Código Genético. Bianca Zingales

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Código Genético. Bianca Zingales"

Transcrição

1 Código Genético Bianca Zingales

2 Um gene - uma enzima Beadle & Tatum ( ) Experimentos de genética com o fungo Neurospora. Mutações induzidas com raios X. Mutações em um único gene afetavam uma única enzima do fungo. Beadle e Tatum propuseram a hipótese um gene uma enzima. Ganharam o prêmio Nobel em 1958.

3 O dogma central da Biologia Molecular Replicação Transcrição O DNA contém a informação genética Tradução As proteínas são a expressão da informação genética

4 Descoberta do código genético Pergunta: Como a informação genética contida no DNA (gene) dita a sequência da proteína (aminoácidos)? DNA = 4 letras (A,T, C, G) Proteínas = ~20 aminoácidos Como um código de 4 letras é traduzido numa informação de 20 letras?

5 George Gamow George Gamov foi um físico nascido na Ucrânia. Gamow tornou-se cidadão estadunidense em 1940 Tentativas:

6 Código genético O código genético é uma linguagem baseada em 4 "letras. As 4 bases dos nucleotídeos formam "palavras" de 3 letras = códons Os códons, dependendo da maneira como são agrupados, formam "sentenças" = proteínas. Um códon é uma sequência de 3 nucleotídios que corresponde a um aminoácido. Um gene inclui uma série de códons que são lidos sequencialmente a partir de um ponto de iniciação. A leitura termina num ponto específico.

7 Decifrando o código genético Nirenberg e Matthaei (1961) Hipótese: Um códon codifica Um aminoácido

8 Experimentos de Nirenberg & Matthaei Sistema de síntese protéica in vitro (ribossomos,trnas, enzimas, 20 aminoácidos) RNAs sintéticos (poli U; poli A; poli C) Análise da sequência de aminoácidos nos peptídios sintetizados in vitro. Conclusão: UUU Phe AAA Lys CCC - Pro

9 Decifrando o código genético RNAs sintetizados com diferentes proporções de nucleotídios. Ex: 76% de U e 24% G. Trincas possíveis UUU; UUG; UGU; GUU; UGG; GUG; GGU; GGG 44% 14% 4% 1% Proteína Phe; Leu; Cys; Val; Trp; Gly

10 Decifrando o código genético Nirenberg & Khorana - Prêmio Nobel em 1968 Incubação: Trincas específicas de RNA (códons), trnas ligados a aminoácidos e ribossomos. Um dos aminoácidos marcados com C 14 Apenas o complexo Trinca-tRNA-AAribossomos ligava-se ao filtro.

11 O código genético (1966) CÓDIGO GENÉTICO códons do mrna UUU Phe UCU Ser UAU Tyr UGU Cys UUC Phe UCC Ser UAC Tyr UGC Cys UUA Leu UCA Ser UAA STOP UGA STOP UUG Leu UCG Ser UAG STOP UGG Trp CUU Leu CCU Pro CAU His CGU Arg CUC Leu CCC Pro CAC His CGC Arg CUA Leu CCA Pro CAA Gln CGA Arg CUG Leu CCG Pro CAG Gln CGG Arg AUU Ile ACU Thr AAU Asn AGU Ser AUC Ile ACC Thr AAC Asn AGC Ser AUA Ile ACA Thr AAA Lys AGA Arg AUG Met ACG Thr AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GUC Val GCC Ala GAC Asp GGC Gly GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly Os códons são lidos no sentido 5-3

12 O código genético (1966) Outra apresentação

13 Características do código genético

14 Características do Código 1. O código é universal: Todos os organismos utilizam o mesmo código (exceção: mitocôndrias) 2. O código é degenerado: O mesmo aminoácido é codificado por mais de um códon Exceto: Metionina e Triptofano 3. Não-ambiguidade do código: cada códon corresponde a somente um aminoácido

15 Características do Código 4. O Código genético tem 64 códons: 61 códons para aminoácidos 3 códons de parada ou terminação: UAA, UGA, UAG 5. As trincas são lidas sem pontuação

16 Características do Código 6. Códon de iniciação: AUG = metionina. Em grande parte das proteínas a cadeia polipeptídica inicia com a metionina que é o aminoácido N-terminal.

17 Mutações de Ponto Mutações de ponto: alteração de uma das bases de um códon. (Nota: a mutação ocorre no gene e se reflete na sequência do RNA) Tipos: Substituições: troca de um único nucleotídeo. Inserções: adição de um ou mais nucleotídeos na sequência do DNA. Deleções: remoção de um ou mais nucleotídeos da sequência do DNA.

18 Mutação de Ponto por substituição Mutação silenciosa O códon alterado codifica o mesmo aminoácido. Mutação em "missense" O códon alterado codifica um aminoácido diferente. Mutação em "nonsense" O códon alterado sinaliza o término da síntese protéica.

19 Efeito de Mutações de Ponto na Síntese Protéica Mutações de ponto: alteração de uma das bases de um códon NO GENE. Mutação silenciosa O códon alterado codifica o mesmo aminoácido. (lembrar que o código é degenerado) Original DNA GCT TGT TTA CGA ATT A Mutação 1 DNA GCC TGT TTA CGA ATT A C Função da proteína não alterada

20 Efeito de Mutações de Ponto na Síntese Protéica Mutação em "missense" O códon alterado codifica um aminoácido diferente. Original DNA GCT TGT TTA CGA ATT A Mutação 2 DNA ACT TGT TTA CGA ATT A A Thr A proteína pode perder sua função, dependendo da função do aminoácido trocado. (Ex. troca de um aa com carga +, por outro também com carga +; troca de um aa polar sem carga, por outro apolar)

21 Na anemia falciforme houve uma mutação de ponto que causou a substituição do ácido glutâmico por valina. A hemoglobina destes indivíduos tem propriedades diferentes da Hb normal. As hemácias ficam em formato de foice, são mais frágeis e se quebram facilmente - Anemia falciforme

22 Efeito de Mutações de Ponto na Síntese Protéica Mutação em "nonsense" O códon alterado sinaliza o término da síntese protéica. Original DNA GCT TGT TTA CGA ATT A Mutação 3 DNA GCT TGA TTA CGA ATT A A Stop A tradução do mrna é interrompida. A proteína será truncada e certamente perderá sua função.

23 Efeito de Mutações de Ponto na Síntese Protéica Mutação por inserção inserção de uma base. Muda todo o passo de leitura do mrna Original DNA GCT TGT TTA CGA ATT AC Mutação 4 DNA GCT TGT CTT ACG AAT TAC CUU ACG AAU UAC. Leu Thr Asn Tyr Polypeptide Proteína diferente. Certamente perde sua função.

24 Efeito de Mutações de Ponto na Síntese Protéica Mutação por deleção perda de uma base. Muda todo o passo de leitura Original DNA GCT TGT TTA CGA ATT AC Mutação 5 DNA GCT TGT TAC GAA TTA C Exercício: Escrever a sequência do mrna e da proteína Proteína diferente. Certamente perde sua função.

25 Síntese de Proteínas (Tradução)

26 O dogma central da Biologia Molecular Gene - Sequência de nucleotídios 4 Bases (A, T, C, G) Transcrição Tradução RNA - Sequência de nucleotídios 4 Bases (A, U, C, G) Proteína - Sequência de 20 aminoácidos

27 SÍNTESE de PROTEÍNAS É o resultado do processo de tradução da informação contida no material genético da célula. As proteínas são, portanto, a expressão da informação genética. É um dos processos bioquímicos mais complexos. Cerca de 300 macromoléculas atuam de forma coordenada. É o processo que mais gasta energia na célula.

28 Componentes Necessários para a Tradução Os Aminoácidos Os RNAs de Transferência O RNA Mensageiro Os Ribossomos Fatores Protéicos Fontes de Energia (ATP e GTP)

29 RNA de Transferência ou RNA Transportador - RNA de fita simples de ~75 nucleotídios Braço aceptor- Extremidade 3 - CCA Braço T C - Estrutura em forma de Trevo - 4 braços: Braço D Dihidrouridina (D), Braço T C - Timina (T), Pseudouridina ( ) Braço do anticódon Braço aceptor do aminoácido Braço D Alça variável - Aminoácido liga-se à extremidade 3 (sempre terminada em CCA) C Braço do anticódon

30 Pareamento CÓDON ANTICÓDON trna mrna GGC CCG anticódon 5 3 códon A sequência de bases do anticódon do trna é complementar e antiparalela ao códon do mrna

31 Os Ribossomos São estruturas formadas por uma associação entre proteínas (35%) e RNA (65%) (RNA Ribossômico - rrna). Nos eucariotos, estão localizados no citossol na forma livre ou associados ao retículo endoplasmático. São formados por 2 subunidades, O ribossomo de: Procariotos é formado por uma subunidade 50S e outra 30S; O conjunto das duas subunidades forma o ribossomo 70S Eucariotos é formado por uma subunidade 60S e outra 40S O conjunto das duas subunidades forma o ribossomo 80S

32 ETAPAS DA SÍNTESE PROTÉICA

33 Etapas da síntese de proteínas 1. Ativação do aminoácido (no citossol) 2. Iniciação (no ribossomo) 3. Alongamento (no ribossomo) 4. Terminação (no ribossomo)

34 1. Ativação dos Aminoácidos https://www.youtube.com/watch?v=w1eqnmtcckw Ligação do aminoácido a seu(s) trna(s) específico(s). Ocorre no Citossol. A ligação é catalisada pelas aminoacil-trna sintetases, enzimas que reconhecem os aminoácidos e seus trnas A reação é dependente de energia (ATP). AA 1 + trna 1 + ATP PP Pirofosfatase AA 1 -trna 1 + AMP + PP 2Pi GASTO DE DUAS LIGAÇÕES RICAS EM ENERGIA

35 Aminoacil-tRNA Aminoácido Reação com elevada especificidade!!!!!!!!!!!!!

36

37 2. Iniciação

38 2. Iniciação Complexo de iniciação Codon iniciador: AUG; Aminoácido: Metionina 50S 30S Complexo de iniciação 70S Na etapa de iniciação gasta-se mais uma ligação rica em energia

39 No ribossomo observam-se duas regiões, denominadas sítios P e A mrna 50S 30S sítio P sítio A AUG CAU GGG Os sítio P" e A" cobrem dois códons vizinhos Na tradução, o sítio "A" - de aminoacil - é ocupado pelo aminoacil-trna O sítio "P" - de peptidil - é ocupado pelo peptidil-trna, ligado à cadeia peptídica que está sendo sintetizada Na etapa de iniciação o met-trna ligase ao sítio P.

40 3. Alongamento da cadeia da proteína

41 3. Alongamento da cadeia da proteína Depende dos "fatores de alongamento" e do complexo de iniciação. A cadeia protéica cresce da extremidade N-terminal (Met) para a C- terminal. O mrna é lido no sentido 5 para 3. A ligação peptídica é catalisada pela Peptidil transferase Há gasto de energia sob forma de hidrólise do GTP. Um GTP para cada Aminoácido incorporado na proteína.

42 Entra o segundo aminoácido ligado a seu trna. Vai ocupar o sítio A sítio P sítio A

43 sítio P sítio A

44 FORMAÇÃO DA PRIMEIRA LIGAÇÃO PEPTÍDICA A ligação peptídica é catalisada por uma molécula de RNA, componente da subunidade 50S, que tem atividade de peptidil transferase sítio P sítio A Notem que a Met ligou-se à Histidina carregada pelo trna2. Notem que o primeiro trna ficou descarregado no sítio P

45 O trna livre sai do complexo e o ribossomo move-se um códon, às custas da hidrólise do GTP. Fica posicionado o terceiro códon no sítio A. sítio P sítio A Nestas etapas participam fatores de alongamento

46 Repete-se o processo de formação da ligação peptídica, o desligamento do trna livre e movimento do ribossomo N-terminal Gasto de uma ligação rica em energia para cada aminoácido incorporado na proteína.

47 4. Terminação da cadeia da proteína O surgimento de um códon de terminação - UAG, UGA ou UAA - determina a ligação de um "Fator de terminação", associado a GTP. Este fator determina o rompimento da ligação entre o último AA e seu trna e a hidrólise do GTP sítio P sítio A Fator de terminação

48 A ligação do fator de terminação no códon específico faz com que a proteína recém-sintetizada se desligue do ribossomo. Em seguida o ribossomo se desliga do mrna e as subunidades se separam sítio P sítio A Gasto de uma ligação rica em energia para liberação da proteína

49 Animações Do RNA à Síntese Proteica Ao Síntese proteica ure=related

50 Em Eucariotos o processo é análogo, mas bem mais complicado... https://www.youtube.com/watch?v=cpwm_i9if0c

51 ANITBIÓTICOS Substância produzida por um organismo ou obtida sinteticamente que, em soluções diluídas, destrói as bactérias e outros microrganismos ou inibe o seu desenvolvimento. ANTIBIÓTICOS

52 Antibióticos que atuam na síntese protéica bacteriana Composto Antibiótico Células-alvo Efeito Estreptomicina Tetraciclina Cloranfenicol Eritromicina Puromicina Cicloheximida Procariótica Procariótica Procariótica Procariótica Procariótica e Eucariótica Eucariótica - Inibe a iniciação - Provoca erro na leitura do RNAm - Inibe a ligação do aminoacil- RNAt ao sítio A do ribossoma - Inibe a actividade da peptidil transferase - Liga-se à subunidade 50S do ribossoma e inibe a translocação - Provoca a terminação prematura da cadeia, actuando como um análogo do aminoacil- RNAt - Inibe a actividade da peptidil transferase

53 Curiosidade: Penicilinas Inibem a Síntese de Parede Celular - Impedem a síntese completa da Peptideoglicana - Atuam em bactérias em crescimento

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir)

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Pergunta 1 Abaixo estão apresentadas as estruturas de três aminoácidos. Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Usando os espaços em branco abaixo, classifique os três na ordem da hidrofobicidade

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

TRADUÇÃO SÍNTESE PROTEICA

TRADUÇÃO SÍNTESE PROTEICA TRADUÇÃO SÍNTESE PROTEICA Formação do Aminoacil-tRNA Durante a formação do aminoacil-trna, o aminoácido é primeiramente ativado, reagindo com o ATP. Após, é transferido do aminoacil-amp para a extremidade

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

EXERCÍCIOS DE VESTIBULAR

EXERCÍCIOS DE VESTIBULAR EXERCÍCIOS DE VESTIBULAR PRÉ-VESTIBULAR BIOLOGIA PROF. MARCONI 1º Bimestre 01. (Ufal 2006) Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam ambos

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Professora Priscila F Binatto

Professora Priscila F Binatto Professora Priscila F Binatto Característica 5 3 AUTODUPLICAÇÃO (Replicação) Ocorre em presença da enzima DNA polimerase Molécula DNA As pontes de hidrogênio se rompem H Nucleotídeos LIVRES encaixam se

Leia mais

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D.

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D. EVOLUÇÃO EVIDÊNCIAS DO PROCESSO EVOLUTIVO Prof. Nelson Jorge da Silva Jr. Ph.D. Professor Titular PREMISSAS BÁSICAS DA EVOLUÇÃO 1. As espécies mudam no sentido da descendência com modificação. 2. Todos

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES 1 3AMIپ0 9CIDS PLASMپ0 9TICS LIVRES پ0 9CIDS AMIADS PLASMپ0 9TICS LIVRES CBPM 4.03.01.29-0 AMB 28.13.043-0 CBPM 4.03.01.67-2 AMB 28.04.099-6/92 Sinon ھmia: پ0 9cido asp rtico, پ0 9cido glutپ0 9mico, Alanina,

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Aula 8 Síntese de proteínas

Aula 8 Síntese de proteínas Aula 8 Síntese de proteínas As proteínas que podem ser enzimas, hormônios, pigmentos, anticorpos, realizam atividades específicas no metabolismo dos seres vivos. São produzidas sob o comando do DNA. Observe

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V BIOLOGIA 01 Não é somente o sabor agradável ao paladar que faz dos cogumelos comestíveis um dos alimentos mais cobiçados pelos asiáticos e europeus. Esses cogumelos são ricos em proteínas, sais minerais,

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo.

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo. BIOLOGIA 01. Considere o enunciado abaixo e as três propostas para completá-lo. Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactérias, observou que elas eram incapazes de crescer

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS Estrutura de um bacteriófago Proteína cabeça DNA cauda Proteínas cromossomo bacteriano Fago DNA Como pode cair no enem (MACKENZIE) O ser humano tem travado batalhas constantes

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

objetivos Fluxo da informação genética tradução III AULA

objetivos Fluxo da informação genética tradução III AULA Fluxo da informação genética tradução III AULA 28 objetivos Nesta aula, você terá a oportunidade de: Descrever cada uma das etapas da tradução: iniciação, alongamento e terminação. Relatar alguns mecanismos

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente:

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: 1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: a) tradução, transcrição, duplicação b) duplicação, transcrição, tradução c) duplicação, tradução, transcrição d) tradução, duplicação,

Leia mais

Introdução à Teoria da Informação

Introdução à Teoria da Informação Introdução à Teoria da Informação Probabilidade e Estatística I Antonio Roque Aula 8 O conceito de quantidade de informação associada a um evento foi introduzido pelo engenheiro norte-americano Claude

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Aminoácidos peptídeos e proteínas

Aminoácidos peptídeos e proteínas Pontifícia Universidade Católica de Goiás Departamento de Biologia Aminoácidos peptídeos e proteínas Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Algumas funções de proteínas A luz produzida

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas A Síntese de Proteínas O RNA e a Síntese de Proteínas O papel do RNAt e das sintetases do aminoacil-rnat O emparelhamento códon-anticódon O papel do RNAm e dos ribossomos Etapas da Síntese de Proteínas

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS anticódon códon Como pode cair no enem (ENEM) Define-se genoma como o conjunto de todo o material genético de uma espécie, que, na

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir. EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações

Leia mais

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA Gabarito Exercícios Ácidos Nucléicos EXERCÍCIO EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA 1) O mofamento de grãos durante a estocagem causa perdas nutricionais e de valor de mercado, além de

Leia mais

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: O Código Genético Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE

ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE - 2016 Nome: Nº 3ª Série Data: 04/ 10/ 2016 Professor(a): Danilo, Davis e Glauco Nota: (Valor 1,0) APRESENTAÇÃO: A estrutura da recuperação bimestral paralela

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 7ª aula teórica 11 Outubro 2010 Proteínas estruturais e funcionais Organização estrutural das proteínas Estrutura e diferentes funções de proteínas

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Tradução Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais