colónia pela variação de ph induzida pela presença de lactose no meio. No meio com Mac/Lac/Clo, não é observado crescimento de colónias bacterianas, o que contradiz o que seria de esperar. De facto, o plasmídeo em questão tem inserido o gene CAT, o qual codifica a enzima bacteriana Cloranfenicol acetil transferase, que, quando induzido corretamente, torna as bactérias resistentes ao cloranfenicol quando na presença de lactose. Assim sendo, era de esperar o crescimento de bactérias, mas como este não é visualizado poderse-à concluir que algo na transformação não correu como o esperado, como por exemplo a indução do gene CAT no plasmídeo. Relativamente ao plasmídeo pbr322: Este plasmídeo possui genes responsáveis pela resistência aos antibióticos tetraciclina e ampicilina. Desta forma, quando são incubadas bactérias transformadas com este pasmídeo no meio de LA/Amp, é esperado o crescimento de colónias, o que de facto se verifica. Quando se procedeu à incubação das bactérias igualmente transformadas com este plasmídeo no meio com LA/Amp/Tetraciclina, foi verificado crescimento, embora em muito pouca quantidade, já que se visualizam apenas cerca de 4 colónias. Tal permite concluír que neste caso a transformação não terá sido muito eficiente, pelo menos não da maneira esperada. Relativamente ao plasmídeo pbr322-cat: Aquando da inserção do gene CAT no plasmídeo pbr322, o local do gene que codifica a resistência à tetraciclina fica inativo, já que a introdução do primeiro gene mencionado ocorre nesse mesmo local. Dessa forma, é esperado crescimento de colónias bacterianas transformadas no meio com LA/Amp, visto que o gene que codifica a resistência a este antibiótico específico não é alterado. E de facto verifica-se o crescimento de um grande número de colónias. Pelo contrário, no meio com LA/Amp/Tet, não é esperado crescimento bacteriano, pela 21

22 inexistência de resistência à tetraciclina, sendo isso que se verifica por observação experimental. Por fim, quando introduzidas num meio com Mac/Lac/Clo, as bactérias transformadas deveriam crescer, já que no plasmídeo foi introduzido o gene CAT (que na presença de lactose permite a resistência ao cloranfenicol). No entanto, não foi verificado qualquer crescimento, o que indicará a ineficiência da transformação neste caso. 22

23 SEQUENCIAÇÃO DE DNA Objetivos Sequenciação de 3 clones de cdna, através da obtenção da sequência original, identificando locais de interesse para apurar qual o clone que codifica a sequência de aminoácidos fornecida. Resultados experimentais Sequência de aminoácidos requerida: N terminal-ser-tyr-cys-leu-pro-met-ser-pro-arg- Ala-C terminal Sequência reconhecida pela EcoRI: Primer: 3 GGGTACAGGGGCGCA 5 (complementar à sequência sublinhada) Clone B: 5 TAGCGAATTCATTATCCCGATCTAGTAACGCATCCT CTAACTAGCGTGAATTATG TCA TAT TGC CTG CCC ATG TCC CCG CGT GCG AAGCTTCGCCTA 3 Primer: 3 GGGTACAGCGGGGCA 5 (complementar à sequência sublinhada) Clone C: 5 TAGCGAATTCAATCGACCCAGGTCACAACCCTTCC GGCTCAAGCCTAACCTAGTTAAGACCCTATGTCTCCC CGAGCTAAGCTTCGCCTA 3 Primer: 3 GGATAAAGAGGGGCT 5 (complementar à sequência sublinhada) 5 GAATTC 3 Sequência reconhecida pelo HindIII: 5 AAGCTT 3 Codão de iniciação: ATG Conclusões Por observação dos resultados obtidos, o clone que codifica a sequência de aminoácidos pretendida é o B. Sequências originais obtidas por complementaridade de bases da sequência de cada clone (obtidas por eletroforese): Clone A: 5 TAGCGAATTCACCAGGTTCCGAACATCGCCATTCC AGGGAACTCATTGAGTCTAGCCTAACTAACGACCCA TGTCGCCCCGTGAAAAGCTTCGCCTA 3 23

24 Objetivos Clonagem de cdna γ-tub Realização da clonagem de cdna γ-tub e verificação do sucesso no método através da transformação de bactérias. Metodologia Procedimento Parte I. A. Foi seguido o procedimento do Caderno de Aulas Práticas de Biologia Molecular para a Aula 8. Parte I. B. A ligação realizou-se através da preparação de quatro soluções cujas composições são apresentadas na Tabela 1. Volumes /ml Reagentes A B C D Vector (pks digerido) Insert (cdna y-tub) Tampão de Ligação (5x) T4 Ligase H 2 O Tabela 1 Volumes medidos para a realização de quatro soluções diferentes para a realização das reações de ligação entre o vetor pks (digerido) e o cdna. Figura 2 Placa resultante do crescimento de colónias de bactérias transformadas, com o meio B. Parte II. (Realizada em laboratório tendo-se seguido as instruções do Protocolo de Aulas Laboratoriais) Resultados Experimentais Após realização da transformação das bactérias, e depois de incubação, foram obtidos os seguintes resultados por plaqueamento. Figura 3 Placa resultante do crescimento de colónias de bactérias transformadas, com o meio C. Figura 1 Placa resultante do crescimento de colónias de bactérias transformadas, com o meio A. Figura 4 Placa resultante do crescimento de colónias de bactérias transformadas, com o meio D. 24

25 Conclusões Para verificar o sucesso da transformação e, desta maneira também, o sucesso da clonagem deve-se atender ao crescimento ou não de colónias na placa e à cor das colónias crescidas. O crescimento de colónias espera-se se estas incluíram o plasmídeo (recombinante ou não), visto que este possui gene de resistência ao antibiótico utilizado no meio de cultura (Ampicilina). Por outro lado, é esperado que bactérias transformadas com o vetor recombinante com cdna façam parte de colónias que apresentem uma cor amarelada. Note-se que o fragmento y-tub é inserido no meio do gene LAC do vetor e, desta maneira, deixa de haver expressão desse gene que promove a produção de proteínas de degradação de lactose, que, a acontecer, baixa o ph do meio, por produção de ácido fórmico na reação de degradação do substrato, com aparecimento da cor vermelha. Ao contrário, se não há degradação da lactose do meio de cultura, as colónias aparecem amarelas, segundo o indicador de ph utilizado, amarelo para meio mais básico. A placa A apresenta crescimento de colónias bacterianas, como se observa, sendo de concluir que ocorreu transformação. Contudo, não se pode concluir com clareza acerca da inserção cdna no vetor. De facto, não são encontradas colónias com cor amarela, o que nos indica que todas as colónias crescidas serão capazes de degradar a lactose, tendo, portanto o gene LAC intacto e, deste modo, não terem incluído no plasmídeo o fragmento de cdna. Podem ser apresentadas várias hipóteses para que a falha na clonagem de cdna no vetor pks: Ainda que se tenha tentado utilizar mais insert do que vetor nas misturas realizadas (por utilização de um maior volume desse, comparativamente ao de vetor), não temos a garantia de que a quantidade é, efetivamente, maior, visto não sabermos, exatamente, a concentração de cdna e de plasmídeo nas soluções utilizadas. Repare-se que a razão ótima é 3:1 (fragmento-vetor) e, de modo a melhorarmos o método, poder-se-ia proceder a ensaios espetrofotométricos para cálculo da concentração de cdna, a garantir a razão ótima por utilização dum volume correto de solução nas misturas reacionais A ligação poderá não ter tido sucesso; Erros experimentais em qualquer um dos passos da transformação que levaram à ineficiência da reação de ligação entre o fragmento e o vetor; Na placa B e C, como seria de esperar, não cresceram colónias. De facto, em B, não houve crescimento porque não se inclui na mistura reacional a enzima que promove a ligação T4 Ligase de modo que não pôde ocorrer nem inserção do fragmento no plasmídeo nem a sua própria re-circularização, o que impede a transformação das bactérias quer pelo vetor quer por este recombinante. Por outro lado, na solução C não foi usado vetor, de modo que, como em princípio o fragmento não possui capacidade de transformar (não só porque não tem resistência, mas porque não terá capacidade de circularizar, a ser incluído nas bactérias), as bactérias não poderão ser transformadas e, portanto, não terão resistência ao antibiótico do meio de cultura, não ocorrendo crescimento. Por fim, em D, observamos crescimento de colónias, que apresentam a cor vermelha, à semelhança do que acontece na placa A. Ora, a mistura reacional neste ensaio apenas não contempla o uso de insert, sendo que toda a experiência culmina na transformação de bactérias pelo vetor pks não recombinante (o que parece acontecer também em A, como já se explicou). 25

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014 Biologia Molecular Caderno de relatórios Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva Docentes: Dr. Cláudio Sunkel, Prof. Mariana Osswald 1 Extração de DNA genómico de Drosophila Melanogaster

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Escola Secundária Dr. Manuel Gomes de Almeida

Escola Secundária Dr. Manuel Gomes de Almeida Escola Secundária Dr. Manuel Gomes de Almeida Ficha de trabalho de Biologia - 12º Ano Fermentação e actividade enzimática Nome: N º: Turma: Data: 1. A figura 1 representa um tipo de fermentação. Figura

Leia mais

Exame de Laboratórios de Bioquímica e Biofísica Licenciatura em Bioquímica 1ª Época 27 de Junho de 2006 Por favor responda às questões da 1ª parte e 2ª partes em folhas separadas 1ª Parte 1. Suponha que

Leia mais

FISIOLOGIA ANIMAL II

FISIOLOGIA ANIMAL II DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA FISIOLOGIA ANIMAL II AULAS e 3 DETERMINAÇÃO DA CONCENTRAÇÃO DE GLICOSE E LÍPIDOS NO SANGUE POR COLORIMETRIA CAETANA CARVALHO,

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA PERMEABILIDADE DAS MEMBRANAS CELULARES

DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA PERMEABILIDADE DAS MEMBRANAS CELULARES DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA FISIOLOGIA ANIMAL II AULA 4 PERMEABILIDADE DAS MEMBRANAS CELULARES CAETANA CARVALHO, PAULO SANTOS 2006 1 INTRODUÇÃO As

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Vanessa Diniz Barcelos Vasconcelos 2, Newton Portilho Carneiro 3 1 Trabalho financiado pelo CNPq/Fapemig

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resumo O propósito deste trabalho é testar a resistência de bactérias (Escherichia

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

ESCOLA SECUNDÁRIA D. SANCHO II ELVAS CIÊNCIAS DA TERRA E DA VIDA 11º ANO

ESCOLA SECUNDÁRIA D. SANCHO II ELVAS CIÊNCIAS DA TERRA E DA VIDA 11º ANO ESCOLA SECUNDÁRIA D. SANCHO II ELVAS CIÊNCIAS DA TERRA E DA VIDA 11º ANO Unidade de ensino: Sistemas vivos e energia. Sub-unidade: Fermentação. Guião de actividade Ontem, na aula de Educação Física, o

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

ESTUDO DA CINÉTICA DE HIDRÓLISE ÁCIDA DO COMPOSTO Trans-[(Co(en) 2 Cl 2 )Cl]

ESTUDO DA CINÉTICA DE HIDRÓLISE ÁCIDA DO COMPOSTO Trans-[(Co(en) 2 Cl 2 )Cl] TRABALHO 3 ESTUDO DA CINÉTICA DE HIDRÓLISE ÁCIDA DO COMPOSTO Trans-[(Co(en) 2 Cl 2 )Cl] 1. OBJECTIVO Estudo da cinética da reacção de hidrólise ácida do composto Trans-[Co(en) 2 Cl 2 ]Cl. Determinação

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Plásticos para Cultivo Celular

Plásticos para Cultivo Celular Linha Cultivo de Células e Tecidos Fabricada em poliestireno cristal virgem (GPPS), oferece produtos com alta transparência para ótima visualização e sem presença de contaminantes, assegurando integridade

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

O NÚMERO DE BACTÉRIAS

O NÚMERO DE BACTÉRIAS O NÚMERO DE BACTÉRIAS A CONTAGEM EM PLACAS A contagem em placas é um dos métodos mais utilizados para determinar qual o número de microrganismos viáveis em um meio líquido. Quando a concentração é baixa,

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL Luciana Oliveira Barateli; Regina Melo Sartori Coelho; Abmael Monteiro

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Escola de Engenharia de Lorena USP - Cinética Química Capítulo 05 Reações Irreversiveis a Volume Varíavel

Escola de Engenharia de Lorena USP - Cinética Química Capítulo 05 Reações Irreversiveis a Volume Varíavel 1 - Calcule a fração de conversão volumétrica (ε A) para as condições apresentadas: Item Reação Condição da Alimentação R: (ε A ) A A 3R 5% molar de inertes 1,5 B (CH 3 ) O CH 4 + H + CO 30% em peso de

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Virologia em Laboratório Fase Pré- Analítica

Virologia em Laboratório Fase Pré- Analítica Virologia em Laboratório Fase Pré- Analítica Leonor Rebelo Lab Virologia i do IPOFGL EPE Novembro 2012 1º Curso de Virologia Molecular em Oncologia 1 ,, TÑÜxÇwxÜ t ØÇ vt vé át wx Öâx t ÅxÇàx ÇâÇvt áx vtçát?

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

A eletroforese é uma técnica utilizada para separar, identificar e purificar

A eletroforese é uma técnica utilizada para separar, identificar e purificar 7. ELETROFORESE DE ÁCIDOS NUCLÉICOS João José de Simoni Gouveia Luciana Correia de Almeida Regitano A eletroforese é uma técnica utilizada para separar, identificar e purificar moléculas carregadas (como

Leia mais

RELATÓRIO DAS ATIVIDADES LABORATORIAS

RELATÓRIO DAS ATIVIDADES LABORATORIAS NOME DA ATIVIDADE LABORATORIAL: 1.2. UM CICLO DE COBRE Será possível reciclar uma substância usando processos químicos com rendimento 100%? OBJETIVOS: Entender a possibilidade de reciclar um metal por

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Reacções e Estrutura de Sólidos Inorgânicos

Reacções e Estrutura de Sólidos Inorgânicos Unidade Curricular de Química Geral e Inorgânica Relatório do Trabalho Laboratorial n.º 6 Reacções e Estrutura de Sólidos Inorgânicos Elaborado por: Diana Patrícia Reis Cunha Jéssica Lopes Figueiredo Turma

Leia mais

Separação de Misturas

Separação de Misturas 1. Introdução Separação de Misturas As misturas são comuns em nosso dia a dia. Como exemplo temos: as bebidas, os combustíveis, e a própria terra em que pisamos. Poucos materiais são encontrados puros.

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

ENZIMAS E METABOLISMO

ENZIMAS E METABOLISMO ENZIMAS E METABOLISMO Metabolismo Celular é o conjunto de todas as reacções químicas celulares acompanhadas de transferência de energia. ANABOLISMO conjunto de reacções químicas que conduzem à biossíntese

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Prova Escrita de Física e Química A

Prova Escrita de Física e Química A Exame Final Nacional do Ensino Secundário Prova Escrita de Física e Química A 11.º Ano de Escolaridade Decreto-Lei n.º 139/2012, de 5 de julho Prova 715/Época Especial Critérios de Classificação 11 Páginas

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

ENSAIO DE ENDOTOXINAS BACTERIANAS

ENSAIO DE ENDOTOXINAS BACTERIANAS ENSAIO DE ENDOTOXINAS BACTERIANAS O ensaio de endotoxinas bacterianas (EEB) é um ensaio para detectar ou quantificar endotoxinas de bactérias gram negativas usando um lisado de amebócitos de caranguejo

Leia mais

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia.

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia. POP-I 67 Página 1 de 5 1. Sinonímia Teste rápido Anti-½ - OraQuick ADVANCE 2. Aplicabilidade Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia. 3. Aplicação clínica O ensaio

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

FUNCIONAMENTO DE UM MONITOR CONTÍNUO DE OZÔNIO

FUNCIONAMENTO DE UM MONITOR CONTÍNUO DE OZÔNIO FUNCIONAMENTO DE UM MONITOR CONTÍNUO DE OZÔNIO 1. Introdução A melhor tecnologia para o monitoramento de baixas concentrações de ozônio (O 3 ) no ar ambiente é a da absorção de luz na faixa do Ultra Violeta

Leia mais

Preparação de 100 ml de uma solução aquosa de concentração. Preparação 250 ml de uma solução aquosa de dicromato de

Preparação de 100 ml de uma solução aquosa de concentração. Preparação 250 ml de uma solução aquosa de dicromato de Físico Química A Relatório da actividade prático - laboratorial Preparação de 100 ml de uma solução aquosa de concentração 0,02 dm -3, cujo soluto foi dicromato de potássio e Preparação 250 ml de uma solução

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

LINKAGE E OS MAPAS GENÉTICOS

LINKAGE E OS MAPAS GENÉTICOS Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Linkage e os Mapas Genéticos Humanos LINKAGE E OS MAPAS GENÉTICOS Os trabalhos de Gregor Mendel não foram

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

Ciclo: 3º Ano: 7º Disciplina: Físico-Química. Atividades / Estratégias. Nº aulas previstas. Avaliação

Ciclo: 3º Ano: 7º Disciplina: Físico-Química. Atividades / Estratégias. Nº aulas previstas. Avaliação código 171608 AGRUPAMENTO DE ESCOLAS D. DOMINGOS JARDO Direção Regional de Educação de Lisboa Ciclo: º Ano: 7º Disciplina: Físico-Química Conteúdos I - O Universo 1. O que existe no Universo 1.1 Estrutura

Leia mais