MÓDULO 3 BIOLOGIA MOLECULAR

Tamanho: px
Começar a partir da página:

Download "MÓDULO 3 BIOLOGIA MOLECULAR"

Transcrição

1 MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos

2 Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae Não virulenta (R) Virulenta (S) Cápsula de polissacarídio

3

4 Conclusão: Algum fator da bactéria virulenta passava para a bactéria não virulenta

5 Da bactéria virulenta separaram: - a proteína - o polissacarídio - o DNA Misturaram cada componente com a bactéria não virulenta Injetaram os camundongos Conclusão: O DNA continha a informação da virulência

6 Análise da composição de bases do DNA

7 Ácidos Nucleicos (DNA e RNA) Moléculas compostas de nucleotídeos Nucleotídeos são os blocos estruturais dos ácidos nucleicos

8 Estrutura de um nucleotídeo 2 Base Nitrogenada 3 Fosfato Pentose 1 X X H desoxiribose Ác. desoxiribonucleicos (DNAs) OH ribose Ác. ribonucleicos (RNAs)

9 2 Bases nitrogenadas que compõem os ácidos nucléicos Purinas Adenina Guanina Pirimidinas DNA RNA Citosina Timina Uracila

10

11 OH OH OH OH Os quatro nucleosídios do DNA: desoxiadenosina (da), desoxiguanosina (dg), desoxicitidina (dc), (desoxi)timidina (dt, ou T). Os quatro nucleosídios do RNA: adenosina (A), guanosina (G),citosina (C), uridina (U).

12 Nucleotídios Um nucleotídio é um nucleosídio que contém um ou mais grupos fosfato covalentemente ligados ao Carbono 5 ou 3 do açúcar (ligação éster)

13 Desoxiribonucleotídeos (Fosfato na posição 5 )

14 Ribonucleotídeos

15 Ligação entre os Nucleotídios Um nucleotídio se liga ao outro nucleotídio por ligação fosfodiéster entre o C3 de um nucleotídio e o C5 do nucleotídio seguinte OH

16 Orientação de uma cadeia de DNA ou RNA extremidade 5 OH 3 extremidade 3

17 Ácidos nucleicos são polímeros lineares de nucleotídeos unidos por ligações fosfodiéster DNA RNA Extremidade 5 Oligonucleotídeos: até 50 unidades Polinucleotídeos: > 50 unidades H Extremidade 3

18 A dupla hélice do DNA

19 Evidências

20

21

22 James Watson e Francis Crick (1953) O modelo da dupla hélice

23

24 Pontes de hidrogênio entre bases C-G e A-T em fitas de DNA complementares A forma 2 pontes de hidrogênio com T na fita oposta e G forma 3 pontes de hidrogênio com C na fita oposta

25 Características da Dupla Hélice de DNA 1- Duas fitas (cadeias) de DNA formam uma hélice, que se enrola em volta de um eixo, com uma espiral para a direita 2- As duas fitas de DNA correm em sentidos opostos (antiparalelas) 3- Os esqueletos de açúcar e fosfato das duas fitas de DNA enrolam-se ao redor do eixo da hélice 4- As bases nitrogenadas dos nucleotídios estão voltadas para o interior da hélice, empilhadas uma sobre a outra 5- Os grupos fosfato carregados ficam voltados para fora Nota: não confundir com alfa-hélice de proteínas...

26 Forças que estabilizam a dupla hélice 1. Pontes de Hidrogênio entre as bases nitrogenadas; 2. Forças de Van der Waals entre os anéis aromáticos das bases nitrogenadas empilhadas no interior da hélice 3. Interações hidrofílicas dos grupos fosfato carregados negativamente com o meio externo.

27 Em função da especificidade do pareamento das bases, as duas fitas do DNA são chamadas complementares

28 A Dupla Hélice do DNA é a estrutura secundária nativa (ou normal) A conversão da dupla hélice do DNA em fitas simples é chamada desnaturação A conversão de fitas simples de volta para a estrutura de dupla hélice é chamada renaturação A renaturação só ocorre porque há complementaridade entre as fitas do DNA

29 DESNATURAÇÃO Separação das duas fitas de DNA e formação de estruturas desordenadas. AGENTES DESNATURANTES Extremos de ph (< 4; >11); Temperatura ( o C); Agentes que quebram pontes de H (uréia; guanidina; formamida)

30 DNA parcialmente desnaturado

31 RNA também é um polímero de nucleotídeos Tipos de RNA numa célula: - RNA mensageiro (mrna) - RNA transportador ou de transferência (trna) - RNA ribossômico (rrna) - Pequenos RNAs (snrna)

32 RNA é um polímero de fita simples Apresenta estrutura secundária por dobramento da cadeia. Pontes de hidrogênio intra-cadeia Em sua estabilidade participam as mesmas forças que atuam no DNA.

33 Estrutura do RNA com exceção de certos tipos de vírus, o RNA é uma molécula encontrada na forma de fita simples moléculas de RNA também apresentam estrutura secundária formam pontes de hidrogênio entre as bases (ligação intra-cadeia) rrna 3 trna 5 5 3

34 Propriedades do DNA e RNA O RNA é hidrolisado por álcali (bases) O DNA não é hidrolisado por álcali

35 Nucleases são enzimas que rompem a ligação fosfodiéster e digerem ácidos nucleicos Desoxiribonucleases atuam no DNA Ribonucleases atuam no RNA

36 A estrutura do DNA e a complementaridade entre as fitas permitiram que Watson e Crick propusessem: - O mecanismo de replicação do DNA - A origem das Mutações - A forma como a informação genética seria armazenada - A forma como a informação genética do DNA é traduzida (e expressa) em proteína

37 Em 1965 Crick define o DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA O dogma Central da Biologia Molecular define os três processos fundamentais envolvidos na preservação e transmissão da informação genética contida no genoma (DNA) do organismo.

38 Processos Replicação DNA Transcrição RNA Tradução PROTEÍNA Replicação processo pelo qual uma molécula de DNA dá origem a duas moléculas idênticas Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Tradução Processo pelo qual a mensagem genética (transcrita no mrna) é decodificada em aminoácidos que são utilizados para a síntese da proteína.

39 Organização do Genoma

40

41

42 Cromossomo de Bactéria

43 Cromossomo de Eucariotos DNA de uma célula humana = 2 metros

44

45 Histonas proteínas básicas, ricas em Lisina e Arginina

46

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS META Introduzir o estudo das funções biológicas, propriedades químicas e estruturas dos nucleotídeos. OBJETIVOS Ao final desta aula,

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Nucleotídeos e Ácidos Nucléicos

Nucleotídeos e Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO Escola de Engenharia de Lorena EEL Programa de Aperfeiçoamento de Ensino - PAE Nucleotídeos e Ácidos Nucléicos Angela da Silva Machado Súmula da aula... Estrutura e função dos

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 Os Ácidos

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição DNA e Cromossomos Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição Ácidos nucléicos Formado por nucleotídeos: uma base nitrogenada ligada a uma ribose ou desoxirribose e um ou mais grupos

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA BIOVESTIBA.NET VIRTUAL UFRGS BIOQUÍMICA 1. (Ufrgs 2015) Observe a tira abaixo. Se o filho do Radicci tornar-se vegetariano do tipo que não utiliza produtos derivados de animais, ficará impossibilitado

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

ADN. Ana Martins STC-7 Saberes fundamentais

ADN. Ana Martins STC-7 Saberes fundamentais 2010 ADN Ana Martins STC-7 Saberes fundamentais 20-07-2010 Em 1869, o Médico Suíço Friedrich Miescher retirou de uma ligadura alguns glóbulos brancos e fez uma grande descoberta. Descobriu que o núcleo

Leia mais

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA Aula teórica 4 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br FUNÇÃO DO MATERIAL GENÉTICO 1. Função genotípica:

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA ESTRUTURA DO DNA E ORGANIZAÇAO DA CROMATINA ATIVIDADE BIOLÓGICA 1 Qual é a natureza química da molécula responsável por estocar a informação genética??? CARACTERÍSTICAS 1. Estocar a informação e transmitir

Leia mais

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS Unidade básica dos Ácidos Nucleicos Existem apenas 4 bases em cada um dos ácidos nucleicos DNA DNA e RNA RNA Ácido fosfórico Ácido fosfórico Pentose Desoxirribose

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio.

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio. Química da Vida Água A água compõe a maior parte da massa corporal do ser humano e de todos os seres vivos, logo na composição química celular prevalece à presença de água. Sendo 70% do peso da célula

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

A função da água e sais minerais dentro da célula

A função da água e sais minerais dentro da célula A QUÍMICA DA VIDA A função da água e sais minerais dentro da célula Eles tem a ver com o metabolismo das mitocôndrias na qual a principal função seria de não parar a que sustenta, vejamos isso entre água

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

Estudo Dirigido Sequenciamento de DNA

Estudo Dirigido Sequenciamento de DNA Estudo Dirigido Sequenciamento de DNA Professores Dra. Daniela Alves Silvestre OBJETIVOS Compreender a partir do estudo da técnica de sequenciamento do DNA através da utilização de didesoxinucleotídeos,

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR. Prof.: Anderson Marques de Souza 2016

ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR. Prof.: Anderson Marques de Souza 2016 ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR Prof.: Anderson Marques de Souza 2016 Hereditariedade sem identidade os fatores de Mendel Em 1865, Mendel apresenta seus trabalhos sobre a hereditariedade. Em 1900

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

29/08/2015 QUÍMICA DE PROTEÍNAS. Medicina Veterinária IBGM - IBS. Medicina Veterinária IBGM - IBS

29/08/2015 QUÍMICA DE PROTEÍNAS.   Medicina Veterinária IBGM - IBS. Medicina Veterinária IBGM - IBS QUÍMICA DE PROTEÍNAS D i s c i p l i n a : b i o q u í m i c a, p r o f. D r. Va g n e O l i v e i ra E-mail: vagne_melo_oliveira@outlook.com Medicina Veterinária IBGM - IBS Medicina Veterinária IBGM -

Leia mais

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas FICHA (IN)FORMATIVA Nº 1 Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas Ácidos nucleicos Os ácidos nucleicos armazenam e transmitem a informação hereditária.

Leia mais

Trabalho de biologia. Nome: Naiheverton e wellinton. Turma:103

Trabalho de biologia. Nome: Naiheverton e wellinton. Turma:103 Trabalho de biologia Nome: Naiheverton e wellinton Turma:103 VITAMINAS São compostos orgânicos imprescindível para algumas reações metabólicas especificas,requeridos pelo corpo em quantidade minimas para

Leia mais

Bioinformática Histórico e conceitos básicos

Bioinformática Histórico e conceitos básicos Bioinformática Histórico e conceitos básicos Raimundo Lima da S. Júnior M.Sc. Departamento de Biologia Núcleo de Pesquisas Replicon PUC-GO Silva Jr., RL Casamento entre a ciência da computação e a biologia

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica.

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. O processo de síntese de RNA, a partir de um molde de DNA, é denominado

Leia mais

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira Faculdade de Tecnologia de Araçatuba Curso Superior de Tecnologia em Bioenergia Sucroalcooleira 1 ÁCIDOS NUCLÉICOS Estrutura e funções 2 Ácidos nucléicos são polímeros de nucleotídeos adenina citosina

Leia mais

Química da Vida. Prof. João Ronaldo Tavares de Vasconcellos Neto

Química da Vida. Prof. João Ronaldo Tavares de Vasconcellos Neto Química da Vida Prof. João Ronaldo Tavares de Vasconcellos Neto Propriedades Atômicas Elementos e Compostos químicos; Alguns símbolos são derivados do latim Por Exemplo: o símbolo do sódio é Na, da palavra

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

objetivo DNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo DNA aspectos funcionais e estruturais AULA Pré-requisito DNA aspectos funcionais e estruturais AULA 4 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do DNA. Pré-requisito Para acompanhar mais facilmente

Leia mais

Composição e Estrutura Molecular dos Sistemas Biológicos

Composição e Estrutura Molecular dos Sistemas Biológicos Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Composição e Estrutura Molecular dos Sistemas Biológicos Átomos e Moléculas Hierarquia

Leia mais

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 7ª aula teórica 11 Outubro 2010 Proteínas estruturais e funcionais Organização estrutural das proteínas Estrutura e diferentes funções de proteínas

Leia mais

Nucleotídeos as unidades que formam os ácidos nucléicos

Nucleotídeos as unidades que formam os ácidos nucléicos Nucleotídeos as unidades que formam os ácidos nucléicos AULA 3 objetivos Nesta aula, você terá a oportunidade de: Conhecer quimicamente os nucleotídeos, já que eles são as unidades que formam os ácidos

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula.

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Aula 01 Composição química de uma célula O que é uma célula? Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Toda célula possui a capacidade de crescer,

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Aula 2 Unidades fundamentais dos ácidos nucléicos

Aula 2 Unidades fundamentais dos ácidos nucléicos Biologia Molecular Básica Módulo I Básico Aula 2 Unidades fundamentais dos ácidos nucléicos Prezado professor, nesta aula você vai estudar os nucleotídeos que formam os blocos constituintes dos ácidos

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS Paulo Dutra ÁCIDOS NUCLEICOS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose

Leia mais

A Química da Vida. Gabriela Eckel

A Química da Vida. Gabriela Eckel A Química da Vida Gabriela Eckel Água A água é um composto químico formado por dois átomos de hidrogênio e um de oxigênio. Sua fórmula química é H2O. Porém, um conjunto de outras substâncias como, por

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Biologia Molecular. Indústria de Informação

Biologia Molecular. Indústria de Informação Biologia Molecular Indústria de Informação A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA- Proteínas Os Operários Proteínas Erros de Programação Doenças 2 1 Biologia Molecular Retrata

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Proteínas. Proteínas são polímeros de aminoácidos

Proteínas. Proteínas são polímeros de aminoácidos Proteínas Estrutura & Propriedades Proteínas são polímeros de aminoácidos Existem 20 tipos diferentes de aminoácidos Aminoácidos são ácidos fracos A carga elétrica do aminoácido varia de acordo com o ph

Leia mais

2 Contexto Biológico Genômica

2 Contexto Biológico Genômica 15 2 Contexto Biológico Neste capítulo abordaremos o contexto biológico para o entendimento deste trabalho. Serão abordados os aspectos gerais da genômica, expostos os processos do sequenciamento genético

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

Professores: Felipe e Olivia

Professores: Felipe e Olivia BIOQUÍMICA Ácidos Nucléicos Professores: Felipe e Olivia Ácidos Nucléicos São compostos orgânicos de elevado peso molecular, formados por carbono, hidrogênio, oxigênio, nitrogênio efósforo; São as moleculas

Leia mais