Clonagem, expressão e mutagênese sítio-dirigida da troponina C* do músculo esquelético de frango

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Clonagem, expressão e mutagênese sítio-dirigida da troponina C* do músculo esquelético de frango"


1 Clonagem, expressão e mutagênese sítio-dirigida da troponina C* do músculo esquelético de frango Fernando C. Reinach e Roger Karlsson Bruna Telles Lucas Travessa Thaisa Diniz Disciplina: Engenharia de proteínas Docente: Prof. Dr. Jesus Aparecido Ferro


3 Músculo Liso Estriado Esquelético Cardíaco

4 Músculo esquelético

5 Contração muscular Extremidade N terminal domínio globular (ATP) Extremidade C terminal alfa hélices estendidas Ligação do Ca 2+ Duas cadeias alfa hélice enroladas

6 REGULAÇÃO Sistema de regulação uma molécula de troponina com três subunidades (TNC, TNI, TNT), uma tropomiosina e sete monômeros de actina Ligação de Ca 2+ alterações conformacionais


8 Troponina - Alta quantidade de alfa-hélices; - 2 domínios N-terminal C-terminal conectados por nove longas alfa-hélices com 11 resíduos de aminoácidos centrais - Interação entre os domínios Rota de transferência de informação Com a determinação da estrutura cristalográfica do TNC, dados bioquímicos e estruturais estão disponíveis para projetos de mutantes sítio-dirigidos.

9 Glicina É um aminoácido apolar e hidrofóbico; Apresenta estrutura mais simples pequena cadeia não chega a contribuir de forma significativa para as interações hidrofóbicas.

10 Presença de glicina (Gly-92) no centro da alfa-hélice + Ausência de contato direto entre os domínios Sugestão: dobramento ao redor da Gly-92 originaria uma interação direta entre os domínios

11 Para testar o papel da glicina ao longo da alfa hélice e uma possível função para este resíduo na transferência de informação entre os resíduos Mutação da glicina em uma ALANINA e uma PROLINA

12 Alanina - Faz parte do mesmo grupo da Glicina; - Suas cadeias laterais tendem a se aglomerar entre si nas proteínas, estabilizando a estrutura protéica por meio de interações hidrofóbicas; - Foi selecionada pois diminui a flexibilidade da hélice com a introdução de uma pequena cadeia lateral, a qual não deve interferir com a troponina.

13 Prolina - Faz parte do grupo da Glicina e Alanina; - Apresenta uma cadeia alifática com uma estrutura cíclica; - O grupo amino secundário reduz a flexibilidade estrutural de regiões contendo prolina; - Restringir uma maior extensão da posição de rotação.

14 SITUAÇÃO 1 SITUAÇÃO 2 Glicina é essencial para funcionamento da TNC Glicina não é essencial para o funcionamento da TNC APÓS A MUTAÇÃO APÓS A MUTAÇÃO Insuficiência na regulação da contração muscular Eficiência na regulação da contração muscular

15 OBJETIVO O objetivo desse trabalho foi verificar se a glicina tem participação na transmissão das informações entre os domínios N e C-terminal informações entre os domínios N e C-terminal da troponina durante a contração muscular.


17 Isolamento da fita inteira de cdna - O RNAm foi extraído do músculo peitoral do frango, duas semans após a eclosão do ovo; clones foram feitos em fago λ de gt10; - Estes cdnas foram testados com uma sonda de fita simples de coelho ( 94 pb e codifica os aminoácidos da troponina C;

18 Sonda: dctp, dgtp, dttp, [32P] datp

19 - Os produtos da reação foram digeridos com EcoRI, e a fita marcada contendo o inserto foi purificada em um gel de poliacrilamida em condições desnaturantes. Fonte: Lodish, H., et. al Molecular Cell Biology. 4th ed. New York. W.H. Freeman and Company. página 376.

20 Fonte: Lodish, H., et. al Molecular Cell Biology. 4th ed. New York. W.H. Freeman and Company. Página 367.

21 - A hibridização foi realizada em 5x SSC (20 x SSC é 3M de NaC1, 0,3 M de citrato de sódio, ph 7,0), 0,1% de dodecil sulfato de sódio, 0,1% de Ficoll, 0,1% polivinilpirrolidona, 1 mm EDTA a 67 o C; - Um total de 150 sinais positivos foram isolados; - Dez clones que deram sinais mais fortes tinham inserções de 500 pb; - Quatro clones com inserções maiores que 850 pb foram sequenciados; - Três destes continha a sequência de codificação completa de TNC e porções variáveis de 5 - região não traduzida.

22 Sequenciamento de DNA e proteínas Todas as sequências de DNA foram determinadas utilizando o método de terminação da cadeia didesoxi. O cdna foi sequenciado em ambas as cadeias utilizando uma série de deleções progressivas.

23 Construção do plasmídeo que expressa troponina C - A fita total de cdna foi clonada no sítio EcoRI do M13 derivado de M13K11RX, e um clone com a extremidade 5 'do RNAm de frente para o primer universal foi selecionado; - Um oligonucleótido que codifica a sequência de reconhecimento do factor Xa e os três primeiros aminoácidos da TNC (ATCGAGGGTAGGATGGCGTCAATG) foram usados para eliminar a extremidade 5 'do cdna, e justapor o último códon do fator Xa da sequência de reconhecimento (Arg) para o primeiro códon detnc (Met); - Foi realizada a hibridação;

24 - A cadeia dupla produzida foi transfectada para (JM101) para selecionar os quatro sítios de EcoK e a região 5 'não traduzida do TNC presente no loop de fita simples. Um clone com a supressão correta foi isolado e resequenciado;

25 Mutagênese sítio dirigida - Para evitar manipulações dentro da região codificadora da proteína de fusão, a região de codificação CIIFXTNC foi excisada com EcoRI e clonados em M13mp18; - Dois oligonucleotídeos (ACGCCAAGCCCAAGTCTGA; ACGCCAAGGCCAAGTCTG) foram usados para mutar Gli-92 em Pro e Ala, respectivamente; - A discriminação entre os genes mutantes e TNC do tipo selvagem foi possível com os oligonucleótidos marcados a 62 o C e lavados em 6x SSC. Os mutantes foram purificados em placa, confirmada por sequenciação, e a sequência completa da região codificadora foi determinada;

26 - A Gli-92- Pro e a Gli-92- Ala (F895) construídas foram excisadas do M13mp18 com EcoRI e clonadas em plmplo (19). Após a selecção de clones com a orientação adequada, eles foram testados quanto à expressão. Fonte:

27 Purificação da TNC recombinante e os dois mutantes produzidos em E. coli - Em overnigth uma cultura de QY13 contendo o plasmídeo foi cultivada a 30 o C em 2 x TY (16 g / litro de triptona, 10 g / litro de extrato de levedura, 5 g / litro de NaCl, ph 7,4) com 25 ug / ml de ampicilina; - Três litros do mesmo meio distribuído em frascos foram inoculados com 5 ml da cultura durante a noite e cultivadas a 30 o C até a OD = 0,6. Indução foi realizada por imersão dos frascos em banho de 85 o C, durante o monitoramento da temperatura do meio. À medida que a temperatura atingiu 42 o C (30-45 segundos), os frascos foram transferidos para um banho a 42 o C durante 15 min.

28 - As culturas foram cultivadas durante mais 4 h a 37 o C; - As células foram recolhidas a 6,000 x g durante 10 min e mantidas congeladas; - As células foram ressuspensas em 15 ml de 50 mm Tris-Cl, ph 8,0, 25% de sacarose, 1 mm EDTA, 2 mg / ml de lisozima. Após 15 min, em gelo, MgCl 2, MnCl 2, e DNAase I foram adicionados a uma concentração final de 10 mm, 1 mm e 1 ug / ml; - Quando a viscosidade foi reduzida, 30 ml de 200 mm de NaCl, 1% de ácido desoxicólico, 1,6% de Nonidet P-40, 20 mm Tris- C1, ph 8,0, 2 mm de EDTA foram adicionados. ;

29 - O extrato resultante foi clarificado durante 15 minutos a 10,000 x g e o ácido tricloroacético (100 % w / v de estoque ) foram adicionados, sob agitação contínua a uma concentração final de 5%. O precipitado foi coletado (3000 x g, 10 min) e ressuspenso em 25 mm Tris-Cl, ph 8,0, MgCl 2, 1 mm, 1 mm e dialisado contra o mesmo tampão; Membrana de celofane solvente solução a ser dialisada

30 - Depois de remover o material não ressuspenso o sobrenadante foi feito em 6 M de ureia e carregado a um DEAE-celulose (Whatman DE52) 2 x 15 cm de coluna equilibrada com 50 mm Tris-Cl, ph 8,0, 6 M de ureia, 1 mm de MgCl 2, 1 mm de 2 βmercaptaetanol à temperatura ambiente; - A proteína foi eluída com um gradiente de 100 ml X 100 de 0-0,6 M de NaCl no mesmo tampão;

31 DEAE - celulose A cromatografia de troca iônica compreende duas etapas: 1) adsorção das proteínas com carga contrária à resina, e saída da coluna das proteínas com a mesma carga; 2) eluição das proteínas adsorvidas Adsorção Eluição Na + Cl

32 - A proteína foi dialisada extensivamente em 50 mm Tris-Cl, ph 8,0, 1 mm de MgCl 2 para remover os vestígios de detergentes e manter congelada; - As proteínas de fusão foram digeridas com o factor Xa em 50 mm Tris-Cl, ph 8,0, 100 mm de NaCl, 1 mm de MgCl 2, 0,1 mm CaCl 2 com um substrato enzimático de 30:1 w / w; - Após a digestão a proteína foi purificada na mesma coluna DE52 para remover o peptídeo N-terminal.

33 Ligação de cálcio - Ligação de cálcio para TNC isolada foi medida utilizando um ensaio de filtração. As medições foram feitas nas concentrações de Ca 2+ livre variando de 10-5 a 10-8 M em 50 mm de tampão de imidazol-hcl, ph 7,0, com ou sem 1 mm de MgCl 2. Uma aparente constante de ligação de Ca / EGTA a 25 o C, ph 7,0, de 3 x 10-6 m I foi utilizado para calcular as concentrações de cálcio livres. A concentração final de 45 Ca/EGTA estava na faixa de 5-20 um (atividade específica foi de cpm / pmol).

34 Reconstituição do complexo Troponina - Os complexos de troponina foram remontados com quatro espécies diferentes de TNC com TNI e TNT purificadas a partir do músculo esquelético; - As três subunidades foram misturadas em uma concentração final de 22 pmol/ul de cada componente em 600 ul de 5 mm de imidazol- HCl, ph 7.0, 5 mm de CaCl 2, 500 mm de KCl, 2 mm de sódio ázido, 0,5 mm de DTT; - Decorridas 12 horas de diálise, o tampão tinha a concentração de CaCl 2 reduzida para 2 mm e a concentração de KCl para 250 mm. Depois de mais 12 h o imidazol foi reduzido para 2 mm, CaCl 2 para 20 um, e KCl para 100 mm. - Depois de mais 12 h, as amostras foram centrifugadas numa centrífuga Eppendorf ( x g, 5 min) e um pequeno precipitado (menos de 1% da proteína total) foi observado em todas as quatro amostras;

35 Regulação de cálcio da actina ativada da ATPase miosina - O complexo de troponina (80 ul) foi pré-misturado com a tropomiosina (28 ul de 5,7 mg / ml solução em 20 mm Tris-C1, ph 7,5, 0,1 mm de DTT). A foi então misturada com o complexo troponina-tropomiosina. Depois de 5 min incubada no gelo, a miosina foi adicionada. Depois de se misturar 1,73 ml de 40 mm de KCl, 5 mm MgCl, 0,1 mm de EGTA, 0,25 mm de DTT foram adicionados à mistura; - Cálcio (10 ul de 100 mm de CaCl 2 ) foi adicionado no final do experimento para determinar a regulação adequada do filamento. Para medir mais a taxa de cálcio, o cálcio foi adicionado antes da ATP, e o mesmo procedimento foi seguido. Uma maior consistência a partir de um experimento para outro pode ser obtido através da medição da taxa de positivo e negativo em experiências separadas;








43 cdna codificando para a troponina C do músculo esquelético de frango foi clonado e expresso em E. coli; Após purificação desta proteína observou-se que ela liga-se ao cálcio com as mesmas propriedades que a proteína purificada do músculo; A produção da TNC funcional a partir de um cdna clonado permite investigar detalhes da estrutura e função desta molécula.

44 Produção de TNC na E. coli A sequência desconhecida de 4 resíduos da porção N- terminal foi determinada a partir da sequência do cdna; Encontrou-se duas substituições de aminoácidos: asparagina por ácido aspártico na posição 100 possivelmente deve-se à desaminação da proteína durante o sequenciamento; A mudança de isoleucina por treonina na posição 130 pode ser devido à variações alélicas.

45 A principal diferença na estrutura primária da proteína recombinante e a purificada do músculo do frango reside no fato de que a proteína da frango possui um resíduo N- terminal bloqueado e perde a metionina inicial; No sistema de expressão, pela clivagem da proteína fundida com o Fxa, o resíduo N terminal permanece desbloqueado e a metionina permanece; Estrutura cristalina: resíduos da porção N terminal ficam mal resolvidos e parecem não se conectar ao restante da molécula

46 Mutantes de Gly-92 Evidências de mudanças conformacionais no domínio C- terminal induzidas por çigação do cálcio na porção N- terminal : mudanças na intensidade de fluorescência em sonda ligada ao Cys-98 ( porção C-terminal da alfa-hélice); Gly-92 no centro da hélice: rotação traria os domínios a uma configuração mais próxima; Flexibilidade na hélice; Substituição por outros resíduos sem alterar função da TNC : papel essencial de Gly-92 rejeitada.

47 Os dois mutantes foram utilizados para restringir a flexibilidade da hélice; Estrutura com prolina na posição 92: normalmente ocasionam quebra da estrutura, porém, têm-se encontrado prolinas em alfa- hélices; Modelo da hélice utilizado para analisar como acomodar prolina nesta posição.

48 Os mutantes apresentaram propriedades normais na ligação do cálcio e na regulação da ATPase da miosina; Os resultados demonstram que a glicina-92 não é essencial no correta função do filamento fino; Os mutantes Pro e Ala provavelmente aumentaram a rigidez da hélice central: grandes rotações nesta parte da molécula não devem estar envolvidas na função da TNC.

49 É possível que a estabilidade promovida pelos mutantes é pequena em comparação com a energia envolvida na mudança conformacional; A expressão de troponina C funcional em E. coli e a análise de mutantes sítio- dirigidos possibilitam analisar mecanismos moleculares da regulação da atividade muscular e interações entre estrutura e função na TNC.


A agricultura moderna está sendo revolucionada pela introdução de plantas geneticamente modificadas;


Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais


ESTRUTURA DAS PROTEÍNAS ESTRUTURA DAS PROTEÍNAS Aminoácidos ligam-se por ligações peptídicas = reação de condensação entre: OH do grupo carboxila de um aminoácido H do grupo amina do outro aminoácido ( liberação de uma molécula

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D

Rachel Siqueira de Queiroz Simões, Ph.D Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Bioquímica. Purificação de proteínas

Bioquímica. Purificação de proteínas Bioquímica Purificação de proteínas Estratégia geral - Liberação da proteína do material biológico - Podem ser separados por fracionamento celular - Pode-se separar proteínas por características: Solubilidade

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010 BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010 (Duração: 1,5 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Separação e Cromatografia de Proteínas

Separação e Cromatografia de Proteínas QBQ0316N: Bioquímica Experimental Farmácia São Paulo, 11 de setembro 2013 Separação e Cromatografia de Proteínas Universidade de São Paulo QBQ0316N: Bioquímica Experimental Farmácia São Paulo, 11 de setembro

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais


RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais

UFABC Bacharelado em Ciência & Tecnologia

UFABC Bacharelado em Ciência & Tecnologia UFABC Bacharelado em Ciência & Tecnologia Transformações Bioquímicas (BC0308) Prof Luciano Puzer Propriedades, funções e transformações de aminoácidos e proteínas

Leia mais

Estrutura tridimensional de proteínas. Prof. Dr. Fernando Berton Zanchi

Estrutura tridimensional de proteínas. Prof. Dr. Fernando Berton Zanchi Estrutura tridimensional de proteínas Prof. Dr. Fernando Berton Zanchi Níveis de Estruturas Protéicas A conformação espacial das proteínas As proteínas não são traços rígidos porque suas ligações químicas

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais


BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 036N 203 Professores Carlos Takeshi Hotta Guilherme Menegon Arantes Esta apostila foi desenvolvida

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais

Histologia do Tecido Muscular

Histologia do Tecido Muscular Histologia do Tecido Muscular Vera Regina Andrade, 2014 Células ou fibras alongadas possuem proteínas contráteis Com capacidade de contração e distensão, proporcionando os movimentos corporais Três tipos

Leia mais


LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais


BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 06N 0 Professores Carlos T. Hotta Ronaldo B. Quaggio Eduardo M. Reis Esta apostila foi desenvolvida

Leia mais


ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015.

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Roteiro. Contracao muscular e potencial de acao. Musculo cardiaco caracteristicas da contracao do musculo cardiaco

Roteiro. Contracao muscular e potencial de acao. Musculo cardiaco caracteristicas da contracao do musculo cardiaco Roteiro Contracao muscular e potencial de acao Musculo cardiaco caracteristicas da contracao do musculo cardiaco Impulsos eletricos no coracao Sistema nervoso simpatico e parassimpatico e a atividade cardiaca

Leia mais

Proteínas. As proteínas são o centro da acção em todos os processos biológicos. Voet & Voet Biochemistry

Proteínas. As proteínas são o centro da acção em todos os processos biológicos. Voet & Voet Biochemistry Proteínas As proteínas são o centro da acção em todos os processos biológicos. Voet & Voet Biochemistry As proteínas são os compostos orgânicos mais abundantes dos organismos vivos (~50% do peso sêco)

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Separação de Misturas

Separação de Misturas 1. Introdução Separação de Misturas As misturas são comuns em nosso dia a dia. Como exemplo temos: as bebidas, os combustíveis, e a própria terra em que pisamos. Poucos materiais são encontrados puros.

Leia mais


TECIDO MUSCULAR CARACTERÍSTICAS TECIDO MUSCULAR CARACTERÍSTICAS O tecido muscular é formado por células alongadas ricas em filamentos (miofibrilas), denominadas fibras musculares. Essas células tem origem mesodérmica e são muito especializadas

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

Síntese do acetato de n-butilo ou etanoato de n-butilo

Síntese do acetato de n-butilo ou etanoato de n-butilo Projeto Ciência Viva INTRODUÇÃO À QUÍMICA VERDE, COMO SUPORTE DA SUSTENTABILIDADE, NO ENSINO SECUNDÁRIO PL 3.4 Identificação e síntese de substâncias com aromas e sabores especiais Síntese do acetato de

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais


BIOQUÍMICA EXPERIMENTAL BIOQUÍMICA EXPERIMENTAL QBQ-4025 Departamento de Bioquímica- Instituto de Química - USP Professores Fábio Luís Forti Carlos Takeshi Hotta Os protocolos que constam desta disciplina foram originalmente

Leia mais

Disciplina de BIOQUÍMICA do Curso de MEDICINA da Faculdade de Medicina da Universidade de Coimbra 1º Ano 2007/2008 SEMINÁRIOS ORIENTADOS APOIO SO10

Disciplina de BIOQUÍMICA do Curso de MEDICINA da Faculdade de Medicina da Universidade de Coimbra 1º Ano 2007/2008 SEMINÁRIOS ORIENTADOS APOIO SO10 Disciplina de BIOQUÍMICA do Curso de MEDICINA da Faculdade de Medicina da Universidade de Coimbra 1º Ano 2007/2008 SEMINÁRIOS ORIENTADOS APOIO SO10 VÍDEO I Estrutura da célula e isolamento dos organelos

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Síntese Artificial de Peptídeos

Síntese Artificial de Peptídeos Síntese Artificial de Peptídeos Rebeca Bayeh Seminário apresentado para a disciplina Princípios Físicos Aplicados à Fisiologia (PGF530) Prof. Dr. Adriano Mesquita Alencar Segundo semestre de 2013 Motivação

Leia mais



Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: Telefone: (16) 3373-9159 O processo da

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Produção de Proteínas Recombinantes em Escherichia coli

Produção de Proteínas Recombinantes em Escherichia coli Produção de Proteínas Recombinantes em Escherichia coli Prof. Dr. Catarina Akiko Miyamoto 1 Resumo A produção de proteínas recombinantes para fins terapêuticos, veterinários, e agro-pecuários tem se mostrado

Leia mais

Géis de Entrada e Separação

Géis de Entrada e Separação (1) Géis de Entrada e Separação ESCOLHA DO GEL Depende do tamanho da proteína que se quer detectar: Tamanho da Proteína Gel 4 40 kda 20% 12 45 kda 15% 10 70 kda 12% 15 100 kda 10% 25 200 kda 8% PREPARO

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais



Leia mais

Características: Células alongadas e grande quantidade de filamentos contráteis; Origem mesodérmica;

Características: Células alongadas e grande quantidade de filamentos contráteis; Origem mesodérmica; Características: Células alongadas e grande quantidade de filamentos contráteis; Origem mesodérmica; Características: Tipos: Músculo estriado esquelético; Músculo estriado cardíaco; Músculo liso; Músculo

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula Genética

Prof. Marcelo Langer. Curso de Biologia. Aula Genética Prof. Marcelo Langer Curso de Biologia Aula Genética CÓDIGO GENÉTICO Uma linguagem de códons e anticódons, sempre constituídos por 3 NUCLEOTÍDEOS. 64 CODONS = 4 tipos diferentes de nucleotídeos, combinação

Leia mais

Culturas Celulares (fermentação)

Culturas Celulares (fermentação) Culturas Celulares (fermentação) Carlos Sinogas 2015 / 2016 - Substrato para produção de proteínas recombinantes (humanas) - Células procarióticas (E.coli) - Células eucarióticas - Leveduras - Insectos

Leia mais



Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Influência da Genética desempenho


Leia mais

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 7ª aula teórica 11 Outubro 2010 Proteínas estruturais e funcionais Organização estrutural das proteínas Estrutura e diferentes funções de proteínas

Leia mais


EXTRAÇÃO DE DNA (3) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA EXTRAÇÃO DE DNA (3) A EXTRAÇÃO DE DNA Muitas pesquisas de Biologia Molecular começam com a extração de ácidos nucleicos. A lise celular libera as moléculas em uma fase aquosa que é separada dos restos

Leia mais

Cromatografia e suas aplicações em purificação de proteínas e peptídeos. Alexandre Rosolia Assessor Técnico - HPLC

Cromatografia e suas aplicações em purificação de proteínas e peptídeos. Alexandre Rosolia Assessor Técnico - HPLC Cromatografia e suas aplicações em purificação de proteínas e peptídeos Alexandre Rosolia Assessor Técnico - HPLC 1 - Cromatografia Líquida História e Evolução Alexandre Rosolia Assessor Técnico - HPLC

Leia mais



Leia mais

Professor Fernando Stuchi M ETABOLISMO DE C ONSTRUÇÃO

Professor Fernando Stuchi M ETABOLISMO DE C ONSTRUÇÃO M ETABOLISMO DE C ONSTRUÇÃO P ROTEÍNAS P ROPRIEDADE BÁSICA São grandes moléculas (macromoléculas) constituídas por aminoácidos, através de ligações peptídicas. É o composto orgânico mais abundante no corpo

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica INBEQMeDI Instituto Nacional de Biotecnologia Estrutural e Química Medicinal em Doenças Infecciosas Coordenadoria de Educação e Difusão de Ciências Telefone: (16) 3373-9159 Rua 9 de julho, 1205 - Centro

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

As membranas são os contornos das células, compostos por uma bicamada lipídica

As membranas são os contornos das células, compostos por uma bicamada lipídica Células e Membranas As membranas são os contornos das células, compostos por uma bicamada lipídica Organelas são compartimentos celulares limitados por membranas A membrana plasmática é por si só uma organela.

Leia mais

QIE0001 Química Inorgânica Experimental Prof. Fernando R. Xavier. Prática 09 Síntese do cloreto de pentaaminoclorocobalto(iii)

QIE0001 Química Inorgânica Experimental Prof. Fernando R. Xavier. Prática 09 Síntese do cloreto de pentaaminoclorocobalto(iii) UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS CCT DEPARTAMENTO DE QUÍMICA DQMC QIE0001 Química Inorgânica Experimental Prof. Fernando R. Xavier Prática 09 Síntese do cloreto

Leia mais

Ensaio de Proficiência

Ensaio de Proficiência Ensaio de Proficiência Cromatografia de Íons - Variações de Cátions e Ânions - Bruno César Diniz Metrohm Pensalab IC - Ânions e Cátions Conteúdo Precisão X Exatidão Qualificação de Operação

Leia mais


CORREÇÃO DE EXERCÍCIOS 1-9 CORREÇÃO DE EXERCÍCIOS 1-9 Ex 1 a) O músculo cardíaco é rico em mitocôndrias onde se localiza a citrato sintase. Essa enzima é a primeira enzima do ciclo de Krebs e é fundamental para a produção de ATP

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais