Distribuições Estatísticas

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Distribuições Estatísticas"

Transcrição

1 Distribuições Estatísticas Para darmos sequência ao estudo da estatística, será necessário conhecer um pouco mais sobre as distribuições mais utilizadas, como distribuição normal, distribuição Gama, distribuição T de Student. Sendo assim, elas eram consideradas sob diversos aspectos, como denição, aplicações e principais propriedades. 1 O que é uma Distribuição? Para responder a essa pergunta, será necessário percorrer um longo caminho, que passará pela denição de variáveis aleatórias, distribuições de probabilidades discretas, média, variância e desvio padrão e valor esperado. Após isso, será considerada nalmente a distribuição normal, o que é uma distribuição continua das mais importantes na estatística. Então vejamos essas denições. A referência bibliográca mais importante nesse capítulo é encontrada em Larson et al. (2004), que servirá como fundamentação desse texto. 1.1 Variáveis Aleatórias Primeiramente, considere o tema variáveis aleatórias. Conforme já foi visto na aula 2, uma variável aleatória é uma função que associa elementos de um espaço amostral a valores numéricos (Wikipédia, 2015). Talvez o exemplo recorrente de variável aleatória é resultado do lançamento de um dado honesto, que certamente irá assumir os valores naturais compreendidos entre 1 e 6, inclusive; o que corresponde a um único dentre os valores do espaço amostral desse exemplo: S = {1, 2, 3, 4, 5, 6}. Outro exemplo bastante utilizado é a função que conta o número de resultados cara no lançamento de 3 moedas. O espaço amostral está exibido na Figura, também chamada de árvore, ferramenta bastante usada na contagem de elementos. A Variável aleatória "número de caras" poderá então assumir os valores 0, 1, 2 e 3, mas esse resultado não pode ser determinado a priori, por depender de fatores aleatórios. 1.2 Variáveis Aleatórias Contínuas e Variáveis Aleatórias Discretas. Há dois tipos de variáveis aleatórias: as discretas e as contínuas. Conforme já foi denido previamente, variáveis discretas são aquelas que cujos conjuntos são enumeráveis. A grosso modo os elementos desses conjuntos podem ser listados. Como exemplo podemos citar o número de ligações com vendedor faz ao longo de um dia: isso pode ser 0, 1, 2, 3, e assim por diante, mas sempre é possível listar tais números. 1

2 Figura 1.1: Espaço amostral do lançamento de três moedas, sendo C a face correspondente a cara, e c a coroa. Uma variável aleatória contínua não pode ser enumerada. Um exemplo é o conjunto de todas as alturas dos seres humanos vivos hoje na Terra: o resultado pode ser qualquer valor entre, digamos, 50 centímetros a dois metros e meio, mas não se Pode listar todos os elementos desse conjunto. Exemplo 1. Decida se essa variável aleatória continua ou discreta: (a) Número de atendimentos realizados pelo call center de uma empresa telefônica. (b) volume em litros vendidos por um posto de gasolina ao longo de um mês. Solução: qualquer que seja o número de atendimentos realizados, eles sempre podem ser enumerados, desde 0 até um número nito deles. Mas como se pode contar número de elementos de tal conjunto ele é discreto. Já o volume de combustível vendido por um posto de gasolina pode assumir qualquer valor entre 0 e o total colocado à venda pela empresa, mais tais elementos nunca podem ser listados, como foi possível no caso anterior. Logo, essa é uma variável aleatória continua. Objetivo das aulas era concentrado no estudo de variáveis aleatórias discretas; sendo que as variáveis aleatórias contínuas serão objeto da próxima aula. 1.3 Distribuições de Probabilidade Discretas A cada valor de variável aleatória discreta pode se associar uma probabilidade. Para ver isso, considere novamente o exemplo do número de caras do lançamento de 3 moedas. A contagem do número de caras do espaço amostral está ilustrada na Figura

3 Figura 1.2: Contagem do número de caras do lançamento de três moedas. Tabela 1: Distribuição de probabilidades do aparecimento de n caras no lançamento de 3 moedas honestas. n p (n) Perceba então que o total de resultados possíveis é. Para determinar a probabilidade de que um certo número de faces apareça, basta contar tal quantidade e dividir pelo total. Então, se essa contagem for denominada f (n) (a letra f foi escolhida por ser a inicial de frequência, ou seja, f (n) denota a frequência do resultado n), sendo n = 0, 1, 2, ou 3, segue que e f (3) = 1; f (2) = 3; f (1) = 3; f (0) = 1. Daí, as probabilidades são: p (3) = 1, p (2) = 3, p (1) = 3 e p (0) = 1. A Tabela tal resume esses dados. 3

4 Pode-se vericar que cada uma dessas probabilidades é um número entre 0 e 1. Isso é uma das características fundamentais das distribuições de probabilidade. A outra característica pode ser vericada nesse exemplo: a soma das probabilidades deve ser igual a unidade: n p (i) = p (0) + p (1) + p (2) + p (3) i=0 = = = = 1. Isso signica que tal função deve descrever as probabilidades de todos os resultados possíveis, ou de outra forma, que a probabilidade de que qualquer um dos resultados apareça é certa, 1 = 100%. De forma geral, essas propriedades se expressam na forma das equações e n p (i) = 1 i=1 0 p (i) 1 i. Tais funções de distribuições costumam ser representadas em grácos chamados de histogramas, que são grácos compostos por retângulos de base unitária centrados em torno do valor assumido pela variável aleatória e cuja altura é a probabilidade desse valor. Na Figura 1.3, ilustração o histograma referente a um exemplo do número de caras do lançamento de três moedas honestas.. Exemplo 2. Construindo e representando uma distribuição de probabilidade discreta por meio de um gráco. Um psicólogo Industrial aplicou um teste de inventário de personalidade para identicar características passivo-agressiva em 150 colaboradores. Os indivíduos receberam uma pontuação de 1 a 5, sendo 1 extremamente passivo e 5 extremamente agressivo. Uma pontuação 3 indicavam a neutralidade. Os resultados estão indicados na Tabela 2. Construa uma distribuição de probabilidade para a variável aleatória X. Depois represente gra- camente distribuição usando um histograma. Solução. Divida a frequência de cada pontuação pelo número total de indivíduos para encontrar a probabilidade de cada valor da variável aleatória:p (1) = = 0.16, p (2) = 150 = 0.22, p (3) = = 0.2, p (4) = 150 = 0.20 e p (5) = 150 = A distribuição de probabilidade está representada na Tabela 3 O histograma está representado na Figura 1.4. Veja que os retângulos tem bases unitárias em torno do valor da variável aleatória cujas alturas correspondentes são as próprias probabilidades desses valores. 4

5 Histogram of a Density a Figura 1.3: Histograma do exemplo do lançamento de três moedas honestas. Tabela 2: Características passivo-agressivas. Escore x Frequência f (x)

6 Tabela 3: Distribuição de probabilidade da pesquisa do inventário de personalidade. x p (x) Histogram of a Density a Figura 1.4: Histograma do exemplo do invetário de personalidade. 6

7 2 Distribuições Binomiais Esse tipo de distribuição é muito provavelmente a mais importante das distribuições discretas. Essas distribuições se aplicam eventos binomiais, que são eventos com os seguintes atributos: 1. O experimento é repetido um número xo de tentativas e cada tentativa é independente das demais. 2. Apenas dois resultados possíveis de interesse que pode ser classicados como sucesso ou fracasso. 3. A probabilidade de sucesso ou fracasso é a mesma para cada tentativa. 4. A variável aleatória x contabiliza o número de tentativas com sucesso. Anotação utilizada para descrever os parâmetros de seus experimentos é a seguinte: n denota o número de experimentos; p = P (S) é a probabilidade de sucesso de uma única tentativa; q = P (F ) é a probabilidade de fracasso em uma única tentativa. Percebam que, como a soma de todas essas probabilidades deve ser unitária, há uma relação entre p e q: p + q = 1 q = 1 p. X é a variável aleatória que conta o número de sucessos nas n tentativas. Logo, os valores que X pode assumir são {0, 1, 2,..., n}. Exemplo 3. Desse desse experimento é binomial ou não. Caso ele seja, Especi- que os valores de n, p e q; e liste todos os valores possíveis da variável aleatória X. Caso ele não seja, explique o porquê. 1. Um dado procedimento cirúrgico tem 5 por cento de chances de sucesso. O médico realiza o procedimento em oito pacientes. A variável aleatória representa o número de cirurgias com sucesso. 2. Uma jarra contém 5 bolinhas de gude vermelhas 9 azuis e 6 verdes. Você escolhe três bolinhas aleatoriamente sem reposição. A variável aleatória representa o número de bolinhas vermelhas. No caso 1, há de fato um experimento binomial. Isso porque, a cada experimento, a probabilidade de sucesso é a mesma; em outras palavras esses experimentos são todos independentes. A variável aleatória obviamente está determinando o número de sucessos em uma dada seqüência de experimentos, e há apenas dois resultados possíveis, sucesso e fracasso, meu número de experimentos é xo. p =.5, q = = 0.25, n =, e X é o número de sucessos dentre as n cirurgias. Já no caso 2, o experimento não pode ser considerado binomial porque não há reposição das bolinhas na jarra. Sendo assim a probabilidade de sucesso em cada uma das experiência diferente. Isso já é incompatível com os parâmetros que usamos para decidir se o experimento binomial. 7

8 Referências Larson, Ron, Farber, Betsy, & traducão técnica Patarra, Cyro; Estatística aplicada. Prentice Hall. Wikipédia Variável aleatória Wikipédia, a enciclopédia livre. [Online; accessed 22-setembro-2015].

Aula de Estatística 13/10 à 19/10. Capítulo 4 (pág. 155) Distribuições Discretas de Probabilidades

Aula de Estatística 13/10 à 19/10. Capítulo 4 (pág. 155) Distribuições Discretas de Probabilidades Aula de Estatística 13/10 à 19/10 Capítulo 4 (pág. 155) Distribuições Discretas de Probabilidades 4.1 Distribuições de probabilidades Variáveis Aleatórias Geralmente, o resultado de um experimento de probabilidades

Leia mais

PROBABILIDADE E ESTATÍSTICA I. Aulas 6, 7 e 8 - Prof. Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA I. Aulas 6, 7 e 8 - Prof. Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA I Aulas 6, 7 e 8 - Prof. Regina Meyer Branski slide 2 Aula de hoje! Diferenciar variáveis aleatórias discretas e contínuas Construir uma distribuição de probabilidade discreta

Leia mais

Modelos Probabilísticos Teóricos Discretos e Contínuos. Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal

Modelos Probabilísticos Teóricos Discretos e Contínuos. Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal Modelos Probabilísticos Teóricos Discretos e Contínuos Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal Distribuição de Probabilidades A distribuição de probabilidades de uma variável aleatória:

Leia mais

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS INTRODUÇÃO O que é uma variável aleatória? Um tipo de variável que depende do resultado aleatório de um experimento aleatório. Diz-se que um experimento é

Leia mais

Variável Aleatória. Gilson Barbosa Dourado 6 de agosto de 2008

Variável Aleatória. Gilson Barbosa Dourado 6 de agosto de 2008 Variável Aleatória Gilson Barbosa Dourado gdourado@uneb.br 6 de agosto de 2008 Denição de Variável Aleatória Considere um experimento E e seu espaço amostral Ω = {a 1, a 2,..., a n }. Variável aleatória

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova de Probabilidade Prof.: Fabiano F. T. dos Santos Goiânia, 31 de outubro de 014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno Unidade I ESTATÍSTICA APLICADA Prof. Mauricio Fanno Estatística indutiva Estatística descritiva Dados no passado ou no presente e em pequena quantidade, portanto, reais e coletáveis. Campo de trabalho:

Leia mais

PROBABILIDADE E ESTATÍSTICA. Profa. Dra. Yara de Souza Tadano

PROBABILIDADE E ESTATÍSTICA. Profa. Dra. Yara de Souza Tadano PROBABILIDADE E ESTATÍSTICA Profa. Dra. Yara de Souza Tadano yaratadano@utfpr.edu.br Aula 7 11/2014 Variáveis Aleatórias Variáveis Aleatórias Probabilidade e Estatística 3/41 Variáveis Aleatórias Colete

Leia mais

2. EXERCÍCIOS PROPOSTOS SOBRE V.A. E DISTRIB.PROBAB.

2. EXERCÍCIOS PROPOSTOS SOBRE V.A. E DISTRIB.PROBAB. 2. EXERCÍCIOS PROPOSTOS SOBRE V.A. E DISTRIB.PROBAB. 1) Classifique as seguintes variáveis aleatórias como discretas ou contínuas. X : o número de acidentes de automóvel por ano na rodovia BR 116. Y :

Leia mais

5 Distribuição normal de probabilidade. Estatística Aplicada Larson Farber

5 Distribuição normal de probabilidade. Estatística Aplicada Larson Farber 5 Distribuição normal de probabilidade Estatística Aplicada Larson Farber Seção 5.1 Introdução às distribuições normais Propriedades de uma distribuição normal Suas média, mediana e moda são iguais. Tem

Leia mais

FACULDADE DE TECNOLOGIA DE GUARATINGUETÁ

FACULDADE DE TECNOLOGIA DE GUARATINGUETÁ FACULDADE DE TECNOLOGIA DE GUARATINGUETÁ ESTATÍSTICA II Nota de aula 1 Prof. MSc. Herivelto T Marcondes dos Santos Fevereiro /2009 1 Modelos de probabilidade 1.1 Variável aleatória Definição: Sejam ε um

Leia mais

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto Estatística Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas Professor Fernando Porto Lançam-se 3 moedas. Seja X o número de ocorrências da face cara. O espaço amostral do experimento é: W = {(c,c,c),(c,c,r),(c,r,c),(c,r,r),(r,c,c),(r,c,r),(r,r,c),(r,r,r)}

Leia mais

Estatística. Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas. Professor Fernando Porto

Estatística. Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas. Professor Fernando Porto Estatística Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas Professor Fernando Porto Capítulo 4 Baseado no Capítulo 4 do livro texto, Distribuições Teóricas de Probabilidades

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Distribuição Geométrica 08/14 1 / 13

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Distribuição Geométrica 08/14 1 / 13 Probabilidade I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Distribuição Geométrica 08/14 1 / 13 Distribuição Geométrica Considere novamente uma sequência

Leia mais

Probabilidade. Variáveis Aleatórias Distribuição de Probabilidade

Probabilidade. Variáveis Aleatórias Distribuição de Probabilidade Probabilidade Variáveis Aleatórias Distribuição de Probabilidade Variáveis Aleatórias Variável Aleatória Indica o valor correspondente ao resultado de um experimento A palavra aleatória indica que, em

Leia mais

Intervalos de Confiança

Intervalos de Confiança Intervalos de Confiança INTERVALOS DE CONFIANÇA.1 Conceitos básicos.1.1 Parâmetro e estatística Parâmetro é a descrição numérica de uma característica da população. Estatística é a descrição numérica de

Leia mais

Princípios de Modelagem Matemática Aula 09

Princípios de Modelagem Matemática Aula 09 Princípios de Modelagem Matemática Aula 09 Prof. José Geraldo DFM CEFET/MG 12 de maio de 2014 1 Modelos estatísticos e estimação de parâmetros A verificação de um modelo matemático demanda a realização

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA. Variáveis Aleatórias. Departamento de Estatística Luiz Medeiros

UNIVERSIDADE FEDERAL DA PARAÍBA. Variáveis Aleatórias. Departamento de Estatística Luiz Medeiros UNIVERSIDADE FEDERAL DA PARAÍBA Variáveis Aleatórias Departamento de Estatística Luiz Medeiros Introdução Como sabemos, características de interesse em diversas áreas estão sujeitas à variação; Essa variabilidade

Leia mais

Cursos de Licenciatura em Ensino de Matemática e de EGI Teoria de Probabilidade

Cursos de Licenciatura em Ensino de Matemática e de EGI Teoria de Probabilidade FACULDADE DE CIÊNCIAS NATURAIS E MATEMÁTICA DEPARTAMENTO DE MATEMÁTICA Campus de Lhanguene, Av. de Moçambique, km, Tel: +5 4007, Fax: +5 400, Maputo Cursos de Licenciatura em Ensino de Matemática e de

Leia mais

AULA 07 Distribuições Discretas de Probabilidade

AULA 07 Distribuições Discretas de Probabilidade 1 AULA 07 Distribuições Discretas de Probabilidade Ernesto F. L. Amaral 31 de agosto de 2010 Metodologia de Pesquisa (DCP 854B) Fonte: Triola, Mario F. 2008. Introdução à estatística. 10 ª ed. Rio de Janeiro:

Leia mais

1 Introdução. 2 Variáveis Aleatórias Discretas (VAD)

1 Introdução. 2 Variáveis Aleatórias Discretas (VAD) Prof. Janete Pereira Amador 1 1 Introdução Muitas situações cotidianas podem ser usadas como experimento que dão resultados correspondentes a algum valor, e tais situações podem ser descritas por uma variável

Leia mais

LISTA DE EXERCÍCIOS 2 VARIÁVEIS ALEATÓRIAS

LISTA DE EXERCÍCIOS 2 VARIÁVEIS ALEATÓRIAS Universidade Federal de Ouro Preto Instituto de Ciências Exatas e Biológicas Departamento de Matemática MTM 5 Estatística Turma 22 Professor: Rodrigo Luiz Pereira Lara LISTA DE EXERCÍCIOS 2 VARIÁVEIS ALEATÓRIAS

Leia mais

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA Aula 2 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade condicional 3. Eventos Dependentes e Independentes 4. Regra da Multiplicação

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 6 - Introdução à probabilidade Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Experimento Experimento aleatório (E ): é um experimento que pode ser repetido indenidamente

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE.1 INTRODUÇÃO Admita que, de um lote de 10 peças, 3 das quais são defeituosas, peças são etraídas ao acaso, juntas (ou uma a uma, sem reposição). Estamos

Leia mais

Cálculo das Probabilidades e Estatística I

Cálculo das Probabilidades e Estatística I Cálculo das Probabilidades e Estatística I Prof a. Juliana Freitas Pires Departamento de Estatística Universidade Federal da Paraíba - UFPB juliana@de.ufpb.br Variáveis Aleatórias Ao descrever um espaço

Leia mais

Definição: É uma coleção bem definida de

Definição: É uma coleção bem definida de EST029 Cálculo de Probabilidade I Cap. 1: Introdução à Probabilidade Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Conjuntos: Definição e notação Definição: É uma coleção bem definida de objetos,

Leia mais

MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade

MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade Edson de Faria Departamento de Matemática IME-USP 26 de Agosto, 2013 Probabilidade: uma Introdução / Aula 5 1 Variáveis aleatórias Definição

Leia mais

2 Conceitos Básicos de Probabilidade

2 Conceitos Básicos de Probabilidade CE003 1 1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento de técnicas estatísticas

Leia mais

Estatística e Probabilidade Aula 7 Cap 04

Estatística e Probabilidade Aula 7 Cap 04 Aula 7 Cap 04 Um estatístico é aquele que, se está com a cabeça em um forno e os pés enterrados no gelo, ainda diz que na média está tudo bem. Na aula anterior vimos... Variáveis aleatórias Distribuições

Leia mais

Escola Politécnica da USP Engenharia de Petróleo e Gás DISTRIBUIÇÃO DE PROBABILIDADE CONTÍNUA. Aulas 10, 11,12 e 13 - Prof. Regina Meyer Branski

Escola Politécnica da USP Engenharia de Petróleo e Gás DISTRIBUIÇÃO DE PROBABILIDADE CONTÍNUA. Aulas 10, 11,12 e 13 - Prof. Regina Meyer Branski Escola Politécnica da USP Engenharia de Petróleo e Gás DISTRIBUIÇÃO DE PROBABILIDADE CONTÍNUA Aulas 10, 11,12 e 13 - Prof. Regina Meyer Branski Objetivos Distribuição Normal e Distribuição Normal Padrão

Leia mais

VARIÁVEIS ALEATÓRIAS

VARIÁVEIS ALEATÓRIAS UNIVERSIDADE FEDERAL DE JUIZ DE FORA INSTITUTO DE CIÊNCIAS EXATAS DEPARTAMENTO DE ESTATÍSTICA VARIÁVEIS ALEATÓRIAS Joaquim H Vianna Neto Relatório Técnico RTE-03/013 Relatório Técnico Série Ensino Variáveis

Leia mais

Variáveis Aleatórias Discretas e Distribuição de Probabilidade

Variáveis Aleatórias Discretas e Distribuição de Probabilidade Variáveis Aleatórias Discretas e Distribuição de Probabilidades - parte II 29 de Março de 2011 Distribuição Uniforme Discreta Média Propriedade da falta de memória Objetivos Ao final deste capítulo você

Leia mais

a) Considerando o lançamento de dois dados, o espaço amostral é Tabela 1: Tabela de distribuição de X. X P 11/36 9/36 7/36 5/36 3/36 1/36

a) Considerando o lançamento de dois dados, o espaço amostral é Tabela 1: Tabela de distribuição de X. X P 11/36 9/36 7/36 5/36 3/36 1/36 1 Exercício 1 Um par de dados não viciados é lançado. Seja X a variável aleatória denotando o menor dos dois números observados. a) Encontre a tabela da distribuição dessa variável. b) Construa o gráfico

Leia mais

Conceitos básicos: Variável Aleatória

Conceitos básicos: Variável Aleatória : Variável Aleatória Variável aleatória (v.a.) valor numérico que é resultado de uma eperiência aleatória. Podemos ter variáveis aleatórias contínuas ou discretas. Eemplo 1: Suponha que lança duas moedas

Leia mais

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB Variáveis Aleatórias Prof. Tarciana Liberal Departamento de Estatística - UFPB Introdução Ao descrever o espaço amostral de um experimento aleatório, não especificamos que um resultado individual seja

Leia mais

Probabilidade. Prof. Paulo Cesar F. de Oliveira, BSc, PhD

Probabilidade. Prof. Paulo Cesar F. de Oliveira, BSc, PhD Prof. Paulo Cesar F. de Oliveira, BSc, PhD 1 Seção 3.1 Conceitos básicos de probabilidade 2 ² Experimento de ² Uma ação, ou tentativa, por meio do qual resultados específicos (i.e. contagens, medições

Leia mais

Conceito de Estatística

Conceito de Estatística Conceito de Estatística Estatística Técnicas destinadas ao estudo quantitativo de fenômenos coletivos, observáveis. Unidade Estatística um fenômeno individual é uma unidade no conjunto que irá constituir

Leia mais

Distribuições Discretas

Distribuições Discretas META: Estudar o comportamento das Variáveis Aleatórias Discretas, bem como das Distribuições Binomial e Poisson e suas aplicações. Entender o comportamento de uma Variável aleatória Contínua. OBJETIVOS:

Leia mais

AULA 6 MODELOS PROBABILÍSTICOS

AULA 6 MODELOS PROBABILÍSTICOS UNIVERSIDADE FEDERAL DA BAHIA ESCOLA POLITÉCNICA MEAU- MESTRADO EM ENGENHARIA AMBIENTAL URBANA ENG C 18 Métodos de Pesquisa Quantitativos e Qualitativos AULA 6 MODELOS PROBABILÍSTICOS Docente: Cira Souza

Leia mais

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado.

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado. Sistema Real Determinístico Probabilístico Causas Efeito X Causas Efeito Eperiência para o qual o modelo probabilístico é adequado. ❶ Não é possível prever um resultado particular, mas pode-se enumerar

Leia mais

AULA 02 Distribuição de Probabilidade Normal

AULA 02 Distribuição de Probabilidade Normal 1 AULA 02 Distribuição de Probabilidade Normal Ernesto F. L. Amaral 20 de agosto de 2012 Faculdade de Filosofia e Ciências Humanas (FAFICH) Universidade Federal de Minas Gerais (UFMG) Fonte: Triola, Mario

Leia mais

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB Variáveis Aleatórias Prof. Tarciana Liberal Departamento de Estatística - UFPB Introdução Ao descrever o espaço amostral de um experimento aleatório, não especificamos que um resultado individual seja

Leia mais

ESTATÍSTICA. x(s) W Domínio. Contradomínio

ESTATÍSTICA. x(s) W Domínio. Contradomínio Variáveis Aleatórias Variáveis Aleatórias são funções matemáticas que associam números reais aos resultados de um Espaço Amostral. Uma variável quantitativa geralmente agrega mais informação que uma qualitativa.

Leia mais

Instituto Tecnológico de Aeronáutica Divisão de Engenharia Mecânica-Aeronáutica. Professora: Denise Beatriz T. P. do Areal Ferrari

Instituto Tecnológico de Aeronáutica Divisão de Engenharia Mecânica-Aeronáutica. Professora: Denise Beatriz T. P. do Areal Ferrari Instituto Tecnológico de Aeronáutica Divisão de Engenharia Mecânica-Aeronáutica Professora: Denise Beatriz T. P. do Areal Ferrari denise@ita.br Distribuições Discretas Uniforme Bernoulli Binomial Poisson

Leia mais

VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL

VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL 1 Variável Aleatória Uma função X que associa a cada elemento w do espaço amostral W um valor x R é denominada uma variável aleatória. Experimento: jogar 1 dado

Leia mais

Distribuições de Probabilidade

Distribuições de Probabilidade Distribuições de Probabilidade 1 Aspectos Gerais 2 Variáveis Aleatórias 3 Distribuições de Probabilidade Binomiais 4 Média e Variância da Distribuição Binomial 5 Distribuição de Poisson 1 1 Aspectos Gerais

Leia mais

1 Distribuição de Bernoulli

1 Distribuição de Bernoulli Centro de Ciências e Tecnlogia Agroalimentar - Campus Pombal Disciplina: Estatística Básica - 2013 Aula 6 Professor: Carlos Sérgio Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas

Leia mais

Aproximação da binomial pela normal

Aproximação da binomial pela normal Aproximação da binomial pela normal 1 Objetivo Verificar como a distribuição normal pode ser utilizada para calcular, de forma aproximada, probabilidades associadas a uma variável aleatória com distribuição

Leia mais

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES 1- Ordene os dados indicando o 1º, 2º e 3º quartil 45, 56, 62, 67, 48, 51, 64, 71, 66, 52, 44, 58, 55, 61, 48, 50, 62, 51, 61, 55 2- Faça a análise da

Leia mais

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti PROBABILIDADE Dizemos que a probabilidade é uma medida da quantidade de incerteza que existe em um determinado experimento.

Leia mais

ESTATÍSTICA APLICADA À ADMINISTRAÇÃO

ESTATÍSTICA APLICADA À ADMINISTRAÇÃO ESTATÍSTICA APLICADA À ADMINISTRAÇÃO Thiago Marzagão DISTRIBUIÇÕES CONTÍNUAS DE PROBABILIDADE Thiago Marzagão (IDP) ESTATÍSTICA APLICADA À ADMINISTRAÇÃO 2/2016 1 / 35 variáveis discretas vs variáveis contínuas

Leia mais

Prof. MSc. Herivelto Tiago Marcondes dos Santos

Prof. MSc. Herivelto Tiago Marcondes dos Santos Prof. MSc. Herivelto Tiago Marcondes dos Santos E-mail: herivelto@fatecguaratingueta.edu.br http://herivelto.wordpress.com Ementa Fundamentos da estatística. Coleta e Apresentação de dados. Medidas de

Leia mais

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves PROBABILIDADE ENEM 2016 Prof. Marcela Naves PROBABILIDADE NO ENEM As questões de probabilidade no Enem podem cobrar conceitos relacionados com probabilidade condicional e probabilidade de eventos simultâneos.

Leia mais

INTRODUÇÃO À PROBABILIDADE

INTRODUÇÃO À PROBABILIDADE INTRODUÇÃO À PROBABILIDADE Foto extraída em http://www.alea.pt Profª Maria Eliane Universidade Estadual de Santa Cruz USO DE PROBABILIDADES EM SITUAÇÕES DO COTIDIANO Escolhas pessoais Previsão do tempo

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais

EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Introdução Considere o experimento: Lançamento de uma moeda. Resultados

Leia mais

INTRODUÇÃO À INFERÊNCIA ESTATÍSTICA

INTRODUÇÃO À INFERÊNCIA ESTATÍSTICA UFPE - Universidade Federal de Pernambuco Departamento de Estatística Disciplina: ET-406 Estatística Econômica Professor: Waldemar A. de Santa Cruz Oliveira Júnior INTRODUÇÃO À INFERÊNCIA ESTATÍSTICA Podemos

Leia mais

MOQ-12: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS. VA s e Distribuições

MOQ-12: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS. VA s e Distribuições Motivação: MOQ-2: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS VA s e Distribuições Definimos anteriormente Espaço de Probabilidades como sendo a tripla (W,, P(.)), em que, dado um eperimento, W representa

Leia mais

Probabilidade e Modelos Probabilísticos

Probabilidade e Modelos Probabilísticos Probabilidade e Modelos Probabilísticos 2ª Parte: modelos probabilísticos para variáveis aleatórias contínuas, modelo uniforme, modelo exponencial, modelo normal 1 Distribuição de Probabilidades A distribuição

Leia mais

Unidade IV ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade IV ESTATÍSTICA. Prof. Fernando Rodrigues Unidade IV ESTATÍSTICA Prof. Fernando Rodrigues Análise combinatória Analise combinatória é a área da Matemática que trata dos problemas de contagem. Ela é utilizada para contarmos o número de eventos

Leia mais

MAT 461 Tópicos de Matemática II Aula 8: Resumo de Probabilidade

MAT 461 Tópicos de Matemática II Aula 8: Resumo de Probabilidade MAT 461 Tópicos de Matemática II Aula 8: Resumo de Probabilidade Edson de Faria Departamento de Matemática IME-USP 28 de Agosto, 2013 Probabilidade: uma Introdução / Aula 8 1 Desigualdades de Markov e

Leia mais

Aproximação da Distribuição Binomial pela Distribuição Normal

Aproximação da Distribuição Binomial pela Distribuição Normal Aproximação da Distribuição Binomial pela Distribuição Normal Uma das utilidades da distribuição normal é que ela pode ser usada para fornecer aproximações para algumas distribuições de probabilidade discretas.

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

Uma estatística é uma característica da amostra. Ou seja, se

Uma estatística é uma característica da amostra. Ou seja, se Estatística Uma estatística é uma característica da amostra. Ou seja, se X 1,..., X n é uma amostra, T = função(x 1,..., X n é uma estatística. Exemplos X n = 1 n n i=1 X i = X 1+...+X n : a média amostral

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

Se A =, o evento é impossível, por exemplo, obter 7 no lançamento de um dado.

Se A =, o evento é impossível, por exemplo, obter 7 no lançamento de um dado. PROBABILIDADE Espaço amostral Espaço amostral é o conjunto universo U de todos os resultados possíveis de um experimento aleatório. O número de elementos desse conjunto é indicado por n(u). Exemplos: No

Leia mais

Universidade da Beira Interior Departamento de Matemática

Universidade da Beira Interior Departamento de Matemática Universidade da Beira Interior Departamento de Matemática ESTATÍSTICA Ano lectivo: 2007/2008 Curso: Ciências do Desporto Folha de exercícios nº4: Distribuições de probabilidade. Introdução à Inferência

Leia mais

14. Distribuição de Probabilidade para Variáveis Aleatórias Contínuas

14. Distribuição de Probabilidade para Variáveis Aleatórias Contínuas 4. Distribuição de Probabilidade para Variáveis Aleatórias Contínuas Os valores assumidos por uma variável aleatória contínua podem ser associados com medidas em uma escala contínua como, por exemplo,

Leia mais

CÁLCULO I Aula 01: Funções.

CÁLCULO I Aula 01: Funções. Inversa CÁLCULO I Aula 01: Funções. Prof. Edilson Neri Júnior Prof. André Almeida Universidade Federal do Pará Inversa 1 Funções e seus 2 Inversa 3 Funções Funções e seus Inversa Consideremos A e B dois

Leia mais

Variáveis Aleatórias. Prof. Luiz Medeiros Departamento de Estatística - UFPB

Variáveis Aleatórias. Prof. Luiz Medeiros Departamento de Estatística - UFPB Variáveis Aleatórias Prof. Luiz Medeiros Departamento de Estatística - UFPB Introdução Ao descrever o espaço amostral de um experimento aleatório, não especificamos que um resultado individual seja um

Leia mais

Variáveis Aleatórias Discretas e Distribuição de Probabilidade

Variáveis Aleatórias Discretas e Distribuição de Probabilidade Variáveis Aleatórias Discretas e Distribuição de Probabilidades - parte IV 2012/02 1 Distribuição Poisson Objetivos Ao final deste capítulo você deve ser capaz de: Ententer suposições para cada uma das

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova 1 de Probabilidade I Prof.: Fabiano F. T. dos Santos Goiânia, 15 de setembro de 2014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Teste de hipóteses. Estatística Aplicada Larson Farber

Teste de hipóteses. Estatística Aplicada Larson Farber 7 Teste de hipóteses Estatística Aplicada Larson Farber Seção 7.1 Introdução ao teste de hipóteses Uma hipótese estatística é uma alegação sobre uma população. A hipótese nula H 0 contém uma alternativa

Leia mais

PROBABILIDADE E ESTATÍSTICA. Profa. Dra. Yara de Souza Tadano

PROBABILIDADE E ESTATÍSTICA. Profa. Dra. Yara de Souza Tadano PROBABILIDADE E ESTATÍSTICA Profa. Dra. Yara de Souza Tadano yaratadano@utfpr.edu.br Aula 5 09/2014 Probabilidade Espaços Amostrais e Eventos Probabilidade e Estatística 3/41 Experimentos Aleatórios Experimento

Leia mais

DISTRIBUIÇÕES ESPECIAIS DE PROBABILIDADE DISCRETAS

DISTRIBUIÇÕES ESPECIAIS DE PROBABILIDADE DISCRETAS VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADES 1 1. VARIÁVEIS ALEATÓRIAS Muitas situações cotidianas podem ser usadas como experimento que dão resultados correspondentes a algum valor, e tais situações

Leia mais

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://paginapessoal.utfpr.edu.br/ngsilva Probabilidade Probabilidade Experimento Aleatório Um experimento é dito aleatório quando satisfaz

Leia mais

ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO

ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO 1. (Magalhães e Lima, pg 40) Para cada um dos casos abaixo, escreva o espaço amostral correspondente e conte seus elementos: (a) Uma moeda é lançada duas vezes

Leia mais

ESTATÍSTICA BÁSICA AULA 05

ESTATÍSTICA BÁSICA AULA 05 ESTATÍSTICA BÁSICA AULA 05 TÁ NA MÉDIA! FILIPE S. MARTINS ESTATÍSTICA - ROTEIRO DISTRIBUIÇÃO DE FREQUÊNCIAS TABELA PRIMITIVA E ROL DISTRIBUIÇÃO DE FREQUENCIA ELEMENTOS DE UMA DISTRIBUIÇÃO DE FREQUÊNCIA

Leia mais

Variáveis aleatórias

Variáveis aleatórias Variáveis aleatórias Joaquim Neto joaquim.neto@ufjf.edu.br www.ufjf.br/joaquim_neto Departamento de Estatística - ICE Universidade Federal de Juiz de Fora (UFJF) Versão 3.0 Joaquim Neto (UFJF) ICE - UFJF

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Modelos básicos de distribuição de probabilidade

Modelos básicos de distribuição de probabilidade Capítulo 6 Modelos básicos de distribuição de probabilidade Muitas variáveis aleatórias, discretas e contínuas, podem ser descritas por modelos de probabilidade já conhecidos. Tais modelos permitem não

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais

Nessa situação, a média dessa distribuição Normal (X ) é igual à média populacional, ou seja:

Nessa situação, a média dessa distribuição Normal (X ) é igual à média populacional, ou seja: Pessoal, trago a vocês a resolução da prova de Estatística do concurso para Auditor Fiscal aplicada pela FCC. Foram 10 questões de estatística! Não identifiquei possibilidade para recursos. Considero a

Leia mais

Medidas de Tendência Central

Medidas de Tendência Central ESTATÍSTICA DESCRITIVA Medidas de Tendência Central 3 MEDIDAS DE TENDÊNCIA CENTRAL 3.1 Média Aritmética Uma das mais importantes medidas estatísticas utilizadas é a média. Ela é, por exemplo, utilizada

Leia mais

Probabilidade e Estatística I Antonio Roque Aula 2. Tabelas e Diagramas de Freqüência

Probabilidade e Estatística I Antonio Roque Aula 2. Tabelas e Diagramas de Freqüência Tabelas e Diagramas de Freqüência Probabilidade e Estatística I Antonio Roque Aula 2 O primeiro passo na análise e interpretação dos dados de uma amostra consiste na descrição (apresentação) dos dados

Leia mais

Ministério da Educação. Nome:... Número:

Ministério da Educação. Nome:... Número: Ministério da Educação Nome:...... Número: Unidade Lectiva de: Introdução às Probabilidades e Estatística Ano Lectivo de 2003/2004 Código1334 Teste Formativo Nº 2 1. Considere que na selecção de trabalhadores

Leia mais

INFERÊNCIA ESTATÍSTICA. ESTIMAÇÃO PARA A PROPORÇÃO POPULACIONAL p

INFERÊNCIA ESTATÍSTICA. ESTIMAÇÃO PARA A PROPORÇÃO POPULACIONAL p INFERÊNCIA ESTATÍSTICA ESTIMAÇÃO PARA A PROPORÇÃO POPULACIONAL p Objetivo Estimar uma proporção p (desconhecida) de elementos em uma população, apresentando certa característica de interesse, a partir

Leia mais

Capítulo 3. Introdução à Probabilidade E à Inferência Estatística

Capítulo 3. Introdução à Probabilidade E à Inferência Estatística Capítulo 3 Introdução à Probabilidade E à Inferência Estatística definições e propriedades: Propriedade 5: A probabilidade condicional reflete como a probabilidade de um evento pode mudar se soubermos

Leia mais

Introdução à probabilidade e estatística I

Introdução à probabilidade e estatística I Introdução à probabilidade e estatística I Variáveis Aleatórias Prof. Alexandre G Patriota Sala: 298A Email: patriota@ime.usp.br Site: www.ime.usp.br/ patriota Probabilidade Daqui por diante utilizaremos

Leia mais

Variáveis Aleatórias - VA

Variáveis Aleatórias - VA Variáveis Aleatórias - VA cc ck kc kk 0 1 2 1/4 1/2 Prof. Adriano Mendonça Souza, Dr. Departamento de Estatística - PPGEMQ / PPGEP - UFSM - Introdução Se entende por VA ou V. indicadoras uma lista de valores

Leia mais

ESTATÍSTICA EXPLORATÓRIA

ESTATÍSTICA EXPLORATÓRIA ESTATÍSTICA EXPLORATÓRIA Prof Paulo Renato A. Firmino praf62@gmail.com Aulas 07-08 Probabilidade Apanhado Geral Seguimos nossas discussões sobre a Incerteza Decidir usualmente envolve incerteza Uma presa

Leia mais

Estatística para Cursos de Engenharia e Informática

Estatística para Cursos de Engenharia e Informática Estatística para Cursos de Engenharia e Informática BARBETTA, Pedro Alberto REIS, Marcelo Menezes BORNIA, Antonio Cezar MUDANÇAS E CORREÇOES DA ª EDIÇÃO p. 03, após expressão 4.9: P( A B) = P( B A) p.

Leia mais

Variáveis Aleatórias

Variáveis Aleatórias Variáveis Aleatórias Conceitos, Discretas, Contínuas, Propriedades Itens 5. e 6. BARBETTA, REIS e BORNIA Estatística para Cursos de Engenharia e Informática. Atlas, 004 Variável aleatória Uma variável

Leia mais

PROBABILIDADES E INTRODUÇÃO A PROCESSOS ESTOCÁSTICOS. Aula 7 11 e 12 abril MOQ-12 Probabilidades e Int. a Processos Estocásticos

PROBABILIDADES E INTRODUÇÃO A PROCESSOS ESTOCÁSTICOS. Aula 7 11 e 12 abril MOQ-12 Probabilidades e Int. a Processos Estocásticos PROBABILIDADES E INTRODUÇÃO A PROCESSOS ESTOCÁSTICOS Aula 7 11 e 12 abril 2007 1 Distribuições Discretas 1. Distribuição Bernoulli 2. Distribuição Binomial 3. Distribuição Geométrica 4. Distribuição Pascal

Leia mais

NOÇÕES DE TESTE DE HIPÓTESES (I) Teste de hipóteses para a proporção populacional

NOÇÕES DE TESTE DE HIPÓTESES (I) Teste de hipóteses para a proporção populacional NOÇÕES DE TESTE DE HIPÓTESES (I) Teste de hipóteses para a proporção populacional Estimação Teste de Hipóteses Qual é a probabilidade de "cara no lançamento de uma moeda? A moeda é honesta ou desequilibrada?

Leia mais

Aula 16 - Erivaldo. Probabilidade

Aula 16 - Erivaldo. Probabilidade Aula 16 - Erivaldo Probabilidade Probabilidade Experimento aleatório Experimento em que não pode-se afirmar com certeza o resultado final, mas sabe-se todos os seus possíveis resultados. Exemplos: 1) Lançar

Leia mais

TE802 Processos Estocásticos em Engenharia. Informação sobre a disciplina Notes. Processos Estocásticos em Engenharia Conteúdo Notes.

TE802 Processos Estocásticos em Engenharia. Informação sobre a disciplina Notes. Processos Estocásticos em Engenharia Conteúdo Notes. TE802 Processos Estocásticos em Engenharia Conceitos Básicos de Teoria de Probabilidade 7 de março de 2016 Informação sobre a disciplina Terças e Quintas feiras das 09:30 às 11:20 horas Professor: Evelio

Leia mais