Tamanho: px
Começar a partir da página:



1 UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA original atua como molde, e cada novo DNA possui uma fita antiga e outra nova. ( ) Os quatro ribonucleosídeos trifosfatados, datp, dgtp, dctp e dutp, devem estar presentes. ( ) O DNA deve ser desnaturado (desenrolado) para tornar-se acessível ao pareamento das novas bases. ( ) A enzima DNA polimerase adiciona nucleotídeos novos de acordo com o molde de DNA. A sequência correta de preenchimento dos parênteses, de cima para baixo, é a) V V F F. b) F V V V. c) V F V V. d) F V F F. e) F F F V. 2. (Ufrgs 2012) Darwin sofreu durante a maior parte de sua vida adulta de uma doença debilitante que pode ter sido a Síndrome dos Vômitos Cíclicos (SVC). A hipótese corrente sugere que a doença seja provocada por uma mutação mitocondrial já descrita na literatura. Sabe-se que a mãe e o tio materno de Darwin apresentavam os mesmo sintomas que ele. Sabe-se, também, que Darwin era casado com uma prima em primeiro grau, que não apresentava a síndrome, e que o casal teve vários filhos e filhas, não havendo nenhum sindrômico entre eles. Com base no exposto acima, assinale a alternativa correta. a) A SVC pode ter padrão de herança dominante ligado ao sexo. b) A inexistência de filhos sindrômicos está de acordo com a hipótese da origem mitocondrial da doença de Darwin. c) De acordo com a hipótese da origem mitocondrial, tanto a avó quanto o avô materno de Darwin podem ter passado a síndrome para seus filhos. d) A consanguinidade entre Darwin e sua esposa sustenta a hipótese de herança mitocondrial da síndrome.

2 e) De acordo com a hipótese da origem mitocondrial da síndrome, todas as filhas de Darwin devem ser portadoras do gene mutado. 3. (Ufrgs 2012) Os ácidos nucleicos são polímeros que atuam no armazenamento, na transmissão e no uso da informação genética. Com base na estrutura e função destes polímeros, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) Seus monômeros são denominados nucleotídeos. ( ) Seus monômeros estão unidos por meio de ligações fosfodiésteres. ( ) Suas bases nitrogenadas estão diretamente ligadas aos fosfatos. ( ) Suas bases nitrogenadas podem ser púricas ou pirimídicas. A sequência correta de preenchimento dos parênteses, de cima para baixo, é a) V V F V. b) V F V F. c) F V V F. d) F F V V. e) V F F V. 4. (Ufrgs 2012) O quadro abaixo representa o código genético universal. U C A G U UUU UCU UAU U UGU Fen UUC UCC Tir Cis UAC UGC Ser C UUA UCA Leu UAA UGA Fim UUG UCG Fim A UAG UGG Trp G C CUU CCU CAU CGU U CUC CCC His CAC CGC C Leu Pr o Arg CUA CCA CAA CGA CUG CCG GIn A CAG CGG G A AUU ACU AAU AGU U AUCIle ACC Ans Ser AAC AGC C AUA Tre ACA AAA AGA AUG Met/Início ACG Lis Arg A AAG AGG G

3 G GUU GUC Val GUA GUG GCU GCC Ala GCA GCG GAU Asp GAC GAA Glu GAG GGU GGC Gli GGA GGG U C A G A molécula de RNA mensageiro com a sequência CGAAUGACAAAAGGAUAACGU produz o segmento de proteína a) Met Tre Lis Gli Arg. b) Tre Arg Met. c) Arg Met Tre Lis Gli. d) Met Tre Lis Gli. e) Leu Arg Met Tre Lis Gli. 5. (Ufrgs 2010) Leia o quadrinho a seguir. Considere o enunciado a seguir, referente ao significado da resposta de Mafalda, e as três propostas para completá-lo. A expressão direção 5 3 refere-se 1 à ligação entre fosfato e açúcar no processo de replicação do DNA. 2 à atividade da enzima RNA polimerase no processo de transcrição do RNA. 3 à união entre os aminoácidos no processo de tradução das proteínas. Quais propostas estão corretas? a) Apenas 1.

4 b) Apenas 2. c) Apenas 3. d) Apenas 1 e 2. e) 1,2 e (Ufrgs 2008) O esquema a seguir representa uma etapa do processo de tradução. Assinale a alternativa que identifica, correta e respectivamente, os componentes indicados pelas setas 1, 2 e 3 do esquema. a) polipeptídeo - RNA transportador - códon b) proteína - RNA mensageiro - anticódon c) RNA mensageiro - RNA ribossômico - anticódon d) RNA mensageiro - RNA ribossômico - RNA transportador e) polipeptídeo - RNA mensageiro - aminoácido 7. (Ufrgs 2007) O dogma central da biologia molecular refere-se ao sentido do fluxo de informação genética nos seres vivos, o qual está representado a seguir. I II DNA RNA Proteína Assinale com V (verdadeiro) ou F (falso) as afirmações adiante, relacionadas aos processos indicados pelos números I e II. ( ) Em I, a RNA-polimerase liga-se a uma sequência especial de DNA, denominada sítio promotor.

5 ( ) Em I, a fita de DNA que é molde para um gene pode ser complementar para outro gene. ( ) Em II, um determinado ribossomo é específico para a produção de uma determinada proteína. ( ) Em II, a formação de polissomos aumenta a taxa de síntese protéica. A sequência correta de preenchimento dos parênteses, de cima para baixo, é a) F - F - F - V. b) V - V - F - V. c) F - V - F - F. d) V - F - V - V. e) V - F - V - F. 8. (Ufrgs 2005) O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA, morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica da biologia molecular, lançando, assim, as bases para a descoberta do código genético. Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma, a) o código genético é degenerado, pois um aminoácido pode ser codificado por mais de uma trinca. b) a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a proteína. c) cada polipeptídeo tem uma sequência específica de nucleotídeos determinada pelo gene. d) cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de quatro tipos diferentes. e) uma molécula de DNA difere de outra pela sequência de seus nucleotídeos. 9. (Ufrgs 2004) Leia o texto abaixo. A entrada na era da genômica possibilitou ao norte-americano Eugene V. Koonin investigar qual seria o número mínimo de genes capazes de sustentar o funcionamento de uma célula. Para isso, ele comparou 21 genomas completos de representantes das três linhagens primárias da vida: as eubactérias, as arqueobactérias e os eucariontes. O resultado da pesquisa mostrou que o número de genes deve situar-se em torno de 150. Esse enfoque é interessante, pois permite imaginar os primeiros sistemas genéticos surgidos por ocasião da origem da vida. Adaptado de SALZANO, F.M. "Ciência Hoje", v. 29, n. 173, jul Considere as seguintes afirmações.

6 I - No código genético, a cada códon deve corresponder mais de um aminoácido. II - Os genes compartilhados pelos genomas dos diferentes grupos devem ser essenciais. III - Os genes envolvidos na replicação, transcrição e tradução do material genético devem fazer parte do conjunto mínimo de genes. Quais delas poderiam ter embasado o raciocínio de Koonin? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas II e III. e) I, II e III. 10. (Ufrgs 2004) No início da década de 1950, foi desenvolvido um experimento onde um dos componentes de um tipo de bacteriófago foi marcado radiativamente com enxofre e outro, com fósforo. Esses bacteriófagos foram utilizados para infectar uma cultura de 'Escherichia coli'. Um dos componentes entrou na bactéria, e o outro foi retirado da parede da mesma, por agitação. A cultura foi, então, imediatamente, centrifugada. O resultado obtido encontra-se ilustrado no esquema a seguir. Sobre o resultado do experimento, é correto afirmar que a) o DNA do bacteriófago marcado com fósforo encontra-se no depósito bacteriano. b) as proteínas do bacteriófago marcadas com enxofre encontram-se no depósito bacteriano. c) o DNA do bacteriófago marcado com enxofre encontra-se em suspensão. d) as proteínas do bacteriófago marcadas com fósforo encontram-se em suspensão. e) o DNA do bacteriófago marcado com enxofre encontra-se no depósito bacteriano. 11. (Ufrgs 2001) Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados:

7 I - 1 a amostra: ribose II - 2 a amostra: timina III - 3 a amostra: dupla hélice IV- 4 a amostra: uracila V - 5 a amostra: 20% de guanina e 30% de citosina Entre estas amostras, quais se referem a DNA? a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas II e IV. e) Apenas II e V. 12. (Ufrgs 1998) Considere a rota metabólica que produz o aminoácido arginina na figura adiante. Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado.

8 e) o gene que codifica a enzima 3 na linhagem III foi afetado. 13. (Ufrgs 1998) Meselson e Stahl, em 1957, fizeram um experimento sobre a replicação do DNA. Nesse experimento, a bactéria 'Escherichia coli' foi cultivada, por muitas gerações, em meio contendo um isótopo pesado de nitrogênio, 15 N, até todo o seu DNA estar marcado com esse isótopo. Depois disso, as bactérias foram transferidas para um meio contendo nitrogênio leve, 14 N. As moléculas de DNA das bactérias foram então isoladas e analisadas com relação ao seu conteúdo de 15 N e de 14 N, sendo observado o seguinte: Com relação a esses dados, podemos concluir que a) a replicação do DNA é semiconservativa. b) a replicação do DNA é conservativa. c) a replicação do DNA é randômica. d) não ocorreu replicação do DNA mas, sim, uma mutação. e) não ocorreu replicação do DNA mas, sim, transcrição. 14. (Ufrgs 1998) Sabendo que o DNA dos vírus bacteriófagos contém fósforo e que a cápsula protéica contém enxofre, Hersey e Chase, em 1952, cultivaram vírus em meio contendo isótopos de fósforo ( 32 P) e de enxofre ( 35 S). Esses pesquisadores observaram, ao introduzir os vírus marcados em meio contendo bactérias, que os isótopos de fósforo ( 32 P) apareciam no interior das bactérias e que os isótopos de enxofre ( 35 S) permaneciam fora das células. Observaram também que, após lavarem a superfície das bactérias, retirando o enxofre ( 35 S), continuava ocorrendo a replicação dos vírus. Com esse experimento, eles puderam concluir que a) a informação genética necessária para a síntese de novos vírus está contida no DNA viral. b) as capas protéicas dos vírus contêm parte importante da informação genética necessária à síntese de novos vírus. c) o DNA viral precisa estar associado integralmente às capas protéicas para poder se replicar no interior das bactérias. d) a capa protéica protege o DNA viral da ação de endonucleases no interior do organismo hospedeiro.

9 e) os vírus bacteriófagos contêm DNA como material genético, e essa molécula é muito rica em enxofre. 15. (Ufrgs 1997) O esquema a seguir mostra a via metabólica de um aminoácido, levando à formação de alguns hormônios: A respeito deste esquema são feitas as seguintes afirmações: I - Um indivíduo com a enzima 1 inibida acumulará grandes quantidades de aminoácido 3. II - Um indivíduo com a enzima 1 inibida deixa de produzir as enzimas 2 e 3. III - Um indivíduo com a enzima 1 inibida precisa receber os hormônios 1 e 2 de fontes externas. Quais estão corretas? a) Apenas I. b) Apenas II. c) Apenas III. d) Apenas I e II. e) Apenas II e III. 16. (Ufrgs 1996) Considere as seguintes etapas da síntese de proteínas. I - Transcrição do código genético do DNA em códons do RNA mensageiro. II - Ligação dos códons de RNA mensageiro aos anticódons correspondentes dos RNAs transportadores. III - Fixação do RNA mensageiro aos ribossomos. Qual a sequência correta dessas etapas durante o processo?

10 a) I - II - III. b) I - III - II. c) II - III - I. d) III - II - I e) III - I - II. Gabarito: Resposta da questão 1: [C] A replicação semiconservativa do DNA caracteriza-se por ter cada fita parental como molde para a nova fita, e cada um dos dois novos DNAs possuir uma fita velha e outra nova. Os quatro deoxirribonucleosídeos trifosfatados que devem estar presentes são os citados com exceção de dutp, que deve ser substituído por dttp. Para que ocorra a replicação do DNA, o mesmo deve ser desnaturado para separar as duas fitas-molde, e a enzima DNA polimerase é a responsável pelo aporte de novos nucleotídeos, de acordo com o molde determinado. Resposta da questão 2: [B] Darwin não pode ter transmitido a síndrome aos seus filhos, pois eles herdaram as mitocôndrias da mãe, não portadora da SVC. Resposta da questão 3: [A] Em nucleotídeos formadores dos ácidos nucleicos, as bases nitrogenadas estão ligadas ao açúcar, ribose ou desoxirribose. Resposta da questão 4: [D] O RNA mensageiro será traduzido a partir do códon de iniciação AUG e terminará no códon terminal UAA. Dessa forma, o peptídeo formado apresentará a seguinte sequência de aminoácidos: metionina treonina lisina glicina. Resposta da questão 5: [D] A molécula de DNA é constituída por uma cadeia de nucleotídeos. Cada nucleotídeo, por sua vez, é formado por um grupo fosfato, um açúcar (desoxirribose) e uma base nitrogenada (timina, citosina, guanina ou adenina). Para formar a molécula de DNA, necessária se faz a ligação entre os nucleotídeos. O grupo hidroxila do carbono-3 da pentose do primeiro nucleotídeo liga-se ao grupo fosfato ligado à hidroxila do carbono-5 da pentose do segundo nucleotídeo. Devido a essa formação, a cadeia de DNA fica com uma direção determinada, isto é, em uma extremidade temos livre a hidroxida do carbono-5 da primeira pentose e na outra temos livre a hidroxila do carbono-3 da última pentose. Isso determina que o crescimento do DNA se faça na direção 5 3. A ligação entre o fosfato e o açúcar no processo de replicação

11 do DNA e a atividade da enzima RNA polimerase no processo de transcrição do DNA em RNA ocorre sempre na direção 5 3. Resposta da questão 6: [A] Resposta da questão 7: [B] Resposta da questão 8: [B] Resposta da questão 9: [D] Resposta da questão 10: [A] Resposta da questão 11: [C] Resposta da questão 12: [E] Resposta da questão 13: [A] Resposta da questão 14: [A] Resposta da questão 15: [C] Resposta da questão 16: [B]


OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais


BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015.

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais


Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais


Site: Código Genético É o conjunto dos genes humanos. Neste material genético está contida toda a informação para a construção e funcionamento do organismo humano. Este código está contido em cada uma das nossas

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais



Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo.

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo. BIOLOGIA 01. Considere o enunciado abaixo e as três propostas para completá-lo. Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactérias, observou que elas eram incapazes de crescer

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais


ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais


EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais


DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Código Genético. Bianca Zingales

Código Genético. Bianca Zingales Código Genético Bianca Zingales Um gene - uma enzima Beadle & Tatum (1930 1940) Experimentos de genética com o fungo Neurospora. Mutações induzidas com raios X. Mutações em um único

Leia mais


1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES 1 3AMIپ0 9CIDS PLASMپ0 9TICS LIVRES پ0 9CIDS AMIADS PLASMپ0 9TICS LIVRES CBPM AMB 28.13.043-0 CBPM AMB 28.04.099-6/92 Sinon ھmia: پ0 9cido asp rtico, پ0 9cido glutپ0 9mico, Alanina,

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais


COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir)

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Pergunta 1 Abaixo estão apresentadas as estruturas de três aminoácidos. Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Usando os espaços em branco abaixo, classifique os três na ordem da hidrofobicidade

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais


GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015.

Criado e Desenvolvido por: Todos os direitos são reservados 2015. Criado e Desenvolvido por: Todos os direitos são reservados 2015. O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Ácidos nucleicos. Disponível em: . Acesso em: 21 fev

Ácidos nucleicos. Disponível em: <>. Acesso em: 21 fev Ácidos nucleicos Ácidos nucleicos Disponível em: . Acesso em: 21 fev. 2012. Núcleo celular Define as características morfofisiológicas da

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais


Bioquímica ENZIMAS ÁC. NUCLEICOS Bioquímica ENZIMAS ÁC. NUCLEICOS As enzimas são substâncias orgânicas, geralmente proteínas, que catalisam reações biológicas pouco espontâneas e muito lentas. O poder catalítico de uma enzima relaciona

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais


CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir. EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações

Leia mais


DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V BIOLOGIA 01 Não é somente o sabor agradável ao paladar que faz dos cogumelos comestíveis um dos alimentos mais cobiçados pelos asiáticos e europeus. Esses cogumelos são ricos em proteínas, sais minerais,

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais


16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais


GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

Introdução à Teoria da Informação

Introdução à Teoria da Informação Introdução à Teoria da Informação Probabilidade e Estatística I Antonio Roque Aula 8 O conceito de quantidade de informação associada a um evento foi introduzido pelo engenheiro norte-americano Claude

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais


BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS Estrutura de um bacteriófago Proteína cabeça DNA cauda Proteínas cromossomo bacteriano Fago DNA Como pode cair no enem (MACKENZIE) O ser humano tem travado batalhas constantes

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais


ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3ª SÉRIE - 3º BIMESTRE ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3ª SÉRIE - 3º BIMESTRE - 2017 Nome: Nº 3ª Série Data: / / 2017 Soraia e Thierry Professor(a):Danilo, Glauco, Léa, Nota: (Valor 1,0) APRESENTAÇÃO: A estrutura da recuperação

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D.

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D. EVOLUÇÃO EVIDÊNCIAS DO PROCESSO EVOLUTIVO Prof. Nelson Jorge da Silva Jr. Ph.D. Professor Titular PREMISSAS BÁSICAS DA EVOLUÇÃO 1. As espécies mudam no sentido da descendência com modificação. 2. Todos

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: Telefone: (16) 3373-9159 O processo da

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais


BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA BIOVESTIBA.NET VIRTUAL UFRGS BIOQUÍMICA 1. (Ufrgs 2015) Observe a tira abaixo. Se o filho do Radicci tornar-se vegetariano do tipo que não utiliza produtos derivados de animais, ficará impossibilitado

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais Entre essas amostras, quais se referem a DNA? a) Apenas I e II. d) Apenas II e IV. b) Apenas I e III. e) Apenas II e V. c) Apenas II e III. 231. UFPE Nos últimos anos, a biologia molecular tem fornecido

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais