Prof. João Carlos Setubal

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Prof. João Carlos Setubal"


1 Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução

2 Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre no ribosomo Proteína

3 Ribossomos Nucleoide (DNA compactado) Pili Flagelo Célula procariótica (bactérias): Envelope celular (membrana) Não tem organelas (núcleo, mitocondrias, etc) Material genético compactado no nucleóide (não compartimentalizado) Cromossomo único, circular fechado (na maioria das bactérias, ex: Escherichia coli)

4 Ribossomos Célula eucariótica: Organelas (núcleo, mitocondrias, cloroplastos, etc) Material genético compactado no núcleo Cromossomos lineares Núcleo Envelope nuclear Ribossomos Mitocondrias Cloroplasto

5 Nucleotídeos e aminoácidos soltos estão nadando na célula

6 Transcrição DNA fita codificadora DNA fita molde RNA transcrito Quem faz esse serviço na célula?

7 O RNA é transcrito por uma enzima chamada RNA polimerase II Ela captura ribonucleotídeos e os pareia com os nucleotídeos da fita molde RNA polimerase I é para RNA ribosomal RNA polimerase III é para RNA de transferência

8 Fases da transcrição: 1. Início: Reconhecimento do promotor pela RNApolimerase Abertura da fita dupla de DNA (região do promotor) Formação do complexo de início de transcrição

9 Fases da transcrição: 2. Elongação: 3.Término


11 Bolha de transcrição Fita codificadora RNA polimerase Fita molde Direção da transcrição 5 3

12 Procariotos e Eucariotos Procariotos são as bactérias e as arquéias Eucariotos são o resto Tem núcleo, e o DNA fica no núcleo Diferença básica na forma como os genes são representados no DNA e com consequente diferença no processo de transcrição (formação do RNA mensageiro maduro)

13 Procariotos promotor 5 UTR 3 UTR m Proteína UTR: Região não traduzida (Untranslated region)

14 Eucariotos 5 UTR 3 UTR Genes eucarióticos são (em sua maioria) constituídos por exons interrompidos por introns

15 RNA polimerases de eucariotos RNA polimerases purificadas não são capazes de iniciar a transcrição de modo específico Possuem subunidades específicas Compartilham algumas subunidades Requerem proteínas auxiliares para transcrição Fatores de Transcrição (TFs)

16 Promotores de genes transcritos pela RNApol II Tata Binding Protein Complexo TFIID TATA box Início da Transcrição

17 Processamento do mrna Eubactérias Eucariotos



20 Junções de splicing: regra GU/AG 98% das junções de splicing no genoma humano Junções alternativas <1% = GC-AG < 0,1% = AU-AC

21 Splicing Alternativo Isoformas/variantes de splicing A maioria dos genes humanos apresentam splicing alternativo

22 Subtipos de splice alternativo

23 Por que ter a complicação de introns?

24 Números de genes organismo Número de genes (aprox) Mycoplasma genitalium 500 Escherichia coli Levedura 6,000 C. elegans (verme) Mosca Camundongo Humanos Tomate Arroz

25 Grande parte da complexidade de eucariotos vem de splice alternativo Permite obter várias diferentes proteínas a partir do mesmo gene Talvez existam cerca de 1 milhão de diferentes proteínas no corpo humano apenas por causa de splice alternativo

26 Processos celulares são complexos Uma rede de interações entre moléculas

27 Eubactérias Eucariotos Splicing



30 Hora de YouTube!

31 Tradução É o processo que leva do mrna para a proteína É quando os codons são traduzidos em aminoácidos Ocorre no ribosomo A célula tem que ter o código genético embutido de alguma forma Que forma será essa?

32 nadando no citoplasma Aminoácido Sítio de ligação do Aminoácido Molécula adaptadora Triplete de nucleotídeos codificando para um aminoácido

33 Molécula adaptadora Se chama RNA de transferência Ou trna

34 Pseudouridina Dihidrouridina

35 AUC = Ile

36 trna A enzima que liga o aminoácido na ponta 3 - OH se chama aminoacil trna sintetase (aars) Existe um trna específico para cada AA Existe uma aars específica para cada trna Então existem 20 diferentes aarss Então o conhecimento do código genético está encapsulado nessas moléculas e nos trnas


38 Base wobble de trnas Somente os 2 primeiros nt no anticodon do trna são estritamente necessários para o pareamento de um codon com um AA O terceiro nt se chama de wobble Por isso não são necessários 61 diferentes trnas; em geral 45 são suficientes Base Inosina: é capaz de se ligar com U, C, A Anticodon CCI serve para GGA, GGC, GGU (glicina)

39 1. Ativação do aminoácido Ligação do aminoácido ao trna Aminoacil t-rna

40 Aminoacil- trna




44 Terminação de tradução




48 Síntese e Processamento de Proteínas Transcrição Modificações pós-traducionais Transcrito primário Processamento pós-transcricional mrna maduro Tradução Dobramento Proteína (não funcional) Proteína funcional

49 Hora de YouTube!

50 Inibição da síntese proteica por antibióticos Estreptomicina Tetraciclina Bloqueia o sítio A do ribossomo bacteriano e inibe associação do aminoacil-trna Causa leitura incorreta dos códons e inibe iniciação de tradução Ribosomos de procariotos são diferentes de ribosomos de eucariotos

51 Classificação dos genes humanos

52 Para pensar Onde está a informação que permite a célula criar um ribosomo? Onde está a informação para criar um trna? Explique como a célula sintetiza uma aminoacil trna sintetase?

53 Terminação da transcrição dependente da proteína Rho Rho (46kDa, ativa como hexâmero) move-se ao longo do RNA acompanhando a RNA polimerase Com a pausa da RNA polimerase na sequência de terminação, Rho alcança a enzima Rho desenrola o híbrido RNA-DNA Sequência de Terminação dependente de Rho: rica em C

Transcrição e Processamento de RNA

Transcrição e Processamento de RNA Transcrição e Processamento de RNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Biologia Molecular Básica-Arnaldo Zaha Lenhinger Principles of Biochemistry

Leia mais

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação.

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação. Organização estrutural e funcional do núcleo DNA RNA Proteínas Replicação Transcrição Processamento (Splicing) Tradução (citoplasma) Cromatina - Eucromatina - Heterocromatina Cromossomo - Mitose 1 DNA

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA.

Leia mais


DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

DNA, cromossomos e organização dos genes do genoma

DNA, cromossomos e organização dos genes do genoma DNA, cromossomos e organização dos genes do genoma Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Lenhinger Principles of Biochemistry (3a. Ed.) Genoma

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Profa. Dra. Viviane Nogaroto

Profa. Dra. Viviane Nogaroto ESTRUTURA DO GENE GENE: Região do DNA capaz de ser transcrita a fim de produzir uma molécula de RNA funcional ou uma proteína -inclui sequências codificadoras e regulatórias transcrição tradução DNA RNA

Leia mais

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017 Princípios Básicos de Genética Molecular Parte II Profª Ana Claudia 17/02/2017 Estrutura do material genético Estrutura de Genomas e variabilidade Replicação Transcrição Tradução Regulação da Expressão

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Genética de microrganismos Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Piracicaba, outubro 2014 Histórico 1868- Primeiro a estudar o núcleo

Leia mais

Transcrição e Processamento

Transcrição e Processamento transcrição do DNA maturação do RNA AAAA AAAA AAAA tradução em proteína NÚCLEO CITOPLASMA Transcrição e Processamento RNAs adotam estruturas terciárias complexas RNA carregado RNA transportador aminoácido

Leia mais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais Tradução José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Tradução em eucarióticos e procarióticos Eventos pós transcricionais 1 Processo de síntese de proteínas mrna contém o código do gene trna

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais


UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais


Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética Prof. Marcelo Langer Curso de Biologia Aula 16 Genética FUNCIONAMENTO DO GENE Um gene não funciona em todas as células, mas somente em um tipo de célula, onde tem relação à sua função. Isso ocorre devido

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN Resumo Introdução: revisão transcrição e tradução

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais


21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon. FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

GENOMAS. Prof. Dr. Marcelo Ricardo Vicari

GENOMAS. Prof. Dr. Marcelo Ricardo Vicari GENOMAS Prof. Dr. Marcelo Ricardo Vicari Definições: Genoma: Conjunto completo de genes e das sequências de DNA de um organismo Transcriptoma: Conjunto completo de genes expressos sob certas condições

Leia mais

Fluxo da informação genética

Fluxo da informação genética UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE GENÉTICA E BIOLOGIA MOLECULAR Fluxo da informação genética Profa. Dra. Nívea Macedo DNA 5 3 Do DNA ao RNA A estrutura

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Transcrição Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail:

Leia mais

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA TRANSCRIÇÃO - Pontos Principais: Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA A transcrição é realizada por enzimas

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Síntese Proteica e Modificação Pós-Traducionais

Síntese Proteica e Modificação Pós-Traducionais Disciplina de Métodos Purif. e Anál. de Proteínas Curso de Ciências Biológicas Síntese Proteica e Modificação Pós-Traducionais Prof. Marcos Túlio de Oliveira

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais


ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: NÚCLEO Abriga do material genético

Leia mais



Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais



Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

Replicação de DNA QBQ 204 Aula 2 (biomol)

Replicação de DNA QBQ 204 Aula 2 (biomol) Replicação de DNA QBQ 204 Aula 2 (biomol) Prof. João Carlos Setubal Site da disciplina Trabalho para entrega Grupos de 6 alunos Temas: processos bioquímicos relacionados

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais



Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais



Leia mais

Sumário. A Transcrição do DNA

Sumário. A Transcrição do DNA Sumário A Transcrição do DNA A expressão dos genes: do DNA à proteína. Unidade transcricional. RNA: estrutura química e estrutura secundária. Transcrição do DNA: o enzima RNA polimerase. Fases da transcrição.

Leia mais

Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA

Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA Conteúdo... - Replicação do DNA e ciclo celular; -Origem de Replicação; -Mecanismos básicos de replicação

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Genes e Genomas Procarióticos

Genes e Genomas Procarióticos Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Genes e Genomas Procarióticos Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves O que é Biologia Celular? É o ramo da ciência

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais


ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais


EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais


MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila DNA RNA 17/04/2017 Genes (ou Gen) é uma parte do DNA capaz de sintetizar uma proteína específica. O DNA (Ácido Desoxiribonucleico) é formado pela união de nucleotídeos. Fosfato Ribose Glicídio do grupo

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

BÁSICA EM IMAGENS. Introdução à Bioquímica

BÁSICA EM IMAGENS. Introdução à Bioquímica Universidade Federal de Pelotas Instituto de Química e Geociências Departamento de Bioquímica 01 BÁSICA EM IMAGENS - um guia para a sala de aula Introdução à Bioquímica 1. Introdução O Que é Bioquímica?

Leia mais

Replicação de DNA. Priscila M. M. de Leon. Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular

Replicação de DNA. Priscila M. M. de Leon. Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Replicação de DNA Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel Replicação

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP:

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP: Ácidos Nucleicos: Nucleotídeos, DNA e RNA Bianca Lobão - nº USP: 9370841 Caio Lourenço - nº USP: Giulia Santos - nº USP: 9370726 Nucleotídeos Compõem a estrutura das moléculas de DNA e RNA; São compostos

Leia mais

Organização do genoma e variação individual

Organização do genoma e variação individual Organização do genoma e variação individual José Francisco Diogo da Silva Junior Mestrando CMANS/UECE PLASTICIDADE CELULAR 1 PLASTICIDADE CELULAR PLASTICIDADE CELULAR 2 COMPOSIÇÃO DO DNA ESTRUTURA DO DNA

Leia mais


UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Replicação do DNA. Profa. Dra. Aline Maria da Silva Instituto de Química- USP

Replicação do DNA. Profa. Dra. Aline Maria da Silva Instituto de Química- USP Replicação do DNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Biologia Molecular Básica-Arnaldo Zaha Lenhinger Principles of Biochemistry (3a. Ed.)

Leia mais


REGULAÇÃO DO MATERIAL GENÉTICO REGULAÇÃO DO MATERIAL GENÉTICO Prof. Ana Rita Rainho Controlo da actividade celular Se todas as células de um organismo possuem a mesma informação genética, qual o mecanismo que permite às células diferenciar-se?

Leia mais

Núcleo. Vera Andrade Robert Brown (1833) descreveu o núcleo celular

Núcleo. Vera Andrade  Robert Brown (1833) descreveu o núcleo celular Vera Andrade Núcleo Robert Brown (1833) descreveu o núcleo celular Nux (grego) = semente, por ser considerado tão importante para a célula quanto a semente é para

Leia mais

GENÉTICA: DE MENDEL AO DNA. Como os genes influenciam as características?

GENÉTICA: DE MENDEL AO DNA. Como os genes influenciam as características? GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Colégio XIX de Março Educação do jeito que deve ser

Colégio XIX de Março Educação do jeito que deve ser Colégio XIX de Março Educação do jeito que deve ser 2017 1ª PROVA SUBSTITUTIVA DE BIOLOGIA Aluno (a): Nº Ano: 2º Turma: Data: 16/05/2017 Nota: Professor(a): Regina Volpato Valor da Prova: 40 pontos Orientações

Leia mais

GOIÂNIA, / / PROFESSOR: Mário Neto. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Mário Neto. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2017 PROFESSOR: Mário Neto DISCIPLINA: Ciências da natureza SÉRIE: 3º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

Leia mais

Engenharia Agronômica. Biologia Celular 1º Período

Engenharia Agronômica. Biologia Celular 1º Período Engenharia Agronômica Biologia Celular 1º Período Apresentação Introdução: Estrutura, funções e evoluções das células Cap. 01 (Junqueira e Carneiro) e Biologia das células (Amabis e Martho, UFRJ) videos\a

Leia mais


CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA CÉLULAS Células são estruturas complexas e diversas; São capazes de autoreplicação; Realizam uma ampla variedade de papeis especializados em organismos multicelulares:

Leia mais

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas Introdução a Bioinformática Curso de Verão 2011 Nivelamento na área de Biológicas 1 O que é genoma? Um genoma é o DNA completo de um organismo, incluindo os genes. Os genes levam a informação para produzir

Leia mais

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos?

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos? O que significam as siglas? R: Ácido desoxirribonucleico. A molécula de tem mensagens codificadas em sequências de que contêm bases púricas e pirimídicas. R: nucleótidos Qual o nome das bases pirimídicas?.

Leia mais

Replicação do DNA e Cromossomos

Replicação do DNA e Cromossomos Replicação do DNA e Cromossomos Características básicas da replicação do DNA In Vivo É semiconservativa, Inicia-se em origens únicas Geralmente é bidirecional a partir de cada origem de replicação. A replicação

Leia mais


DUPLICAÇÃO DO DNA REPLICAÇÃO DO DNA DUPLICAÇÃO DO DNA OU REPLICAÇÃO DO DNA 18/04/2017 1 MITOSE EM CÉLULAS EUCARIÓTICAS 2n A mitose ocorre em células somáticas 1. Intérfase 1.1 Prófase 1.2 Metáfase 1.3 Anáfase 1.4 Telófase 1.4.1 Citocinese

Leia mais

DNA, Cromossomos e Replicação. Capítulos 5 e 6 (pág ) - Fundamentos da Biologia Celular - Alberts- 2ª edição

DNA, Cromossomos e Replicação. Capítulos 5 e 6 (pág ) - Fundamentos da Biologia Celular - Alberts- 2ª edição DNA, Cromossomos e Replicação Capítulos 5 e 6 (pág 199-210) - Fundamentos da Biologia Celular - Alberts- 2ª edição Ácidos ribonucléicos DNA e RNA Formado por nucleotídeos: uma base nitrogenada ligada a

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo Genética Estuda

Leia mais

Regulação gênica em Eucariotos. Prof. Dr. Marcelo Ricardo Vicari

Regulação gênica em Eucariotos. Prof. Dr. Marcelo Ricardo Vicari Regulação gênica em Eucariotos REGULAÇÃO GÊNICA Neurônio e célula de fígado: células de um mesmo indivíduo e que contêm a mesmo genoma REGULAÇÃO GÊNICA Diferenciação celular 1973 REGULAÇÃO GÊNICA Dolly:

Leia mais