21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon."

Transcrição

1 FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm é decodificada em proteína, a partir de um código genético. Qual a importância da tradução? Função estrutural proteínas fazem parte de todos os constituintes celulares. Ex: colágeno da pele, queratina das unhas. Função enzimática atuam como enzimas, acelerando as reações químicas. Função de transporte ex: hemoglobina transporta O 2. Função de reserva alimentar proteínas fornecem aminoácidos ao organismo durante o seu desenvolvimento, bem como energia. Ex: albumina do ovo. 1

2 Qual a importância da tradução? Onde ocorre a tradução? Função imunológica (defesa) anticorpos neutralizam substâncias estranhas. Eucariotos: Citoplasma. Função motora componentes dos músculos. Função hormonal alguns hormônios possuem constituição proteica. Ex: insulina e adrenalina. Procariotos: transcrição e tradução acoplados sem núcleo Citoplasma. No processo de tradução participam 3 tipos de RNA: RNAm (mensageiro) Contém o código do gene. RNAt (transportador) RNAr (ribossômico) Liga-se a aminoácidos específicos, conforme o código genético, trazendoos para o ribossomo. Permite a atração entre as bases complementares do anticódon do RNAt e o códon do RNAm. Responsáveis pela leitura da mensagem contida no RNAm. ALGUNS CONCEITOS Tabela do código genético universal Códons de RNA Códon 3 bases nucleotídicas no RNAm que codificam cada aminoácido. 1 códon 3 nucleotídeos do RNAm 1 AA 7 códons 21 nucleotídeos 7 AA 2

3 Características: CÓDIGO GENÉTICO 64 códons. CÓDIGO GENÉTICO Especificidade codifica o mesmo AA; um determinado códon sempre 20 aminoácidos. Universalidade é conservado em todas as espécies; Redundância um AA pode ter mais de 1 trinca que o codifica; Contínuo sempre lido de 3 em 3 bases. CÓDIGO GENÉTICO ALGUNS CONCEITOS Códon de iniciação Códons. de terminação não codificam AA Anticodon sequência de três bases nitrogenadas (trinca) do RNA transportador, que se associa (complementa) a uma trinca do RNA mensageiro. AUG UAG/UGA/ UAA Duas regiões se destacam em cada RNAt: 1 - Local em que se ligará o aminoácido a ser transportado. 2 - Trio de bases complementares do RNAt, que se encaixará no códon correspondente do RNAm. C G ALGUNS CONCEITOS ESTRUTURA DE UM RIBOSSOMO Subunidade maior Ribossomo são organelas celulares presentes em todo o citoplasma de células eucariontes e procariontes. Elas tem como função sintetizar proteínas que serão utilizadas em processos internos da célula. Subunidade maior Subunidade menor Sitio P Segura a cadeia polipeptídica em crescimento. Sitio A Recebe os RNAt com os aminoácidos. 3

4 O processo de tradução é divido em 4 etapas: 1- Ativação do aminoácido 4- Terminação 1-1- Ativação do do aminoácido Ligação dos aminoácidos aos seus RNAt no citoplasma pelas aminoacil-rnat sintetases. A menor subunidade do ribossomo liga-se RNAt do AA metionina e juntos percorrem a molécula de RNAm até encontrar o códon de iniciação. Enzimas que ligam AA aos seus RNAt aumenta a especificidade e a fidelidade da tradução da mensagem genética. C U U U A U G C U U G A C C C C U G A G G C G U U 5 3 RNA mensageiro 5 A partir do códon de iniciação AUG início da leitura do RNAm início da proteína a ser sintetizada. Subunidade maior do ribossomo se encaixa ao complexo. P A AUG U UU C U U G A C C C C U G A G G C G U U 5 3 4

5 5 Lis Inclui todas as reações que ocorrem desde a formação da primeira ligação peptídica até a incorporação do último AA à proteína. Lis Formação da ligação peptídica (grupo amina de um aminoácido une-se ao grupo carboxila do outro) P U A C A 5 3 P U A C A RNA mensageiro Glu Glu A U G U U U C U U G A C C C C U G A G G C C A G 5

6 4- Terminação Ocorre quando 1 dos 3 códons (UAA, UAG, UGA) de terminação é colocado no sítio A do ribossomo. Dissociação dos componentes. Para finalizar Explique detalhadamente como ocorre o processo de tradução da molécula de RNA evidenciando a produção de proteínas. 6

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

EXERCÍCIOS DE VESTIBULAR

EXERCÍCIOS DE VESTIBULAR EXERCÍCIOS DE VESTIBULAR PRÉ-VESTIBULAR BIOLOGIA PROF. MARCONI 1º Bimestre 01. (Ufal 2006) Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam ambos

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas A Síntese de Proteínas O RNA e a Síntese de Proteínas O papel do RNAt e das sintetases do aminoacil-rnat O emparelhamento códon-anticódon O papel do RNAm e dos ribossomos Etapas da Síntese de Proteínas

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente:

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: 1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: a) tradução, transcrição, duplicação b) duplicação, transcrição, tradução c) duplicação, tradução, transcrição d) tradução, duplicação,

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Profº Lásaro Henrique

Profº Lásaro Henrique Profº Lásaro Henrique Proteínas são macromoléculas complexas, compostas de aminoácidos. São os constituintes básicos da vida e necessárias para os processos químicos que ocorrem nos organismos vivos. Nos

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Professora Priscila F Binatto

Professora Priscila F Binatto Professora Priscila F Binatto Característica 5 3 AUTODUPLICAÇÃO (Replicação) Ocorre em presença da enzima DNA polimerase Molécula DNA As pontes de hidrogênio se rompem H Nucleotídeos LIVRES encaixam se

Leia mais

Núcleo. Vera Andrade Robert Brown (1833) descreveu o núcleo celular

Núcleo. Vera Andrade  Robert Brown (1833) descreveu o núcleo celular Vera Andrade http://histologiavvargas.wordpress.com/ Núcleo Robert Brown (1833) descreveu o núcleo celular Nux (grego) = semente, por ser considerado tão importante para a célula quanto a semente é para

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Faculdade Anhanguera Curso de Graduação em Educação Física

Faculdade Anhanguera Curso de Graduação em Educação Física Faculdade Anhanguera Curso de Graduação em Educação Física Profa. Dra. Amabile Vessoni Arias E-mail: Amabile.arias@anhanguera.com 2016-2 Mês de agosto Conteúdo 9 Unidade 1 16 Unidade 1 23 Unidade 1 30

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

Tipo do produto: Plano de aula

Tipo do produto: Plano de aula Edital Pibid n 11 /2012 CAPES PROGRAMA INSTITUCIONAL DE BOLSA DE INICIAÇÃO À DOCÊNCIA - PIBID Plano de Atividades (PIBID/UNESPAR) Tipo do produto: Plano de aula 1 IDENTIFICAÇÃO NOME DO SUBPROJETO: POPULARIZANDO

Leia mais

Recursos para Estudo / Atividades

Recursos para Estudo / Atividades COLÉGIO NOSSA SENHORA DA PIEDADE Programa de Recuperação Paralela 1ª Etapa 2013 Disciplina: Ciências Série: 2ª Professor (a): SUELI COSTA Turma: FG Caro aluno, você está recebendo o conteúdo de recuperação.

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR

UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR CURITIBA 2014 MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

BIOLOGIA CELULAR. Organelas celulares ORGANELAS CELULARES

BIOLOGIA CELULAR. Organelas celulares ORGANELAS CELULARES BIOLOGIA CELULAR ORGANELAS CELULARES Organelas celulares Núcleo; Retículo endoplasmático; Ribossomos; Complexo de Golgi; Endossomos; Lisossomos; Peroxissomos; Citoesqueleto; Mitocôndrias. 2 1 Retículo

Leia mais

Proteínas e enzimas. Profs. Lourdes, Guilherme e Lauren

Proteínas e enzimas. Profs. Lourdes, Guilherme e Lauren Proteínas e enzimas Profs. Lourdes, Guilherme e Lauren Definição As proteínas são polipeptídios que resultam na condensação de milhares de moléculas de aminoácidos, ligadas em sequencia como elos em uma

Leia mais

objetivos Fluxo da informação genética tradução III AULA

objetivos Fluxo da informação genética tradução III AULA Fluxo da informação genética tradução III AULA 28 objetivos Nesta aula, você terá a oportunidade de: Descrever cada uma das etapas da tradução: iniciação, alongamento e terminação. Relatar alguns mecanismos

Leia mais

Aula 6: Síntese protéica

Aula 6: Síntese protéica Aula 6: Síntese protéica 3 RNAs são necessários para efetuar a síntese protéica: mrna (RNA mensageiro) processado: carrega a informação (ou seja, a seqüência de bases) para a sintese da proteina rrna

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

TRADUÇÃO SÍNTESE PROTEICA

TRADUÇÃO SÍNTESE PROTEICA TRADUÇÃO SÍNTESE PROTEICA Formação do Aminoacil-tRNA Durante a formação do aminoacil-trna, o aminoácido é primeiramente ativado, reagindo com o ATP. Após, é transferido do aminoacil-amp para a extremidade

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Tradução Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

TRABALHO DE BIOLOGIA A Química da Vida

TRABALHO DE BIOLOGIA A Química da Vida TRABALHO DE BIOLOGIA A Química da Vida Nomes: Leonardo e Samuel Turma: 103 Para iniciar o estudo das células (citologia) devemos primeiramente ter uma noção das estruturas básicas da célula ou as estruturas

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR

BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR BIOQUÍMICA CELULAR COMPOSTOS INORGÂNICOS Moléculas simples: ÁGUA; SAIS MINERAIS. COMPOSTOS ORGÂNICOS Moléculas complexas: CARBOIDRATOS; LIPÍDIOS; PROTEÍNAS

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Relembrando: Material genético

Relembrando: Material genético REGULAÇÃO GÉNICA Relembrando: Material genético O MATERIAL GENÉTICO é o suporte físico do conjunto de padrões de informações hereditárias, transmitidas ao longo das gerações. GENE é a unidade de informação

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o

Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o A química da Vida Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o restante 2,5% está concentrado em

Leia mais

SÍNTESE DE PROTEÍNAS

SÍNTESE DE PROTEÍNAS SÍNTESE DE PROTEÍNAS MÓDULO 2 CITOLOGIA SÍNTESE DE PROTEÍNAS Sintetizar uma proteína é parecido com preparar uma receita. Ao invés de uma célula, imagine um restaurante. Nesse restaurante existe uma sala

Leia mais

Conceitos fundamentais de Biologia Celular

Conceitos fundamentais de Biologia Celular Conceitos fundamentais de Biologia Celular Principais estruturas da célula eucariótica O NÚCLEO Contém nos cromossomos todo o genoma (DNA) das células; Responsável pela síntese e processamento dos RNAs

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

Questões Uece 2º Fase Específica Biologia. Prof. Matheus Magalhães/ Data: 26/06/14

Questões Uece 2º Fase Específica Biologia. Prof. Matheus Magalhães/ Data: 26/06/14 Questões Uece 2º Fase Específica Biologia Prof. Matheus Magalhães/ Data: 26/06/14 1. Dentre as propriedades físico-químicas da água, com grande importância sob o ponto de vista biológico, podem-se citar:

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula.

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Aula 01 Composição química de uma célula O que é uma célula? Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Toda célula possui a capacidade de crescer,

Leia mais