Save this PDF as:

Tamanho: px
Começar a partir da página:




2 Número de genes para RNA


4 RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca). Os rrnas se agregam a proteínas ribossômicas para integrarem as partículas ribossomais.

5 O ribossomo é um complexo constituído por moléculas de RNA individuais e mais de 50 proteínas, arranjados em uma subunidade pequena e uma subunidade grande. As proteínas das duas subunidades diferem, assim como as moléculas de rrna. O comprimento das moléculas de RNA, a quantidade de proteínas e, consequentemente, o tamanho das subunidades diferem entre procariotos e eucariotos.

6 Os rrnas formam estruturas dobradas, muito semelhantes em diferentes espécies, embora as sequências de nucleotídeos possam diferir.

7 Síntese e processamento do pré rrna Os ribossomos de eucariotos contêm 4 rrnas (18S, 28S, 5.8S e 5S). Os três primeiros são transcritos como uma única unidade de transcrição, na forma de um pré-rrna, por ação da RNA polimerase I. O DNA que codifica para rrna tem sido isolado de várias espécies de eucariotos e há algumas semelhanças entre as espécíes: As unidades de transcrição de pré-rrna estão arranjadas, umas após a outras, em longas sequências. Três sequências do pré-rrna correspondem aos componentes ribossômicos: 18S, 28S e 5.8S. A ordem desta sequência é sempre a mesma: l8s, 5.8S e 28S.

8 O processamento do pré-rrna ocorre no nucléolo e envolve vários passos, que levam a formação das subunidades ribossômicas 40S e 60S. O processamento começa com a associação das proteínas ribossômicas ao pré-rrna. O rrna pequeno (5S) constituído por 120 nucleotídeos, codifícado por genes que ficam fora do nucléolo. Ele é sintetizado pela RNA polimerase III que não se encontra no nucléolo (este rrna - 5S não sofre nenhum processamento).


10 RNA transportador - trna Os trnas correspondem a 10% do RNA total da célula, e são denominados de adaptadores. Os adaptadores são moléculas que carregam aminoácidos que se ligam, de modo específico às bases do molde de RNA. Os trnas são adaptadores para os aminoácidos durante a síntese proteíca. Cada trna tem uma estrutura específica que reconhece uma determinada sequência no molde de DNA.

11 Os trna apresentam algumas estruturas comuns: Cada molécula de trna contêm entre 73 a 93 nucleotídeos em uma única cadeia linear. Há tipos de trnas em bactérias e, até, 50 em células animais ou vegetais. No terminal 3' está sempre presente uma sequência CCA. No terminal 5' está sempre presente um nucleotídeo monofosfato, frequentemente guanina (G). A maioria das bases do trna são ligadas por pontes de hidrogênio. Dobras, em forma de grampos, da mesma cadeia, aproximam bases complementares que formam duplas hélices curtas.


13 Alguns nucleotídeos não formam pares de bases e ficam livres para interagir com outras moléculas, durante a síntese proteíca. A conformação adotada pelas moléculas de trna é a forma de um trevo. Estudos de difração de raio X, demonstram que o trevo se dobra, assumindo uma conformação terciária estável, conferindo a molécula a forma de L.

14 Síntese e processamento do trna A síntese do trna é catalizada pela RNA polimerase III. A transcrição termina quando a RNA polimerase III encontra uma sequência de resíduos do nucleotídeo timina (T). Os trnas são sintetizados como precursores que são modificados. O pré-trna sofre: "Splicing" e remoção das sequências intercaladas, Remoção de três nucleotídeos da extremidade 3' e adição da sequência CCA,

15 O "splicing" das moléculas de pré-trna envolve dois passos: Corte do transcrito primário para remover o intron. União das pontes cortadas. A molécula se dobra, de modo a permitir que a cadeia seja cortada com precisão, para liberar o intron.

16 Aminoacil trna sintetase Aminoacil trna sintetase - (abreviação aars) é uma enzima que cataliza a ligação do aminoácido específico ao trna: aminoacyltrna. a maioria das células produzem 20 diferentes aminoacyl-trna sintetases: uma para cada tipo de aminoácido. Estas enzimas reconhecem suas respectivas moléculas de trna interagindo de maneira complexa com o anticodon dos mesmos.



19 RNA mensageiro - mrna Os mrnas representam cerca de 4% do RNA celular total. O mrna carrega informações do DNA para o ribossomo, local onde ocorre a síntese protéica. É o verdadeiro molde da síntese protéica. Os mrnas têm vários tamanhos e são constituídos por diferentes tipos de bases nitrogenadas, em função da proteína a ser codificada. Um mrna especifica uma cadeia linear precisa de aminoácidos em uma proteína e também sinaliza onde começar e onde parar a síntese da cadeia polipeptídica.

20 Relembrando a molécula de RNAmensageiro

21 Síntese e processamento do mrna Os mrnas são sintetizados pela RNA polimerase II. Todos os genes analisados, que são ativamente transcritos, tem uma sequência altamente conservada, chamada de "TATA box", localizada a pares de bases antes do início da transcrição. Após a transcrição, vários grupos metil (grupo radical alcalino CH3 derivado do metano pela remoção de um átomo de H) são adicionados a resíduos de Adenina (A) localizados em exons (regiões codificadoras). Talvez a metilação desempenhe um papel de proteção na porção do transcrito a ser preservado. O mrna citoplasmático é derivado de um precursor denominado hnrna nuclear (heterogeneous nuclear RNA) mrna imaturo.

22 Os mrna de eucariotos são monocistrônicos (codificam apenas para um polipeptídeo). O processamento pós-transcrição do hnrna para originar o mrna envolve três etapas: Adição de uma cauda de poli A à extremidade 3' Formação de um capacete "cap" na extremidade 5' "Splicing" para a remoção dos introns

23 Adição da cauda de poli A A cauda de poli A é adicionada à cadeia de hnrna pela extremidade 3' do RNA, por uma enzima chamada polia polimerase. Esta enzima adiciona uma cauda de polia de nucleotídeos ao hnrna. Esta cauda não é codificada no DNA e é específica do mrna. A cauda de poli A é lentamente encurtada no citoplasma.

24 Formação do capacete "cap" O "cap"consiste de um nucleotídeo 7- metilguanilato (guanina modificada), unido por uma ligação 5'- 5' ao nucleotídeo inicial da cadeia de mrna (ao invés da ligação usual 3-5 ). Portanto não há extremidade 5' livre na cadeia de mrna e sim duas extremidades 3'-OH livres. A formação do "cap"ocorre no núcleo.


26 "Splicing" O splicing é o passo final do processamento do mrna. lntron - parte do transcrito primário que não está incluída no mrna, trna e rrna maduro. Exon - parte do transcrito primário que chega ao citoplasma como parte de uma molécula de RNA. A remoção do intron é um processo de alta precisão, uma vez que o erro de apenas uma base levaria a leitura errada de toda sequência seguinte. Existem algumas sequências relativamente conservadas nos limites intron-exon e uma sequência rica em pirimidinas dentro de intron.

27 Para que ocorra o "splicing", é necessário que uma estrutura se organize em torno do RNA. Esta estrutura é chamada de "spliceosomo ; O "Splicing" é a última etapa de processamento do mrna que, com o "cap" na extremidade 5' e a cauda de poli A, na extremidade 3' vai para o citoplasma, onde, complexando-se com ribossomos, serve de molde para a síntese protéica.



30 Diferenças na produção de mrna em eucariotos e procariotos Procariotos mrna corresponde exatamente aos genes no DNA; Não ocorre processamento do mrna; Ocorrência de mrna policistrônico Eucariotos mrna requer processamento póstranscricional Cada mrna é derivado de um gene individual (mrna monocistrônico)

31 RNA de interferência e micro-rna

32 rrna mirna Interrupção mirna

33 RNA mrna ncrna Non-coding RNA. RNA transcrito tem papel estrutural, funcional ou catalítico rrna Ribosomal RNA Participa da síntese de proteínas trna Transfer RNA Interface entre RNAm e aminoácidos snrna Small nuclear RNA RNA que fazem parte do spliceossomo snorna Small nucleolar RNA Encontrado no nucléolo e esta envolvido na modificação do RNAr mirna Micro RNA Pequenos fragmentos de RNA que estão envolvidos na regulação da expressão gênica Outros RNAs maiores compondo a estrutura da cromatina e relacionados ao imprinting strna Small temporal RNA. RNA com função de regulação do desenvolvimento biológico sirna Small interfering RNA ativa moléculas na interferência por RNA

34 O que é um microrna (mirna)? pequenas moleculas de RNA encontradas em eucariotos, reguladoras, escondidos no genoma (regiões intergênica e intrônica); Sao sequencias conservadas evolutivamente; ~22 nucleotídeos; descobertos em estudos de regulação do desenvolvimento de C. elegans em 1993; Controlam a expressão a nivel da traducao;


36 Biogenese do mirna

37 Inicialmente transcrito como um pré-mirna de pb; pré-mirna é processado pela Dicer (RNAase III); formação de mirna maduro com nt; atua negativamente na regulação pós-transcricional pela formação de um duplex RNA, interrompendo a tradução de um mrna pela região 3 -UTR mirna Loop Dicer (RNAase III) UGAGGUAGUAGGUUGUAUAGU (mirna)


39 Qual a diferença entre sirna e mirna?? Função: envolvidos na regulação da expressão gênica mirna: micro-rna geralmente complementares a mrna (imperfeita); seqüências são relativamente conservadas entre espécies; ligam-se à 3 UTR: degradação do mrna ou inibição da tradução; alteram a estabilidade do mrna; mirna origina de ssrna formando uma estrutura secundária em forma de hairpin; expressão constitutiva ou com controle temporal-específica e tecido-específica

40 mirna são altamente conservados em grupos filogenéticos afastados (insetos, peixe e humano)

41 Qual a diferença entre sirna e mirna?? sirna: RNA de interferência diferença se baseia na origem; sirna é mais comum em resposta a RNA estrangeiro (geralmente viral); geralmente é 100% complementar; tipicamente induz a degradação do mrna

42 sirna: Mecanismo de ação


RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais


TRANSCRIÇÃO DO DNA: Tipos de RNA TRANSCRIÇÃO DO DNA: Síntese do mrna Gene (Unidades transcricionais) Tipos de RNA Tipos de RNA polimerase Tipos de RNA polimerase DNA dependente Transcrição em Procariotos Transcrição em Eucariotos Mecanismos

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais


16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais



Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015.

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

V e t e r i n a r i a n D o c s Genética

V e t e r i n a r i a n D o c s Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: Visão Holística

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais



Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito RNA aspectos funcionais e estruturais 5 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do RNA. Pré-requisito Para acompanhar mais facilmente esta

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Fluxo da informação gênica transcrição em eucariotos

Fluxo da informação gênica transcrição em eucariotos Fluxo da informação gênica transcrição em eucariotos AULA 21 objetivos Ao final desta aula, você deverá ser capaz de: Estudar o mecanismo de transcrição em eucariotos. Entender a formação do RNA mensageiro

Leia mais


COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais


BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais


DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

Profa. Dra. Viviane Nogaroto

Profa. Dra. Viviane Nogaroto ESTRUTURA DO GENE GENE: Região do DNA capaz de ser transcrita a fim de produzir uma molécula de RNA funcional ou uma proteína -inclui sequências codificadoras e regulatórias transcrição tradução DNA RNA

Leia mais


Ácidos Nucléicos OS ÁCIDOS NUCLÉICOS Ácidos Nucléicos DNA e RNA Profª Ana Luisa Miranda Vilela OS ÁCIDOS NUCLÉICOS Constituintes: Nucleotídeos formados por três diferentes tipos de moléculas: um açúcar (pentose) desoxirribose no DNA e ribose

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015.

Criado e Desenvolvido por: Todos os direitos são reservados 2015. Criado e Desenvolvido por: Todos os direitos são reservados 2015. O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira Faculdade de Tecnologia de Araçatuba Curso Superior de Tecnologia em Bioenergia Sucroalcooleira 1 ÁCIDOS NUCLÉICOS Estrutura e funções 2 Ácidos nucléicos são polímeros de nucleotídeos adenina citosina

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais


MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição

Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição EIXO BIOLÓGICO Unidade 6 Transcrição e regulação da expressão gênica Autor: Elisângela de Paula Silveira Lacerda I. Introdução II. Do DNA ao RNA III. Mecanismos de transcrição IV. Particularidades da RNAP

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Universidade Federal de Ouro Preto SÍNTESE PROTEICA

Universidade Federal de Ouro Preto SÍNTESE PROTEICA Universidade Federal de Ouro Preto SÍNTESE PROTEICA SÍNTESE DE MACROMOLÉCULAS Macromoléculas: Proteínas - aa Carboidratos - monossacarídeos Lipídeos ácidos graxos Macromoléculas celulares: em constante

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA.

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Controle da expressão gênica

Controle da expressão gênica Programa de Biologia Celular V Curso de Verão Controle da expressão gênica Renata Ramalho Oliveira Desenvolvimento e fenótipos explicados pela modulação da expressão gênica Lehninger.

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: Telefone: (16) 3373-9159 O processo da

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais


CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais



Leia mais


BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017 Princípios Básicos de Genética Molecular Parte II Profª Ana Claudia 17/02/2017 Estrutura do material genético Estrutura de Genomas e variabilidade Replicação Transcrição Tradução Regulação da Expressão

Leia mais


DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais


Aula 6 REPLICAÇÃO DO DNA E TRANSCRIÇÃO REPLICAÇÃO DO DNA E TRANSCRIÇÃO META Apresentar os processos de replicação e transcrição do material genético e fornecer as informações necessárias para o estudante compreender a base molecular da hereditariedade

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais


GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

BIOLOGIA Prof. André Fozzy

BIOLOGIA Prof. André Fozzy BIOLOI Prof. ndré Fozzy RN E SÍNTESE PROTEIC Biologia Prof. ndré Fozzy Regiões Codificadoras e Não-Codificadoras do DN O DN é formado por 2 regiões: Intergênicas ênicas Intergênicas ênicas Região ênica

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais


Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais


ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA ESTRUTURA DO DNA E ORGANIZAÇAO DA CROMATINA ATIVIDADE BIOLÓGICA 1 Qual é a natureza química da molécula responsável por estocar a informação genética??? CARACTERÍSTICAS 1. Estocar a informação e transmitir

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação.

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação. Organização estrutural e funcional do núcleo DNA RNA Proteínas Replicação Transcrição Processamento (Splicing) Tradução (citoplasma) Cromatina - Eucromatina - Heterocromatina Cromossomo - Mitose 1 DNA

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA TRANSCRIÇÃO - Pontos Principais: Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA A transcrição é realizada por enzimas

Leia mais

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva Controle da expressão gênica Prof. Dr. José Luis da C. Silva Controle da Expressão gênica Procariotos Princípios da regulação gênica Organismos procariontes e eucariontes são sensíveis à pequenas variações

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais