Introdução à Bioquímica

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Introdução à Bioquímica"

Transcrição

1 Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP.

2 Genoma! O genoma de um organismo conteúdo específico de DNA pode estar distribuído em diversos cromossomos, cada um contendo uma molécula de DNA separada.! Vários organismos são diplóides dois conjuntos equivalentes de cromossomos! Devido ao seu comprimento, as moléculas de DNA são descritas em termos do número de pares de bases (pb ou kb).

3 Os cromossomos

4 O cariótipo humano

5 Ácidos nucléicos de fita simples! O RNA ocorre principalmente como fita simples, em geral formando estruturas compactas em vez de cadeias frouxas estendidas! Uma fita de RNA é idêntica à fita de DNA, exceto pela presença de grupos 2 -OH e pela substituição da timina por uracila! Pode parear com uma fita complementar de RNA ou DNA! O pareamento das bases é intramolecular, formando estruturas em grampo ou estruturas mais complexas.

6 Os genes são parte dos cromossomos! Foi em 1944 que Avery, Macleod e McCarty mostraram que o DNA, e não as proteínas, era a substância que transformava uma cepa nãopatogênica em patogênica.! A natureza da fita dupla do DNA facilita a replicação.! Quando a célula se divide, cada fita de DNA atua como molde para a síntese da sua fita complementar

7 Replicação do DNA DNA polimerase

8 Os genes direcionam a síntese de proteínas! Dogma central da biologia molecular: O DNA dirige sua própria replicação e transcrição, formando um RNA de seqüência complementar A seqüência de bases no RNA é então traduzida na seqüência correspondente de aminoácidos, formando uma proteína

9 A conversão da informação do DNA em informação proteíca não é direta.

10 A tradução! O RNA que corresponde ao gene que codifica uma proteína é o RNA mensageiro (RNAm)! Este vai até o ribossomo organela composta em grande parte por RNA ribossômico (RNAr)! No ribossomo cada grupo de três nucleotídeos no RNAm pareia com três nucleotídeos complementares em uma pequena molécula de RNA o RNA transportador (RNAt)! Cada molécula de RNAt está ligada a um aminoácido correspondente

11 Tipos de RNA! RNAt, RNAr e RNAm

12 RNAm não é todo transcrito

13 O ribossomo catalisa a união dos aminoácidos pela peptidil transferase

14 DNA e proteínas são polímeros lineares de unidades repetitivas. A informação genética estocada na seqüência de 4 tipos de nucleotídeos da fita de DNA é codificada numa seqüência protéica com 20 possíveis aminoácidos. O mecanismo molecular desta conversão é a tradução, em que uma trinca de nucleotídeos (códon) é traduzido num aminoácido.

15

16 O ribossomo consiste de 2/3 de RNA e 1/3 de proteína. A reação química que une os aminoácidos de modo covalente é catalisada pelo RNAr (RNA + peptidil transferase) exemplo de RNA catalítico Lembrar que: As proteínas suplantaram o RNA como catalisadores celulares devido à sua maior versatilidade química

17 O RNA Dupla função: " Transmissão da informação do genoma " Molécula funcional na expressão da informação RNA e DNA: moléculas muito similares Podem ser usadas de maneira idêntica para estocagem de informação RNA e proteína: moléculas muito diferentes O que é preservado não é a capacidade de estocar informações, mas a capacidade de processar informações.

18 Retrovírus " fluxo oposto de informação RNA " DNA A transmissão da informação genética requer a transcrição reversa do RNA para DNA antes da replicação do DNA - predita por Howard Temin Enzima responsável pela reação - Transcriptase reversa (1970) Ex.: vírus da AIDS Estocam a informação genética no RNA genômico ao invés do DNA.

19 Replicação do HIV

20 Sequenciamento de ácidos nucléicos A capacidade de determinar as seqüências de nucleotídeos nos ácidos nucléicos tornou possível deduzir as seqüências de aminoácidos das proteínas por eles codificadas, e até certo ponto, as estruturas e as funções dessas proteínas

21 Sequenciamento de ácidos nucléicos A estratégia global: 1. Clivar o polímero em fragmentos específicos, pequenos o suficiente para serem completamente sequenciados 2. Determinar a seqüência dos resíduos em cada fragmento 3. Determinar a ordem dos fragmentos no polímero original pela repetição das etapas precedentes

22 Sequenciamento pelo método de terminação de cadeia! Utiliza DNA polimerase, dntps e iniciadores, e uma fita simples de DNA como molde! A síntese de DNA termina após bases específicas! método dideoxi (2,3 -dideoxinucleosídeotrifosfato - ddntp) ddntp

23 dntps DNA fita simples 5 CGCGAATTCATGGCAAAGCAGTACGACTGGACTATCCTAGTAACACCTCTAAA 3 5 CGC GAA TTC ATG GCA AAG CAG TAC GAC CCG GAA TTC TCA GAA GAC GCG CTC AAA 3 3 Iniciadores ( primers )

24 Reação em cadeia da polimerase - PCR

25 O aparelho para PCR

26 Eletroforese para sequenciamento

27 Sequenciamento manual

28 Sequenciamento automático É uma variação do método de terminação de cadeia são usados marcadores fluorescentes A base terminal de cada fragmento é identificada pela fluorescência característica Esses detetores fluorescentes são controlados por computador Esse sistema automático pode identificar ~10 mil bases por dia contra ~ 50 mil bases por ano obtidas pelo método manual.

29 Sequenciamento automático

30 Sequenciamento automatizado de DNA

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 Introdução a Biologia i Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Corpo Informação das proteínas e RNAs que serão sintetizadas

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Estudo Dirigido Sequenciamento de DNA

Estudo Dirigido Sequenciamento de DNA Estudo Dirigido Sequenciamento de DNA Professores Dra. Daniela Alves Silvestre OBJETIVOS Compreender a partir do estudo da técnica de sequenciamento do DNA através da utilização de didesoxinucleotídeos,

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Vírus, um grupo a parte.

Vírus, um grupo a parte. Vírus, um grupo a parte. Vírus, um grupo a parte. Estrutura típica de um vírus: 01)Observe a figura a seguir, onde está representado, esquematicamente, o vírus HIV e analise as proposições quanto à sua

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

2 Contexto Biológico Genômica

2 Contexto Biológico Genômica 15 2 Contexto Biológico Neste capítulo abordaremos o contexto biológico para o entendimento deste trabalho. Serão abordados os aspectos gerais da genômica, expostos os processos do sequenciamento genético

Leia mais

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas Introdução a Bioinformática Curso de Verão 2011 Nivelamento na área de Biológicas 1 O que é genoma? Um genoma é o DNA completo de um organismo, incluindo os genes. Os genes levam a informação para produzir

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

- Sequenciamento de genomas nada mais é que a determinação da ordem linear dos nucleotídeos ou bases nitrogenadas de um genoma.

- Sequenciamento de genomas nada mais é que a determinação da ordem linear dos nucleotídeos ou bases nitrogenadas de um genoma. Sequenciamento de genomas - Sequenciamento de genomas nada mais é que a determinação da ordem linear dos nucleotídeos ou bases nitrogenadas de um genoma. O sequenciamento de um genoma é geralmente referido

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Nucleotídeos e Ácidos Nucléicos

Nucleotídeos e Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO Escola de Engenharia de Lorena EEL Programa de Aperfeiçoamento de Ensino - PAE Nucleotídeos e Ácidos Nucléicos Angela da Silva Machado Súmula da aula... Estrutura e função dos

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO Página 1 de 5 PLANO DE ENSINO I. IDENTIFICAÇÃO Unidade Acadêmica: Câmpus Jataí Curso:Biomedicina Disciplina:Biologia Molecular Carga horária semestral:64 Teórica: 48 Prática: 16 Semestre/ano:1/2013 Turma/turno:

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

A Estrutura dos Ácidos Nucléicos

A Estrutura dos Ácidos Nucléicos Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular A Estrutura dos Ácidos Nucléicos Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel

Leia mais

Bases e aplicações. da tecnologia do DNA recombinante

Bases e aplicações. da tecnologia do DNA recombinante Bases e aplicações da tecnologia do DNA recombinante Por quê entender a Tecnologia do DNA recombinante? y y Doenças: diagnóstico, prognóstico e tratamento Compreensão dos mecanismos biológicos y y y organismos

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor:

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor: Avaliação: Aluno: Data: Ano: Turma: Professor: Biologia Questão 1 (Fuvest 2002) Os vírus A. ( ) possuem genes para os três tipos de RNA (ribossômico, mensageiro e transportador), pois utilizam apenas aminoácidos

Leia mais

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Tema: Direção da síntese de polímeros biomoleculares DNA mrna Proteína Alunos: José Augusto M. Burgarelli Rafael da Fonseca Lameiro Seiti Inoue Venturini

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Superlista núcleo 1.

Superlista núcleo 1. Superlista núcleo 1. (Unicamp) Em relação a um organismo diploide, que apresenta 24 cromossomos em cada célula somática, pode-se afirmar que a) seu código genético é composto por 24 moléculas de DNA de

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Síntese de Proteínas, Divisão Celular e Embriologia

Síntese de Proteínas, Divisão Celular e Embriologia Síntese de Proteínas, Divisão Celular e Embriologia 1. Em um segmento de cadeia ativa de DNA, que servirá de molde para a fita de RNA mensageiro, há 30 timinas e 20 guaninas. No segmento correspondente

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Aula 14 ÁCIDOS NUCLEICOS. André Luís Bacelar Silva Barreiros Marizeth Libório Barreiros. META Introduzir o aluno ao estudo dos ácidos nuleicos.

Aula 14 ÁCIDOS NUCLEICOS. André Luís Bacelar Silva Barreiros Marizeth Libório Barreiros. META Introduzir o aluno ao estudo dos ácidos nuleicos. Aula 14 ÁCIDOS NUCLEICOS META Introduzir o aluno ao estudo dos ácidos nuleicos. OBJETIVOS Ao final desta aula, o aluno deverá: Saber definir e classificar os ácidos nulceicos. Conhecer as funções biológicas

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Replicação do DNA Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Processo de replicação do DNA. Mediado por diversas enzimas Principais enzimas

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

GENES, DNA E RNA CONTEÚDOS. Transcrição e tradução gênica Mutações gênicas O fenótipo e o genótipo. Figura 1 Dupla Hélice de DNA Fonte: Microsoft

GENES, DNA E RNA CONTEÚDOS. Transcrição e tradução gênica Mutações gênicas O fenótipo e o genótipo. Figura 1 Dupla Hélice de DNA Fonte: Microsoft GENES, DNA E RNA Figura 1 Dupla Hélice de DNA Fonte: Microsoft CONTEÚDOS Transcrição e tradução gênica Mutações gênicas O fenótipo e o genótipo AMPLIANDO SEUS CONHECIMENTOS Transcrição e tradução gênica

Leia mais

O Sequenciamento genômico

O Sequenciamento genômico Pontifícia Universidade atólica de oiás Departamento de Biologia Disciplina: Bioinformática Bio1015 Prof. Macks Wendhell onçalves, Msc mackswendhell@gmail.com O Sequenciamento genômico Sequenciamento genômico

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 07 ÁCIDOS NUCLEICOS

BIOLOGIA - 1 o ANO MÓDULO 07 ÁCIDOS NUCLEICOS BIOLOGIA - 1 o ANO MÓDULO 07 ÁCIDOS NUCLEICOS Nome do Nucleotídeo Adenina Guanina Timina Citosina Base Adenina (A) Guanina (G) Timina (T) Citosina (C) Purina / Pirimidina Purin Purina Pirimidina Pirimidina

Leia mais

BIOLOGIA QUESTÃO 01. Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Ca ++ e tromboplastina

BIOLOGIA QUESTÃO 01. Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Ca ++ e tromboplastina Processo Seletivo/UNIFAL- janeiro 008 - ª Prova Comum TIPO BIOLOGIA QUESTÃO 0 Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Fibrinogênio Coágulo Ca ++

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais