Introdução à Bioquímica

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Introdução à Bioquímica"

Transcrição

1 Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP.

2 Tópicos! Estrutura e função dos nucleotídeos! Estrutura dos ácidos nucléicos! Visão geral da função dos ácidos nucléicos! Sequenciamento dos ácidos nucléicos! Tecnologia do DNA recombinante

3 Métodos para sequenciar ácidos nucléicos Sequenciamento manual : 2,3 -dideoxinucleosídeo-trifosfato ddntp Sequenciamento automático : Marcadores fluorescentes

4 Sequenciamento pelo método de terminação de cadeia seq. manual

5 Uso de marcadores fluorescentes - Sequenciamento automático

6 Tecnologia do DNA recombinante! Técnicas de clonagem! Bibliotecas genômicas! Amplificação de DNA por PCR! Aplicações da Tecnologia do DNA recombinante

7 Tecnologia do DNA recombinante

8 Como genes são isolados da fita de DNA??

9 As nucleases de restrição A endonuclease cliva um ácido nucléico no interior de uma fita polinucleotídica A exonuclease cliva um ácido nucléico por meio da remoção de um dos seus resíduos terminais

10 Técnicas de clonagem " Amplificação de um segmento de DNA 1. Um fragmento de DNA de tamanho apropriado é produzido por meio de endonucleases de restrição, e isolado 2. O fragmento é incorporado em uma outra molécula de DNA (vetor), que contém as seqüências necessárias para dirigir a replicação do DNA 3. O vetor recombinado é introduzido em células, onde é replicado 4. As células que contém o DNA desejado são identificadas, ou selecionadas

11 Clonagem Produção de múltiplos organismos idênticos, derivados de um ancestral comum Em um organismo hospedeiro (como E. coli) podem ser produzidas grandes quantidades do DNA

12 Uso da DNA-ligase na clonagem! A DNA-ligase une fragmentos de DNA para produzir uma molécula de DNA-recombinante

13 Plasmídeos bacterianos podem ser usados para clonar DNA! Plasmídeo: DNA circular Genes humanos são isolados pela clonagem de DNA

14 Vetor de clonagem - plasmídeo + fragmento de DNA (inserto) Plasmídeo recombinante

15 Os plasmídeos recombinantes são geralmente clonados em células bacterianas Processo denominado transformação

16

17 Bibliotecas genômicas Bibliotecas de cdna representam o RNAm produzido por determinado tecido

18 A hibridização permite que mesmo genes pouco relacionados possam ser identificados relação com a função de proteínas conhecidas

19 Amplificação de DNA por PCR! A reação em cadeia da polimerase amplifica sequências selecionadas de DNA Iniciadores! Proteínas celulares raras podem ser produzidas em grandes quantidades usando DNA clonado

20 PCR

21 Aplicações da Tecnologia do DNA recombinante

22 Estudo estrutural da CDK9 Objetivos Expressar a proteína quinase (CDK9), purificá-la, para então resolver sua estrutura cristalográfica a alta resolução. Usar as informações estruturais para desenhar drogas específicas.

23 Principal função das CDKs O ciclo celular

24 Ciclo de divisão celular: processo básico da gênese de novas células Mitose

25 A regulação da divisão celular é crucial para o desenvolvimento normal de organismos multicelulares O sistema controle do ciclo celular está baseado em duas famílias de proteínas que são chaves para o seu funcionamento: 1) quinases dependentes de ciclinas ( cyclindependent kinase CDKs), 2) ciclinas, denominadas proteínas ativadoras.

26 Cada subunidade catalítica da CDK pode associar-se a diferentes ciclinas Existem ao todo 13 CDKs (CDK1-CDK13). CDKs1-8 estão envolvidas no controle do ciclo celular. CDKs 9 e 10 são importantes reguladores transcricionais. CDKs suas funções não estão bem claras Existem 15 ciclinas: Ciclinas A - T

27 CDKs e ciclinas

28 A formação, ativação e a separação dos complexos ciclinas-cdks são os eventos fundamentais que coordenam o ciclo celular

29 Proteínas regulatórias envolvidas em neoplasias

30 Quinase dependente de ciclina 9 (CDK9) CDK9 é uma subunidade catalítica da P-TEFb, um fator de transcrição que estimula a elongação da RNA polimerase II

31 Complexo de pré-iniciação para a transcrição da RNA polimerase II do HIV (Fackler et al., 2001).

32 Ex.: Replicação do vírus HIV O estudo estrutural de proteínas envolvidas na sua replicação são importantes para o desenvolvimento de novos inibidores da sua transcrição.

33 Clonando o gene da CDK9

34 cdna total + iniciadores PCR Amplificação do fragmento de cdna Sequenciamento Extração e purificação do gene da CDK9 plasmídeo Reação com ligase Inserção do gene da CDK9 no vetor pet23a Transformação Clonagem do vetor em Escherichia coli (DH10B) Purificação do vetor Clonagem e expressão em E. coli (BL21-DE3) Solubilização!! Purificação da CDK9

35 5 ggggacccggagcaggagcggcggcagcagcgactgggggcggcggcggcgcgttggag gcggccatggcaaagcagtacgactcggtggagtgccctttttgtgatgaagtttccaa atacgagaagctcgccaagatcggccaaggcaccttcggggaggtgttcaaggccaggc accgcaagaccggccagaaggtggctctgaagaaggtgctgatggaaaacgagaaggag gggttccccattacagccttgcgggagatcaagatccttcagcttctaaaacacgagaa tgtggtcaacttgattgagatttgtcgaaccaaagcttccccctataaccgctgcaagg gtagtatatacctggtgttcgacttctgcgagcatgaccttgctgggctgttgagcaat gttttggtcaagttcacgctgtctgagatcaagagggtgatgcagatgctgcttaacgg cctctactacatccacagaaacaagatcctgcatagggacatgaaggctgctaatgtgc ttatcactcgtgatggggtcctgaagctggcagactttgggctggcccgggccttcagc ctggccaagaacagccagcccaaccgctacaccaaccgtgtggtgacactctggtaccg gcccccggagctgttgctcggggagcgggactacggcccccccattgacctgtggggtg ctgggtgcatcatggcagagatgtggacccgcagccccatcatgcagggcaacacggag cagcaccaactcgccctcatcagtcagctctgcggctccatcacccctgaggtgtggcc aaacgtggacaactatgagctgtacgaaaagctggagctggtcaagggccagaagcgga aggtgaaggacaggctgaaggcctatgtgcgtgacccatacgcactggacctcatcgac aagctgctggtgctggaccctgcccagcgcatcgacagcgatgacgccctcaaccacga cttcttctggtccgaccccatgccctccgacctcaagggcatgctctccacccacctga cgtccatgttcgagtacttggcaccaccgcgccggaagggcagccagatcacccagcag tccaccaaccagagtcgcaatcccgccaccaccaaccagacggagtttgagcgcgtctt ctgagggccggcgcttgccactagggctcttgtgttttttttcttctgctatgtgactt gcatcgtggagacagggcatttgagtttatatctctcatgcatattttatttaatcccc accctgggctctgggagcagcccgctgagtggactggagtggagcattggctgagagac caggagggcactggagctgtcttgtccttgctggttttctggatggttcccagagggtt tccatggggtaggaggatgggctcgcccaccagtgactttttc 3

36 Mapa do vetor pet23a, mostrando os sítios de restrição no (MCS) sítio múltiplo de clonagem (flecha em preto).

37 Desenho dos primers Primer S: 5 CGC GAA TTC ATG GCA AAG CAG TAC GAC 3 Primer A: 5 CCG GAA TTC TCA GAA GAC GCG CTC AAA C 3 sítio da enzima de restriçã ção o Eco RI

38 pet23a + fragmento da CDK9 Vetor pet23a linearizado com enzima de restrição, mostrando a inserção do gene da CDK9 com T4 DNA ligase.

39 Intervençã ção o da atividade de CDKs

40 Moduladores diretos de CDKs Flavopiridol UCN-01 (7-hidroxi-estaurosporina) Olomoucina Roscovitina Purvanalol Conseqüê üências da inibiçã ção o de CDKs Interrupção do ciclo celular Apoptose Diferenciação Efeitos transcricionais

41 Inibidores de CDKs Ligam-se ao sítio de ligação do ATP, com o benzopirano ocupando a mesma região do anel de purina do ATP

42 Potenciais aplicações dos inibidores de CDKs Por estar envolvida na proliferação celular, apoptose, funções neuronais e transcrição, inibidores farmacológicos de CDKs são usados em múltiplas áreas terapêuticas.

43 Modelagem da CDK9 com flavopiridol Elementos de estrutura secundária da CDK9 complexada com o inibidor flavopiridol, obtida por modelagem molecular por homologia (MODELLER).

44 Situação atual do projeto Purificar em grande quantidade e tentar cristalizar a CDK9 para resolver sua estrutura cristalográfica

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

Bases e aplicações. da tecnologia do DNA recombinante

Bases e aplicações. da tecnologia do DNA recombinante Bases e aplicações da tecnologia do DNA recombinante Por quê entender a Tecnologia do DNA recombinante? y y Doenças: diagnóstico, prognóstico e tratamento Compreensão dos mecanismos biológicos y y y organismos

Leia mais

Aula 6: Endonucleases de restrição de enzimas de modificação de DNA

Aula 6: Endonucleases de restrição de enzimas de modificação de DNA UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2014/1 Aula 6: Endonucleases de restrição de enzimas de modificação de DNA

Leia mais

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA I - INTRODUÇÃO Atualmente é muito comum ouvirmos falar de clonagem em meios de comunicação que atingem o grande público. É também bastante comum assistirmos

Leia mais

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B)

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) Para produzir 5mg de somatostatina, são necessários 500.000 cérebros de carneiro, ou por engenharia genética 7,5kg de E. coli com gene enxertado deste

Leia mais

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e Perguntas para o roteiro de aula Professora: Drª Marilda S. Gonçalves Propriedades físico-químicas dos ácidos nucléicos 1) Descreva as principais características estruturais gerais das moléculas de DNA

Leia mais

Fases do Ciclo Celular

Fases do Ciclo Celular Ciclo Celular Fases do Ciclo Celular Todas as células passam por um ciclo de vida que, assim como a vida de um organismo complexo, apresenta diferentes fases e é irreversível. Duração do ciclo celular

Leia mais

Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA

Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA Universidade Federal de Pelotas Centro de Biotecnologia Graduação em Biotecnologia REPLICAÇÃO DE DNA Conteúdo... - Replicação do DNA e ciclo celular; -Origem de Replicação; -Mecanismos básicos de replicação

Leia mais

Estratégias de clonagem

Estratégias de clonagem UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Estratégias de clonagem Prof. Dr. Silas Pessini Rodrigues Rio de Janeiro,

Leia mais

introdução ao curso

introdução ao curso introdução ao curso http://www.ifsc.usp.br/~rdemarco/ffi0760/ffi0760.htm Cronograma aulas teóricas Aulas teóricas (Segundas-feiras - Sala 146) 30/07-introdução ao curso. 06/08-Busca em bancos de dados

Leia mais

TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3

TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3 TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3 LGN0232 Genética molecular Maria Carolina Quecine Departamento de Genética mquecine@usp.br Homo sapiens: UMA ESPÉCIE TECNOLÓGICA

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Durante décadas o método de Sanger foi praticamente a única opção utilizada para sequenciamento de DNA Nos últimos anos surgiram novas tecnologias de sequenciamento

Leia mais

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs Clonagem Molecular Fragmentos de DNA de interesse Vetores: Plasmídeos Fagos Cosmídeos BACs/ YACs Hospedeiros: E.coli Levedura Células vegetais Células animais Enzimas: Enzimas de restrição DNA polimerases

Leia mais

Replicação do DNA. Profa. Dra. Aline Maria da Silva Instituto de Química- USP

Replicação do DNA. Profa. Dra. Aline Maria da Silva Instituto de Química- USP Replicação do DNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Biologia Molecular Básica-Arnaldo Zaha Lenhinger Principles of Biochemistry (3a. Ed.)

Leia mais

Seleção de clones e screening de bibliotecas genômicas

Seleção de clones e screening de bibliotecas genômicas UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Seleção de clones e screening de bibliotecas genômicas Prof. Dr. Silas

Leia mais

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação.

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação. Organização estrutural e funcional do núcleo DNA RNA Proteínas Replicação Transcrição Processamento (Splicing) Tradução (citoplasma) Cromatina - Eucromatina - Heterocromatina Cromossomo - Mitose 1 DNA

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Por que seqüenciar genomas? O seqüenciamento de genomas é o primeiro passo para obter uma descrição completa da composição molecular de cada organismo, pois todas

Leia mais

Unidade III: Tecnologia do DNA Recombinante

Unidade III: Tecnologia do DNA Recombinante Unidade III: Tecnologia do DNA Recombinante Disciplina: Biologia Molecular Centro de Ciências da Saúde Docente: Profa. Dra. Marilanda Ferreira Bellini Pró-Reitoria de Pesquisa e de Pós-graduação Bloco

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

Biotecnologia. à Conjunto de técnicas que utilizam seres vivos para a obtenção de produtos para uso humano. Produção de antibióticos - fungos

Biotecnologia. à Conjunto de técnicas que utilizam seres vivos para a obtenção de produtos para uso humano. Produção de antibióticos - fungos Biotecnologia à Conjunto de técnicas que utilizam seres vivos para a obtenção de produtos para uso humano. Produção de antibióticos - fungos Produção de álcool e pães (fermentação alcoólica - leveduras)

Leia mais

Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h.

Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h. 1 Nome: Curso: Nº 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h. As proteínas sensoras dos sistemas reguladores de dois components são usadas por bactérias para detectar e responder

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Concurso Público para Técnico-Administrativo em Educação Edital 067/2016 Gabarito oficial preliminar Data: 05/03/2017 BIOLÓGO

Concurso Público para Técnico-Administrativo em Educação Edital 067/2016 Gabarito oficial preliminar Data: 05/03/2017 BIOLÓGO Conhecimentos Específicos Português Legislação N. de Informática Conhecimentos Específicos SERVIÇO PÚBLICO FEDERAL Tipo 1 Tipo 2 # Gab # Gab 1 D 1 A 2 B 2 C 3 C 3 D 4 A 4 B 5 C 5 C 6 B 6 C 7 C 7 D 8 D

Leia mais

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA CÉLULAS Células são estruturas complexas e diversas; São capazes de autoreplicação; Realizam uma ampla variedade de papeis especializados em organismos multicelulares:

Leia mais

Aula 2 biologia molecular

Aula 2 biologia molecular Aula 2 biologia molecular Processo de cópia de uma molécula de DNA em duplas moléculas filhas Este processo ocorre a cada fase S do ciclo celular Apresenta processos gerais e particularidades entre procariotos

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

Análises moleculares - DNA

Análises moleculares - DNA Análises moleculares - DNA Como o mapeamento genético contribui para a genética médica? A caracterização de um gene e suas mutações aumenta a compreensão da doença Aplicações: -Desenvolvimento de diagnóstico

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 Introdução a Biologia i Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Corpo Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI

Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI Menu do dia: -DNA RNA proteína - Sequenciação de genomas (Clonagem, electroforese em gel) - Transcritoma (Microarrays) - Organismos

Leia mais

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP:

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP: Ácidos Nucleicos: Nucleotídeos, DNA e RNA Bianca Lobão - nº USP: 9370841 Caio Lourenço - nº USP: Giulia Santos - nº USP: 9370726 Nucleotídeos Compõem a estrutura das moléculas de DNA e RNA; São compostos

Leia mais

ANEXO A CICLO CELULAR DIVISÃO CELULAR

ANEXO A CICLO CELULAR DIVISÃO CELULAR ANEXO A CICLO CELULAR DIVISÃO CELULAR CICLO CELULAR DIVISÃO CELULAR 1 CICLO CELULAR: processo em que o material celular é duplicado. 2 PERÍODOS: interfase (G 1, S, G 2 ), divisão celular mitose (prófase,

Leia mais

Seqüenciamento de DNA

Seqüenciamento de DNA Seqüenciamento de DNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Recombinant DNA James Watson & Michael Gilman Guia de Rotas na Tecnologia do Gene Matthew Walker & Ralph Rapley

Leia mais

Replicação de DNA. Priscila M. M. de Leon. Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular

Replicação de DNA. Priscila M. M. de Leon. Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Replicação de DNA Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel Replicação

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

Aspectos gerais da estrutura celular

Aspectos gerais da estrutura celular Ciclo celular Aspectos gerais da estrutura celular A célula é a unidade básica da vida Altamente organizada, dividida em compartimentos As células surgem de outras células préexistentes As células são

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

MARCADORES MOLECULARES

MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais

Replicação de DNA QBQ 204 Aula 2 (biomol)

Replicação de DNA QBQ 204 Aula 2 (biomol) Replicação de DNA QBQ 204 Aula 2 (biomol) Prof. João Carlos Setubal Site da disciplina http://www.iq.usp.br/setubal/qbq204/2016 Trabalho para entrega Grupos de 6 alunos Temas: processos bioquímicos relacionados

Leia mais

Aplicações. Enzimas de restrição

Aplicações. Enzimas de restrição Engenharia genética - Capacidade de manipular ácidos núcleicos de forma bem definida e controlada. As ferramentas que o permitem são as enzimas capazes de actuarem sobre ácidos núcleicos. Enzimas de restrição

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas Introdução a Bioinformática Curso de Verão 2011 Nivelamento na área de Biológicas 1 O que é genoma? Um genoma é o DNA completo de um organismo, incluindo os genes. Os genes levam a informação para produzir

Leia mais

IDENTIFICAÇÃO DE SEQUÊNCIAS POR HIBRIDIZAÇÃO E SEQUENCIAMENTO. Aula 5. Maria Carolina Quecine Departamento de Genética

IDENTIFICAÇÃO DE SEQUÊNCIAS POR HIBRIDIZAÇÃO E SEQUENCIAMENTO. Aula 5. Maria Carolina Quecine Departamento de Genética IDENTIFICAÇÃO DE SEQUÊNCIAS POR HIBRIDIZAÇÃO E SEQUENCIAMENTO Aula 5 LGN232 Genética Molecular Maria Carolina Quecine Departamento de Genética mquecine@usp.br LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA MOLECULAR

Leia mais

Nucleotídeos e Ácidos Nucléicos

Nucleotídeos e Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO Escola de Engenharia de Lorena EEL Programa de Aperfeiçoamento de Ensino - PAE Nucleotídeos e Ácidos Nucléicos Angela da Silva Machado Súmula da aula... Estrutura e função dos

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

MARCADORES MOLECULARES: AFLP E RFLP

MARCADORES MOLECULARES: AFLP E RFLP Universidade Federal de Pelotas Programa de Pós Graduação em Agronomia Disciplina de Biotecnologia Aplicada ao Melhoramento MARCADORES MOLECULARES: AFLP E RFLP Prof. PhD. Antonio Costa de Oliveira Gabriela

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Actividade prática: Constrói os teus Kits de Genética!

Actividade prática: Constrói os teus Kits de Genética! Actividade prática: Constrói os teus Kits de Genética! Mais uma vez vais vestir a tua bata de cientista e investigador e preparar o teu dia a dia no laboratório. Hoje é um dia especial, vais receber a

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Fases do ciclo celular O ciclo celular dos eucariotos está dividido em quatro fases separadas: M, G 1

Fases do ciclo celular O ciclo celular dos eucariotos está dividido em quatro fases separadas: M, G 1 CICLO CELULAR A vida das células é formada por dois períodos: INTÉRFASE: inicia no fim da mitose e estende até iniciar a próxima mitose. MITOSE: Reprodução celular, com as seguintes finalidades: Nos unicelulares:

Leia mais

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais

Bases da análise genômica: estado da arte

Bases da análise genômica: estado da arte Bases da análise genômica: estado da arte Cesar Martins cmartins@ibb.unesp.br Departamento de Morfologia Instituto de Biociências UNESP Universidade Estadual Paulista Botucatu, SP Avanços nas tecnologias

Leia mais

Clonagem Molecular Patricia H. Stoco Edmundo C. Grisard

Clonagem Molecular Patricia H. Stoco Edmundo C. Grisard Universidade Federal de Santa Catarina Centro de Ciências Biológicas Programa de Pós Graduação em Biotecnologia e Biociências Clonagem Molecular Patricia H. Stoco Edmundo C. Grisard Desenvolvimento da

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017 Princípios Básicos de Genética Molecular Parte II Profª Ana Claudia 17/02/2017 Estrutura do material genético Estrutura de Genomas e variabilidade Replicação Transcrição Tradução Regulação da Expressão

Leia mais

Bases da análise genômica: estado da arte

Bases da análise genômica: estado da arte Bases da análise genômica: estado da arte Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP Avanços nas tecnologias

Leia mais

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila DNA RNA 17/04/2017 Genes (ou Gen) é uma parte do DNA capaz de sintetizar uma proteína específica. O DNA (Ácido Desoxiribonucleico) é formado pela união de nucleotídeos. Fosfato Ribose Glicídio do grupo

Leia mais

Biologia Celular e Molecular:

Biologia Celular e Molecular: Disciplina: Biologia Celular e Molecular: Estrutura e Fisiologia da Célula Os Ácidos Nucleicos Os ácidos nucleicos são as maiores moléculas encontradas no mundo vivo e responsáveis pelo controle dos processos

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

Aula experimental 1: Reação da polimerase em cadeia (PCR), digestão, ligação e eletroforese em gel de agarose

Aula experimental 1: Reação da polimerase em cadeia (PCR), digestão, ligação e eletroforese em gel de agarose Bloco 1 Professor: Renato Carvalho Monitora: Luana Fé UNIVERSIDADE FEDERAL DO RIO DE JANEIRO CENTRO DE CIENCIAS DA SAÚDE FACULDADE DE FARMÁCIA DEPARTAMENTO DE BIOTECNOLOGIA FARMACÊUTICA Aula experimental

Leia mais

Kit de Clonagem Flex-C

Kit de Clonagem Flex-C Kit de Clonagem Flex-C Instruções de Uso DESCRIÇÃO O Kit de Clonagem Flex-C é altamente eficiente, rápido e de fácil uso para clonagem por PCR. A enzima Flex-C permite a clonagem direta de qualquer fragmento

Leia mais

A BIOLOGIA MOLECULAR NA PRODUÇÃO DE IMUNOBIOLÓGICOS

A BIOLOGIA MOLECULAR NA PRODUÇÃO DE IMUNOBIOLÓGICOS A BIOLOGIA MOLECULAR NA PRODUÇÃO DE IMUNOBIOLÓGICOS PRODUÇÃO DE INSUMOS BIOLÓGICOS GENE PLASMÍDEO HOSPEDEIRO TRANSCRIÇÃO - RNA TRADUÇÃO - PROTEÍNA PURIFICAÇÃO PLASMÍEO PADRÃO Amp R Ori Promotor Eco RI

Leia mais

AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR)

AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR) AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR) Beatriz Dantas Guimarães (1); Lucas Linhares de Locio (2); Herbert Crisóstomo dos Santos Araújo

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA GENÉTICA É a ciência que estuda a hereditariedade Estuda os gens, como eles transportam informações, são replicados e passados para as gerações subseqüentes de células ou transmitidos entre organismos

Leia mais

Clique para editar o estilo do título mestre

Clique para editar o estilo do título mestre sub 23/07/2014 1 23/07/2014 1 AU09 Estrutura título e Função mestre do Material Genético Nalini subtítulo Drieli Josviak mestre Doutorado drinaly@gmail.com 23/07/2014 2 23/07/2014 2 Material Genético:

Leia mais

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon.

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon. FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm

Leia mais

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down)

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Aplicações: IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Mapeamento genético e identificação: mapeamento de genes

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

DOGMA CENTRAL DA BIOLOGIA MOLECULAR

DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

Tecnologia do DNA Recombinante

Tecnologia do DNA Recombinante Aula de Bioquímica II Tema: Tecnologia do DNA Recombinante Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail:

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

7.012 Conjunto de Problemas 4

7.012 Conjunto de Problemas 4 Nome Seção 7.012 Conjunto de Problemas 4 Pergunta 1 Você está estudando a síntese do aminoácido triptofano em bactérias. As enzimas TrpA, TrpB, TrpC, TrpD, TrpE e AroH são essenciais para a síntese desse

Leia mais

Biotecnologia e Engenharia Genética

Biotecnologia e Engenharia Genética Biotecnologia e Engenharia Genética OBJETIVOS A biotecnologia é um conjunto de técnicas que utilizam seres vivos para a obtenção de produtos para uso humano. São práticas de melhoramento animal e vegetal

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula 26 Genética

Prof. Marcelo Langer. Curso de Biologia. Aula 26 Genética Prof. Marcelo Langer Curso de Biologia Aula 26 Genética MATERIAL GENÉTICO A primeira atividade é a de orientação do DNA para formar a proteína, que será responsável pela característica genética. DNA é

Leia mais

CATÁLOGO DE KITS DE EXTRAÇÃO

CATÁLOGO DE KITS DE EXTRAÇÃO CATÁLOGO DE KITS DE EXTRAÇÃO KITS DE EXTRAÇÃO BIOPUR A extração de DNA é o primeiro passo para diferentes procedimentos na Biologia Molecular. Este processo é parte fundamental para se obter alta eficiência

Leia mais

Transcrição e Processamento de RNA

Transcrição e Processamento de RNA Transcrição e Processamento de RNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Biologia Molecular Básica-Arnaldo Zaha Lenhinger Principles of Biochemistry

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Catálogo de Kits de Extração

Catálogo de Kits de Extração Catálogo de Kits de Extração Kits de Extração Biopur A extração de DNA é o primeiro passo para diferentes procedimentos na Biologia Molecular. Este processo é parte fundamental para se obter alta eficiência

Leia mais

Replicação do DNA. Prof. Edimar

Replicação do DNA. Prof. Edimar Replicação do DNA Prof. Edimar PRINCIPAIS ENZIMAS ENVOLVIDAS (SISTEMA DE REPLICAÇÃO DO DNA) 1. DNA Polimerases 2. Endonucleases 3. Helicases 4. Topoisomerases 5. Primases 6. Telomerases ENDONUCLEASES HELICASE

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais Tradução José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Tradução em eucarióticos e procarióticos Eventos pós transcricionais 1 Processo de síntese de proteínas mrna contém o código do gene trna

Leia mais

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula.

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula. Pergunta 1 Parte A Você está estudando um receptor chamado Receptor do Fator de Tamanho ou SF-R em um eucariota haplóide. Abaixo encontra-se um diagrama esquemático da proteína SF-R: A fim de ser localizado

Leia mais

Escolha de iniciadores. Cairé Barreto

Escolha de iniciadores. Cairé Barreto Cairé Barreto 2017 A replicação do DNA precisa de iniciadores para acontecer (PRIMASE) A DNA polimerase replica o DNA a partir de uma fita pré-existente (5 -> 3 ). Pequenos segmentos de RNA orientam a

Leia mais

Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS)

Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS) Universidade Estadual Paulista Júlio de Mesquita Filho Faculdade de Ciências Agrárias e Veterinárias Campus de Jaboticabal Introdução às Tecnologias de Sequeciamento: Sanger e Nova Geração (NGS) Dr. Camila

Leia mais

Replicação do DNA e Cromossomos

Replicação do DNA e Cromossomos Replicação do DNA e Cromossomos Características básicas da replicação do DNA In Vivo É semiconservativa, Inicia-se em origens únicas Geralmente é bidirecional a partir de cada origem de replicação. A replicação

Leia mais

PROGRAD / COSEAC Padrão de Respostas Biologia

PROGRAD / COSEAC Padrão de Respostas Biologia 1 a QUESTÃO: Cada vez mais a técnica da reação em cadeia da polimerase (PCR - polimerase chain reaction) tem sido utilizada no diagnóstico de doenças parasitárias. Por essa técnica, regiões específicas

Leia mais

Colégio XIX de Março Educação do jeito que deve ser

Colégio XIX de Março Educação do jeito que deve ser Colégio XIX de Março Educação do jeito que deve ser 2017 1ª PROVA SUBSTITUTIVA DE BIOLOGIA Aluno (a): Nº Ano: 2º Turma: Data: 16/05/2017 Nota: Professor(a): Regina Volpato Valor da Prova: 40 pontos Orientações

Leia mais

Ciclo Celular e Controle do Ciclo Celular

Ciclo Celular e Controle do Ciclo Celular Ciclo Celular e Controle do Ciclo Celular Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Profa. Dra. Ester Tartarotti MSc. Rita Luiza Peruquetti Divisão Celular Deve ser regulada e Coordenada Ciclo

Leia mais

Prof. Dr. Bruno Lazzari de Lima. Replicação do DNA

Prof. Dr. Bruno Lazzari de Lima. Replicação do DNA Prof. Dr. Bruno Lazzari de Lima Replicação do DNA Introdução Sistemas vivos tem a capacidade de fazer cópias de si mesmos. Capacidade associada ao material genético hereditário. Compreensão do processo

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011 BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011 (Duração: 1,5 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

2 Contexto Biológico Genômica

2 Contexto Biológico Genômica 15 2 Contexto Biológico Neste capítulo abordaremos o contexto biológico para o entendimento deste trabalho. Serão abordados os aspectos gerais da genômica, expostos os processos do sequenciamento genético

Leia mais

Resumo - capítulo 7. Pedro Ivo Gomes de Faria

Resumo - capítulo 7. Pedro Ivo Gomes de Faria Resumo - capítulo 7 Pedro Ivo Gomes de Faria Sumário 1 Capítulo 7 - Tecnologia do DNA recombinante 2 1.1 Fragmentação, separação e sequenciamento de moléculas de DNA................................ 2 1.2

Leia mais