Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers :

Tamanho: px
Começar a partir da página:

Download "Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers :"

Transcrição

1 Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3 São necessários dois primers : Um complementar a um trecho da fita anti-sense» Primer sense (forward) Um complementar a um trecho da fita sense» Primer anti-sense (reverse)

2 Desenho de primers

3 Escolha dos primers para PCR: 1 Asp Pro Val Ala Val Leu Ala Val Phe Glu Glu Ile 12 1 G GAT CCA GTG GCG GTG TTG GCC GTG TTC GAG GAG ATA Gln Val Glu Glu Val Leu Tyr Ile Leu Val Phe Gly Glu CAG GTG GAG GAG GTG CTG TAT ATC CTG GTC TTC GGC GAG Ser Leu Leu Asn Asp Gly Val Thr Val Val Arg Tyr His TCC CTC CTC AAC GAT GGT GTG ACG GTG GTC CGT TAC CAT Leu Phe Glu Gly Phe Ser Glu Leu Gly Glu Asp Asn Ile CTG TTC GAG GGC TTC AGC GAG CTC GGT GAG GAC AAC ATC Lys Ala Val Asp Ile Ala Ser Xxx Val Ala Ser Phe Leu AAG GCC GTT GAC ATC GCC AGC NGG GTC GCC TCC TTC CTT Leu Val Ala Leu Gly Gly Thr Ala Ile Gly Ile Ile Trp CTC GTG GCC CTC GGC GGC ACG GCC ATC GGC ATC ATC TGG Gly Phe Leu Thr Ala Phe Ile Thr Arg Leu Thr Ser Gln GGC TTC CTC ACC GCC TTC ATC ACC AGG TTA ACG AGT CAG 271 oligonucleotídeo 1 para PCR (sense): 5' GTG GAG GAG GTG CTG TAT ATC 3' - oligonucleotídeo 2 para PCR (anti-sense): 5' GTA GGC CAT CAC GAA CAC GAA 3' - oligonucleotídeo para hibridização (anti-sense): 5' CTG ACT CGT TAA CCT GGT GAT G 3' 91 Val Pro Arg Asp Arg Ala Ile Phe Val Phe Val Met Ala GTN CCG CGT GAT CGA GCC ATC TTC GTG TTC GTG ATG GCC Tyr Leu Asn Ala Glu Met Leu Ala Ser Ser Ser Glu Thr TAC CTC AAT GCG GAG ATG CTG GCC TCG TCC TCG GAG ACC Ile Ile ATC ATC T 356

4 Critérios para desenho de primers : - Composição de bases: O conteúdo de G+C deve estar entre 40% e 60%, com distribuição mais ou menos homogênea de todas as bases ao longo do comprimento do primer. - Comprimento: A região do primer complementar à template deve ser de 18 a 28 nts. Os dois primers a serem utilizados numa reação não devem ter diferença de comprimento que exceda 3 nts. - Seqüências repetidas ou auto-complementares: Não deve haver repetições invertidas no primer ou seqüências auto-complementares com mais de 3 nts seguidos.

5 Complementaridade entre membros de um par de primers : A extremidade 3 de um primer não pode ser capaz de se ligar a qualquer ponto do outro primer. Como os primers estão presentes em alta concentração, mesmo baixa complementaridade entre eles pode levar à formação de híbridos e a conseqüente síntese e amplificação de dímeros de primers.

6 Dímeros dos primers é o produto da extensão do primer por pareamento consigo mesmo ou com o outro primer do par. Como são produtos mais curtos, são copiados mais eficientemente, podendo dominar a reação e sequestrar primers que iriam se parear com a template real. Outro fato que pode ocorrer, quando começa a se acumular produto de PCR, é o pareamento das extremidades dos produtos amplificados, formando concatâmeros. Isso aparecerá na eletroforese como smears de elevado peso molecular.

7 - Temperatura de fusão: temperatura na qual 50% das moléculas alvo já estão pareadas com os primers O Tm calculado dos dois membros do par de primers não deve diferir em mais que 5 o C (Tm depende da concentração de primers e de sais) Extremidade 3 : A natureza da extremidade 3 dos primers é crucial. Se possível, a base da extremidade 3 de cada primer deve G ou C. Mas não é recomendável que seja...nggg ou...nccc, pois pode gerar dímeros de primers. -Localização do sítio de pareamento dos primers na seqüência alvo: Algumas vezes há restrições impostas pelo tipo de informação que se quer obter ao fazer a PCR. Ao desenhar primers para cdna, o ideal é que estejam em exons diferentes. -Adição de sítios de restrição, promotores de bacteriogafos, clamp GC, e outras seqüências na extremidade 5 : Usualmente estas seqüências não alteram o pareamento do primers nas seqüências alvo.

8 A extremidade 5 não precisa ser complementar à seqüência alvo. Isso nos permite adicionar seqüências com propósitos específicos na extremidade 5 sítio para enzima de restrição, mais 3 a 4 bases adicionais promotores para transcrição in vitro promotores de seqüências consenso para inicío de tradução para transcrição e tradução in vitro etc Para o cálculo do Tm considera-se apenas a região complementar à seqüência alvo.

9 primers com sítios para enzimas de restrição:

10 Cáculo do Tm dos inciadores

11 Tm é a temperatura na qual metade das fitas moldes presentes na reação estão hibridizadas com os primers, que usualmente estão presentes em considerável excesso em relação às templates. Tm depende da concentração de primers (e templates) e da concentração de sal. Métodos para cálculo do Tm: Para primers com cerca de 20 nucleotídeos (regra de Wallace): Tm = (número de G + C) x 4 + (número de A+T) x 2 Uma fórmula mais acurada que pode ser usada para oligonucleotídeos entre 15 e 70 nucleotídeos (Bolton e McCarthy): Tm = 81,5 + 16,6[log 10 (I) + 0,41 (%G+C)-(675/N) onde I: concentração de cátions monovalentes N: comprimento em n o. de nucleotídeos Pode ser ainda usado cálculo da temperatura de annealing otimizada (Wu et al., 1991) para oligonucloetídeos com nts. Tp = ,46 [(2 x número de G+C) + (número de A+T)

12 Nearest neighbor method: Proc Natl Acad Sci U S A 1986 Jun;83(11): Breslauer KJ, Frank R, Blocker H, Marky LA Nucleic Acids Research Rychlik, Spencer and Rhoads, vol 18, num 12, pp H Tm = - 273, ,6 log [Na + ] S + R ln[primers]

13 5 3 G global do primer < 10 Kcal/mol G ~ 10K cal/mol G ~ 0,6K cal/mol G não depende da concentração de sal Favorece produtos inespecíficos 3 irá parear por último. Aumento da especificidade

14 Primer3 Free Online Primer Design Tool PCR Primer Analysis...

15 Existe uma grande variedade entre os valores calculados usando as diferentes fórmulas. Estas fórmulas constituem apenas um guia para a temperatura de annealing a ser usada na PCR. Na prática, é necessário determinar a temperatura ótima empiricamente. Pode usar: - Touch down - PCR em termociclador com gradiente

16 A distância entre os primers : Fragmentos longos são mais difíceis de ser amplificados Fragmentos de nt são adequados quando o objetivo é apenas detectar a presença do gene Quando o propósito é clonar uma região específica de um gene ou um cdna inteiro, o fragmento poderá ser maior, mas devemos usar enzimas com antividade corretiva ou mix de enzimas.

17 Primers degenerados: verificar as tabelas de uso do código pela espécie (codon usage)

18 Desenho de iniciadores degenerados: uma mistura de primers - Met Ile His Trp Cys Pro Leu ATG ATT CAT TGG TGT CCT TTT ATC CAC TGC CCC TTG ATA CCA CTT CCG CTC CTA CTG = mas não é possível usar as 6 degenerações acima - uso de inosina (por A/T/G) reduz diluição - quantidade de primer deve ser aumentada - alinhamento prévio usando Clustal ou Clustalw

19 Codon usage: disponível para grande número de espécies em

20

21 Para preparar o estoque de primer é necessário que o fabricante forneça a quantidade sintetizada. Dilua o primer liofilizado de modo que a solução estoque fique na concentração de 1 mm, por exemplo. Se não sabe a quantidade, meça a concentração por espectrofotometria (A 260 nm) c = A 260 /el e: coeficiente de extinsão (M -1 cm -1 ) l: banda de passagem do espectrofotômetro

22 Cálculo de e: A C G T Exemplo: 5 GTGAGTCCCTGAATGTAGTG 3 e = ( x 4) + (7.050 x 3) + ( x 7) + (8.400 x 6) = Dilua o estoque de modo que a leitura de A 260 esteja entre Suponhamos que a diluição tenha sido de 100, a A260 = 0.15 C = [0.15 X 100]/ X 1 = 0, M = 69 mm = 69 pmol/ml Fatores de conversão úteis: pmol para ng = (n o. de pmol x N x 325)/ N é o número de nucleotídeos ng para pmol = (ng x 1000)/ (N x 325) 325 é a massa molecular média dos nucleotídeo.

23 PCR quantitativo em tempo real

24 Sistema para quantificação do produto amplificado por PCR em tempo real ou sistema de detecção de seqüência (SDS): Isso consiste em utilizar um sistema que detecta o aumento da quantidade de fitas de DNA no tubo de reação, através da medida do aumento da emissão fluorescente, à medida que a reação está ocorrendo. Os níveis de fluorescência emitida pela amostra excitada por um laser ou por uma lâmpada de halogênio associada a um filtro específico, é detectada a cada ciclo e enviada para uma unidade processadora.

25 O ciclador térmico utilizado para quantificação em tempo real está equipado com cabos de fibra óptica que direciona a luz do laser para cada uma das poças do bloco onde são colocadas as amostras

26 O sistema coleta a emissão fluorescente entre 500 e 600 nm em cada uma das 96 poças com amostras, a cada 3 a 10 s. Os cabos levam a emissão fluorescente de volta à câmara CCD

27 Para detecção do produto de PCR em cada ciclo é preciso marcar o DNA amplificado com algum tipo de molécula fluorescente. Existem vários tipos de moléculas fluorescentes utilizadas para esse fim. Dois sistemas têm sido mais comumente utilizados: - SYBR Green - TaqMan

28 Sistema SYBR Green: O corante se liga a duplas fitas de DNA. Se há aumento do número de fitas duplas, há aumento proporcional da intensidade de fluorescência.

29 Fluorescence Ressonance Energy Transfer - FRET Sistema TaqMan Sistema TaqMan emprega uma sonda, que é um oligonucleotídeo específico que é complementar a uma parte interna do segmento a ser amplificado. Este oligonucleotídeo é marcado com uma molécula fluorescente em sua extremidade 5, esta molécula é denominada reporter ; na extremidade 3, é adicionada outra molécula que pode ou não ser fluorescente (de comprimento de onda diferente), cuja função é denominada quencher. Enquanto a sonda está livre em solução o quencher absorve a fluorescência do reporter, não sendo detectada fluorescência.

30 Reporter Quencher Substâncias fluorescentes usadas: ATCACC...CATCG 5 3 reporter quencher A atividade de exonuclease 5 3 da Taq DNA polimerase é utilizada para separar reporter e quencher durante a síntese de cada nova molécula de DNA.

31 Holland et al. 1991: descreveu pela primeira vez a atividade síntese de DNA associada a atividade exonucleásica 5 -> 3 da Taq DNA pol.; atividade essa que se seguia ao aparecimento de uma estrutura em forquilha, criada pela fita template e pela fita a ser removida pela atividade exonucleolítica da enzima. Lee : explorou a essa característica da enzima para criar sistema TaqMan reporter quencher reporter quando liberado pela enzima, fluoresce livremente FAM TET

32 Taq DNA Pol Cada vez que é sintetisada uma nova fita há aumento da intensidade da emissão fluorescente

33 Representação de um plot da amplificação em tempo real O plot da amplificação mostra 4 fases distintas: linha basal: não houve acúmulo de fitas duplas o suficiente para que a fluorescência emitida possa ser detectada. fase log: a quantidade de amplicon dobra a cada ciclo fase linear: há pequeno aumento, amplificação linear, da quantidade de amplicon fase platô: não há mais aumento no número de amplicons

34 sensibilidade (dynamic range): < 10 1 a > Esta maneira de quantificar o produto de PCR criou um novo paradigma para quantificação por PCR: É avaliado o momento de aparecimento do sinal e não quanto sinal é gerado após um dado número de ciclos Ciclo threshold Ct: A fluorescência ultrapassa um nível avaliado como background valor correspondente a cerca de 10 vezes o desvio padrão do background. Pode-se estabelecer um nível (Crossing Point CP) em qualquer ponto da fase 2.

35 A diluição serial (diluição em série de 10 x) de uma amostra seguida de amplificação das moléculas originais por PCR deve resultar numa curva com gradiente próximo de 3,3, isso indica que a amplificação é de duas vezes a cada ciclo (Y = 1). Caso o slope seja maior em módulo que 3,3 significa que a eficiência de amplificação é menor que 1.

36 Nesta curva padrão (diluições seriadas), as 3 últimas diluições parecem ter a mesma quantidade. Exemplo típico de contaminação com DNA genômico.

37 Sistema SYBR Green: O corante detecta todo tipo de dupla fita presente na amostra. Caso haja amplificação de produtos inespecíficos ou amplificação de dímeros de primers, a fluorescência emitida por estas moléculas será indistinguível da fluorescência emitida pelo produto amplificado específico que se desejava amplificar. Cada curva é o registro do que ocorreu em um tubo ao longo dos diversos ciclos de PCR

38 Após o término dos ciclos de amplificação, se utilizamos SYBR Green, podemos avaliar quantos tipos de diferentes fragmentos foram amplificados, porque diferentes fragmentos têm melting points diferentes: Quando as fitas se separam, o SYBR Green não mais se liga àquelas moléculas, e deixa de emitir fluorescência. A fluorecência cai abruptamente.

39 SYBR Green É possível derivar a quantidade de fluorescência em função da temperatura e expressar o resultado como na curva abaixo. Neste caso, um único produto amplificado.

40 SYBR Green Exemplo de dois diferentes produtos amplificados em tubos distintos.

41 SYBR Green Identificação de tipos de HPV por avaliação do Tm dos produtos amplificados com o mesmo par de primers.

42 Para otimização, procure obter a condição com:. maior variação de fluorescência por ciclo ( R ou Rn). menor Ct Sintetize vários pares de primers e teste-os com SYBR Green. Analise R, Ct e curvas melting. Primers: Tm 10 o C abaixo do Tm da sonda (60 a 65 o C) Sonda: Não pode ter G na extremidade 5 junto ao fluoróforo repórter Tm 70 o C a 75 o C Localize a sonda a 2 ou 3 bases de um dos primers

43 Como calcular o número de moléculas-template presentes no início da reação (N o ) a partir do Ct? N f = N o (1+Y) n Ct = n = número de ciclos

44 Ct é um termo exponencial! Não é linear.

45 A conversão para uma forma linear é através do termo: N f = N o (1+Y) Ct 2 -Ct Nf = número de moléculas quando a fluorescência atinge o nível limiar definido pelo pesquisador. Tem que ser um ponto escolhido dentro da fase de amplificação exponencial e é o mesmo para todas as amostras analisadas num mesmo experimento. Y = 1 (se a eficiência de amplificação for 100%) N f /N o = 2 Ct N o /N f = 2 -Ct N o 2 -Ct

46 PCR em tempo real será quase sempre comparativo. Duas moléculas alvo são amplificadas, simultaneamente em um mesmo tubo, ou em duas reações distintas: Gene de interesse (x) Controle interno Referência (r) (outro gene, ou o mesmo gene clonado e mutado para servir de controle) Analisemos esta questão formalmente: Para o Gene de interesse - x N f,x = N o,x (1 + Y x ) Ct,x Para o controle interno - r N f,r = N o,r (1 + Y r ) Ct,r Se Y x = Y r = 1, podemos escrever: N o,x = N f,x. 2 -Ct,x (1) N o,r = N f,r. 2 -Ct,r (2) Dividindo (1) por (2)

47 N o,x = N f,x. 2 -Ct,x N o,r = N f,r. 2 -Ct,r Definindo: N o,x /N o,r = X N quantidade normalizada de moléculas do gene de interesse em relação ao número de moléculas controle no tempo zero N f,x /N f,r = K relação constante e próxima de 1, visto que o número de moléculas amplificadas quando ambos atingem o limiar deve ser o mesmo. Temos que X N = K. 2 - Ct

48 Em nossos experimentos o valor de X N (número normalizado de nossas moléculas alvo no início da reação de PCR) será medido em diferentes condições experimentais: por exemplo condição A e condição B: Assim teremos: X N,A K. 2 - Ct,A = = 2 - Ct X N,B K. 2 - Ct,B

49 Exemplo de comparação da quantidade de moléculas de mrna/c-myc normalizada pela quantidade de molécula de mrna/gapdh em cérebro e rins. A comparação foi: cérebro/cérebro rim/cérebro Livak KJ AND Schmittgen TD 2001 Methods 25:

50 Quantificação relativa de mrna por PCR convencional

51 Quantificação relativa mrna Comparação de amostras A e B A quantidade de um mrna específico em cada uma das amostras A e B é normalizada por meio da comparação com a quantidade de uma molécula tomada como controle interno, esta com expressão constante nas condições A e B. Controles internos mais utilizados: b-actina; b2-microglobulina, GAPDH; fosfogliceratocinase 1; hipoxantina ribosiltransferase (HPRT1); RNA ribossomal Estes mesmos controles internos são utilizados para PCR em tempo real

52 Para quantificação, o que mais comumente é feito quando não se dispõe de PCR em tempo real: Transcrição reversa com oligo-dt ou randon primers, a partir de 5 mg de RNA total de cada uma das amostras correspondentes às situações A e B Diluição do cdna (1:10 a 1:100) - 1 ml para PCR PCR com primers específicos para o gene alvo e para um gene utilizado como controle interno. Faz-se PCR com números variáveis de ciclos, de modo a determinar o menor número de ciclos necessários para visualização da banda amplificada sem alcançar o platô. A amplificação de ambos os genes deve estar na fase exponencial de amplificação, para que possamos fazer a comparação entre eles.

53 A quantidade final de produto só tem relação conhecida com a quantidade inicial de moléculas alvo se o platô ainda não foi atingido Cinética da PCR N f = N o (1 + Y) n

54 Considerações sobre controles internos para PCR semiquantitativo

55 O RNA nativo a ser usado como controle interno: Não deve ter sua expressão modificada pela manobra experimental e condição especial que está sendo analisada. Os níveis de expressão do controle interno e do gene analisado devem ser similares. A amplificação de uma molécula muito abundante pode prejudicar, por competição, a amplificação da molécula pouco abundante (isso, para multiplex PCR) Para genes muito expressos: GAPDH e b-actina (ambos muito abundantes) Para genes de média e baixa expressão: hipoxantina ribosiltransferase (HPRT1) que é um gene housekeeping com poucas cópias de mrna Para estudos com estimulação com soro: b2-microglobulina ou 18S Neste caso, b-actina e GAPDH não são recomendáveis

56 Exemplo de análise temporal do nível de expressão gênica após um dado tratamento No caso da avaliação do efeito de um dado tratamento, o controle interno não deve sofrer variação com o tratamento. No exemplo acima, b-2 microgobulina poderia ser usada como controle interno, mas não o GAPDH.

57 Gene de interesse: Interleucina Ib Controle interno: 18S

58 Para análise quantitativa a integridade do RNA é fundamental. Com a degradação parcial do RNA há alteração da relação entre a quantidade de um RNA específico e a quantidade de RNA total. As moléculas de RNA não se degradam de forma homogênea.

59 A reprodutibilidade dos experimentos de quantificação relativa cai muito quando o número de cópias da molécula alvo é muito baixo. Efeito de amostragem estocástica ( stochastic sample effect )

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Material e Métodos Resultados e Discussão

Material e Métodos Resultados e Discussão Área: Melhoramento Genético Vegetal TRANSFERIBILIDADE DE PRIMERS MICROSSATÉLITES DE Phaseolus vulgaris PARA Vigna unguiculata Matheus Felipe Nogueira da Silva 1, Leidiane Bezerra Albuquerque 2, Rafaela

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006

ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006 ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006 PREÂMBULO Termo de Participação, via meio eletrônico, para a seleção da melhor proposta para aquisição por dispensa de licitação, nos termos do Decreto Estadual

Leia mais

PAULO CESAR NAOUM AC&T- 2013

PAULO CESAR NAOUM AC&T- 2013 PAULO CESAR NAOUM AC&T- 2013 HEMOGLOBINAS NORMAIS MOLÉCULA DA HEMOGLOBINA HUMANA NORMAL Hb A AS HEMOGLOBINAS HUMANAS SÀO COMPOSTAS POR QUATRO CADEIAS DE AMINOÁCIDOS CONHECIDAS POR GLOBINAS E INSERIDO EM

Leia mais

Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática

Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática Explorando bancos de dados genômicos e introdução à bioinformática Guilherme Targino Valente Marcos Tadeu Geraldo 22/07/2011 Bioinformática É a aplicação de estatística e ciência da computação no campo

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Curso: Marcadores Moleculares aplicados a organismos de interesse epidemiológico

Curso: Marcadores Moleculares aplicados a organismos de interesse epidemiológico Curso: Marcadores Moleculares aplicados a organismos de interesse epidemiológico SUCEN Superintendência de Controle de Endemias São Paulo 17 a 22 de agosto de 2009 Aula : PCR EM TEMPO REAL José Eduardo

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

PCR em Tempo Real PCR Quantitativa (qpcr)

PCR em Tempo Real PCR Quantitativa (qpcr) UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL INSTITUTO DE CIÊNCIAS BÁSICAS DA SAÚDE LABORATÓRIO DE VIROLOGIA PCR em Tempo Real PCR Quantitativa (qpcr) DOUTORANDA: TIANE MARTIN DE MOURA PPG MICROBIOLOGIA AGRÍCOLA

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

(11) (21) PI 0414073-7 A

(11) (21) PI 0414073-7 A (11) (21) PI 0414073-7 A (22) Data de Depósito: 31/08/2004 (43) Data de Publicação: 24/10/2006 República Federativa do Brasil (RPI 1868) Ministério do Desenvolvimento, Indústria e do Comércio Exterior

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

X JORNADA FARMACÊUTICA E V AMOSTRA DESENVOLVIMENTO DE METODOLOGIAS EM PCR EM TEMPO REAL: OTIMIZANDO CUSTOS E PRODUTIVIDADE

X JORNADA FARMACÊUTICA E V AMOSTRA DESENVOLVIMENTO DE METODOLOGIAS EM PCR EM TEMPO REAL: OTIMIZANDO CUSTOS E PRODUTIVIDADE X JORNADA FARMACÊUTICA E V AMOSTRA DESENVOLVIMENTO DE METODOLOGIAS EM PCR EM TEMPO REAL: OTIMIZANDO CUSTOS E PRODUTIVIDADE Sueli Massumi Nakatani Laboratório Central do Estado LACEN-PR Maio de 2010 Laboratório

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Toxigenomics: Principles and aplication. Dr. André D. Luchessi andre.luchessi@outlook.com

Toxigenomics: Principles and aplication. Dr. André D. Luchessi andre.luchessi@outlook.com Toxigenomics: Principles and aplication Dr. André D. Luchessi andre.luchessi@outlook.com NATAL DACT - PPgCF PROGRAMA DO CURSO TOXIGENÔMICA DEFINIÇÃO Em termos gerais toxigenômica são os estudos que envolvem

Leia mais

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 Gonçalves MG 1, Fukasawa LO 1, Alencar WK 2, Caterino-de-Araujo A 1 1 Instituto

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado

Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado Vivian E. Nascimento 1, Édila V.R. V. Pinho 1, Renzo G.V. Pinho 1, Bruno C. dos Santos 1, Elise de M. Pereira

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

BIOLOGIA Prof. André Fozzy

BIOLOGIA Prof. André Fozzy BIOLOI Prof. ndré Fozzy RN E SÍNTESE PROTEIC Biologia Prof. ndré Fozzy Regiões Codificadoras e Não-Codificadoras do DN O DN é formado por 2 regiões: Intergênicas ênicas Intergênicas ênicas Região ênica

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR:

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR: RTSD01-II Fator II G20210A Q PCR Alert Kit Rev. 04 Out/2013 Instruções de Uso USO PRETENDIDO O produto FATOR II Q-PCR Alert é um kit para teste de amplificação quantitativa de ácidos nucleicos para a determinação

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Virologia em Laboratório Fase Pré- Analítica

Virologia em Laboratório Fase Pré- Analítica Virologia em Laboratório Fase Pré- Analítica Leonor Rebelo Lab Virologia i do IPOFGL EPE Novembro 2012 1º Curso de Virologia Molecular em Oncologia 1 ,, TÑÜxÇwxÜ t ØÇ vt vé át wx Öâx t ÅxÇàx ÇâÇvt áx vtçát?

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

UFABC Bacharelado em Ciência & Tecnologia

UFABC Bacharelado em Ciência & Tecnologia UFABC Bacharelado em Ciência & Tecnologia Transformações Bioquímicas (BC0308) Prof Luciano Puzer http://professor.ufabc.edu.br/~luciano.puzer/ Propriedades, funções e transformações de aminoácidos e proteínas

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

Produção de Proteínas Recombinantes em Escherichia coli

Produção de Proteínas Recombinantes em Escherichia coli Produção de Proteínas Recombinantes em Escherichia coli Prof. Dr. Catarina Akiko Miyamoto 1 Resumo A produção de proteínas recombinantes para fins terapêuticos, veterinários, e agro-pecuários tem se mostrado

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Alexandre Havt. Estrutura dos Ácidos Nucléicos. DNA e RNA Replicação Transcrição Tradução Introdução à Biologia Molecular

Alexandre Havt. Estrutura dos Ácidos Nucléicos. DNA e RNA Replicação Transcrição Tradução Introdução à Biologia Molecular Estrutura dos Ácidos Nucléicos DN e RN Replicação Transcrição Tradução Introdução à Biologia Molecular lexandre Havt Moléculas com informações para a síntese de proteínas DN armazém ou biblioteca celular

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Genética e Câncer. Viviane Ferreira Esteves

Genética e Câncer. Viviane Ferreira Esteves Genética e Câncer Viviane Ferreira Esteves Fatores de risco Fatores internos Predisposição hereditária Fatores externos Ambientais Predisposição Genética para o Câncer Tipo de câncer Mama Cólon Leucemias

Leia mais

Secretaria de Estado da Saúde Coordenadoria de Controle de Doenças Instituto Adolfo Lutz. Priscilla Lima de Oliveira

Secretaria de Estado da Saúde Coordenadoria de Controle de Doenças Instituto Adolfo Lutz. Priscilla Lima de Oliveira Secretaria de Estado da Saúde Coordenadoria de Controle de Doenças Instituto Adolfo Lutz Priscilla Lima de Oliveira USO DA PCR EM TEMPO REAL PARA DETERMINAR A FREQUÊNCIA DOS PRINCIPAIS AGENTES CAUSADORES

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA

Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA PCR - consiste em fazer cópias de DNA in vitro, usando os elementos básicos do processo de replicação natural

Leia mais

Transformando a medicina com abordagem sistemá2ca de dados gené2cos. Mauricio Carneiro Broad Ins2tute of MIT and Harvard

Transformando a medicina com abordagem sistemá2ca de dados gené2cos. Mauricio Carneiro Broad Ins2tute of MIT and Harvard Transformando a medicina com abordagem sistemá2ca de dados gené2cos Mauricio Carneiro Broad Ins2tute of MIT and Harvard Sequenciadores no mercado Illumina HiSeq 2500 Padrão do mercado, maior volume de

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

ELISANGELA OLIVEIRA DA SILVA

ELISANGELA OLIVEIRA DA SILVA ELISANGELA OLIVEIRA DA SILVA Desenvolvimento de curvas-padrão com aplicabilidade na análise de expressão do RNA mensageiro de genes da superfamília dos receptores nucleares Dissertação apresentada ao Curso

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

BioDrop DUO Nota de Aplicação para dsdna

BioDrop DUO Nota de Aplicação para dsdna BioDrop DUO Nota de Aplicação para dsdna Utilizando o espectrofotômetro BioDrop DUO para quantificar dsdna em amostras de microvolumes A quantificação de DNA em microvolumes é uma aplicação de rotina em

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais