03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: )."

Transcrição

1 DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: ). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração de raios X de Rosalind Frandlin e Maurice Wilkins e em estudos químicos da molécula. 1. Unidade da molécula de DNA: nucleotídeos iii. Bases nitrogenadas Adenina (A) Guanina (G) Timina (T) Citosina (C) Purinas Pirimidinas ii.fosfato (para a base) Nucleotídeos Nucleosídeo i. Pentose (desoxirribose) 2. DNA fita simples: ligação fosfodiéster, sentido DNA fita simples: cadeia polinucleotídica Fosfato (para a base) Arcabouço açúcar - fosfato Bases Pentose (desoxirribose) ligação fosfodiéster Ligação fosfo-diéster base Direção 5 3 1

2 3. Molécula de DNA fita dupla: Estrutura primária Pareamento específico de bases por pontes de H: A-T, G-C; Estrutura dupla fita do DNA: - complementaridade T A C G Complementaridade Grupos ceto (C=O) de T, C e G e amino (C NH 2 ) de A, C e G. 3. Molécula de DNA fita dupla: Estrutura primária Estrutura dupla fita do DNA: - antiparalelismo 5 3 Direcionalidades opostas: 5 3 e 3 5. Antiparalelismo 3 5 A estrutura primária + características favorecem o giro de uma fita sobre a outra 4. Dupla hélice: estrutura secundária do DNA 4. Molécula de DNA dupla hélice Estrutura Secundária Estrutura primária Estrutura secundária 2

3 Ácido ribonucléico (RNA) - Ácido ribonucléico (RNA) i) Bases nitrogenadas A=U C=G Adenina (A) Purinas Guanina (G) Uracil (U) Citosina (C) Pirimidinas ii) Fosfato (para a base) iii. Pentose (ribose) Tipos de RNA na célula: mrna (mensageiro) DNA (RNA) Genoma trna (transportador) rrna (ribossômico) 5... ATCGGAAACGTGGCCTATGCTTGCAACCT TAGCCTTTGCACCGGATACGAACGTTGGA... 5 Importantes no processo de síntese de proteínas (tradução). Informação genética Genoma Material genético de qualquer célula, seja ela procariótica ou eucariótica, que guarda toda a informação necessária para a sobrevivência, desenvolvimento e reprodução do organismo. Ou seja, a informação genética total de um organismo, armazenada no DNA (ou RNA) de sua ou suas células. Quantidade de DNA no genoma haplóide humano: ~ 3 bilhões pb Como este genoma está organizado na célula??? 3

4 Genoma humano Genoma nuclear Genoma mitocondrial Genoma nuclear - DNA fita dupla linear - uma cópia/célula - genes necessários ao funcionamento celular - existência de grandes porções de seqüências sem função conhecida, incluindo repetições - complexo Genoma nuclear: compactação Genoma (DNA) nuclear: cromossomos OBS: Tamanho do cromossomo e outros fragmentos de DNA em pares de base (pb), e unidades de medida usuais Organização do genoma nuclear humano: ~ 3Mb ~ genes Exemplo: Cromossomo 1: 246 Mb Gene da fibrose cística: 250 kb 4

5 1) Sequências únicas ou pouco repetidas (gênicas ou extragênicas) DNA codificador ou genes propriamente ditos seqüências regulatórias e intragênicas pseudogenes Genes: conceito clássico Porção do DNA que controla uma característica hereditária discreta, usualmente uma proteína ou RNA (Alberts e cols., 2002) regiões com função desconhecida (extragênicas)??? Estrutura do gene eucariótico típico: introns e exons Tamanho dos genes, exons e introns: ex. no genoma humano: Upstream (anterior) Downstream (posterior) % exons Componentes dos genes: exons (codificador), introns (não codificador), regiões regulatórias (promotor, 5, 3 ), regiões transcritas mas não traduzidas (UTRs) Genes humanos mostram uma grande variação de tamanho e da proporção relativa entre exons e introns. Organização do genoma nuclear humano: 2) DNA repetitivo: moderadamente repetitivo ( cópias/genoma) altamente repetitivo (> 10 5 cópias/genoma) DNA não codificador seqüências curtas idênticas ou similares em tandem (agrupado) ou dispersas pelo genoma 5

6 DNA repetitivo em tandem (altamente repetitivo) Exemplo de DNA repetitivo em tandem: Microssatélites GCATGGATTTCAAACGGTG... Unidade de repetição 1-4 pares de base: microssatélites 5-50 pares de base: minissatélites maiores: satélites - seqüências de 1 a 4pares de bases; - também chamados de STRs (repetições curtas em tandem); - repetições de mononucleotídeos (A, T) e dinucleotídeos (com exceção de GC) são os mais comuns; - repetições de tri e tetranucleotídeos são mais raros: potencial patogênico. Exemplo: microssatélites Qual a importância destas seqüências? - O tamanho da unidade de repetição, o número de repetições e as combinações possíveis são extremamente variáveis entre os indivíduos, tornando-os únicos: importância em medicina forense, determinação de paternidade e mapeamento genético (DNA fingerprint). Qual a importância destas seqüências? Ex: determinação de paternidade (vários locos de microssatélites) Ex: investigação criminal 6

7 Distribuição do DNA repetitivo no genoma nuclear humano: OBS: Elementos repetitivos em genes humanos: 3) Situações intermediárias: repetições, agrupamentos e famílias gênicas Famílias gênicas conceito componentes (genes e pseudogenes) necessidade de grande quantidade de produto necessidade de diferentes produtos ao mesmo tempo especialização de/em determinada função diferentes tipos de famílias, conforme a similaridade dos seus componentes e produtos por eles codificados * localizam-se tanto em agrupamentos como dispersos pelo genoma, ou em situação intermediária * * Extremamente relacionados com a função Famílias gênicas: exemplos de famílias Globinas Genes das globinas em humanos: 2 cópias 1 cópia HbA Expressos na ordem do desenvolvimento... 7

8 Expressão das hemoglobinas ao longo do desenvolvimento humano: Genes de RNAs ribossômicos Hb Gower 1 ( 2 2 ) Hb Gower 2 ( 2 2 ) Portland ( 2 2 ) HbF ( 2 2 ) HbA ( 2 2 ) HbA 2 ( 2 2 ) 200 cópias no genoma humano: cromossomos 13, 14, 15, 21 e 22; gene para rrna 5S: ~2000 cópias no cromossomo 1. Genoma mitocondrial - DNA circular - várias cópias/célula - genes relacionados às funções mitocondriais - ~93% codificador - pouquíssima ocorrência de porções de seqüências sem função conhecida (como repetições) - simples Genoma mitocondrial Genoma nuclear X genoma mitocondrial 8

9 Funções do Genoma Humano DNA Genoma * Como a informação genética contida no DNA se transforma em organismos? DNA RNA proteína Função principal do genoma humano: - converter a informação genética armazenada na seqüência de bases do DNA em todas as proteínas e outros componentes necessários para a sobrevivência, desenvolvimento e reprodução do organismo (expressão gênica), e perpetuar esta informação (replicação). Manutenção e fluxo da informação genética através de 3 processos fundamentais: - Replicação - Transcrição - Síntese protéica (Tradução) Manutenção e fluxo da informação genética! 9

10 Quando ocorre a duplicação do DNA? 1. Replicação ou duplicação do DNA Fase S do ciclo celular Processo pelo qual todo o DNA da célula se duplica, para originar uma célula nova Características do processo: - adequação ao ciclo celular - rapidez -fidelidade (enzimas com atividade - exonucleásica) - simultaneidade Manutenção e fluxo da informação genética através de 3 processos fundamentais: - Replicação - Transcrição - Tradução Transcrição: formação de uma molécula fita simples de RNA a partir de uma molécula dupla fita de DNA. Segue regras de complementaridade e antiparalelismo 2. Transcrição reflete o estado fisiológico da célula extremamente variável Síntese no sentido 5 3 (DNA molde 3 5 ) 10

11 Transcrição Transcrição: DNA Fita molde Fita codificante rrna estrutural ribossomos DNA mrna proteínas RNA 5 3 trna acoplador transportador Transcrição em genes de proteínas nos eucariotos: Iniciação: Promotor promotor região transcrita Cascata de fatores (upstream) (downstream) + RNAP Complexo de iniciação Unidade de transcrição mrna primário: exons, introns, regiões 5 e 3 UTR Nível basal Alongamento: Terminação ATG AATAAA 5 3 Bolha de transcrição - região consenso no DNA molde (3 TTATTT 5 ) - clivagem (corte) 11

12 Resumo: AAUAAA Produtos da transcrição DNA mrna Proteína transcrição pré-mrna exons, introns, regiões 5 e 3 UTR processamento mrna Capping cap 5' 3. Processamento Capping Poliadenilação Splicing -Importante para a tradução do mrna: sítio de reconhecimento dos ribossomos - Facilita o transporte do núcleo para o citoplasma - Protege a extremidade 5 do mrna Poliadenilação - cauda poli A mrna após transcrição, capping e poliadenilação: - Protege a extremidade 3 do mrna - Facilita o transporte do núcleo para o citoplasma - Facilita a tradução: reconhecimento pela maquinaria ribossômica * mrna imaturo, quase pronto 12

13 Splicing DNA molde Pré-mRNA Relação DNA-mRNA maduro: Intron Produtos da transcrição 4. Código Genético e tradução (síntese protéica) DNA mrna Proteína transcrição tradução pré-mrna exons, introns, regiões 5 e 3 UTR processamento mrna cap5, exons, regiões 5 e 3 UTR, cauda poli-a Proteínas: formadas por 20 aminoácidos diferentes. A informação genética é estocada no DNA por meio de um código (o código genético). Genoma 5... ATCGGAAACGTGGCCTATGCTTGCAACCT TAGCCTTTGCACCGGATACGAACGTTGGA

14 Como??? Como a seqüência de bases do DNA é codificada nos 20 aa diferentes e apenas 4 bases diferentes de DNA aminoácidos da proteína Em qualquer posição existem 4 possibilidades (A, T, C, G) 4 n = combinações possíveis 4 2 = 16 aa diferentes 4 3 = 64 combinações 3 bases (códon) = 1 aminoácido Características do código genético Tradução: síntese protéica propriamente dita; processo pelo qual o mrna fornece um molde para a síntese de um polipeptideo. Necessita dos diferentes tipos de RNA. Universalidade Especificidade Redundância mrna: leva a informação genética do DNA ao citoplasma, onde serve de molde, sendo lido em códons. DNA trna: traz o aminoácido e interpreta cada códon atraves do anticódon (pareamento baseado nas regras de complementaridade mrna 5 3 anticódon 14

15 rrna: expõe cada códon do mrna para o trna, fornecendo o local para a tradução. Iniciação: Alongamento: Terminação: Dogma central da biologia molecular 15

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição DNA e Cromossomos Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição Ácidos nucléicos Formado por nucleotídeos: uma base nitrogenada ligada a uma ribose ou desoxirribose e um ou mais grupos

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas FICHA (IN)FORMATIVA Nº 1 Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas Ácidos nucleicos Os ácidos nucleicos armazenam e transmitem a informação hereditária.

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2016 PROFESSOR: Fred DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: - É fundamental

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Biologia Molecular. Indústria de Informação

Biologia Molecular. Indústria de Informação Biologia Molecular Indústria de Informação A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA- Proteínas Os Operários Proteínas Erros de Programação Doenças 2 1 Biologia Molecular Retrata

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR. Prof.: Anderson Marques de Souza 2016

ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR. Prof.: Anderson Marques de Souza 2016 ÁCIDOS NUCLEICOS E BIOLOGIA MOLECULAR Prof.: Anderson Marques de Souza 2016 Hereditariedade sem identidade os fatores de Mendel Em 1865, Mendel apresenta seus trabalhos sobre a hereditariedade. Em 1900

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS Unidade básica dos Ácidos Nucleicos Existem apenas 4 bases em cada um dos ácidos nucleicos DNA DNA e RNA RNA Ácido fosfórico Ácido fosfórico Pentose Desoxirribose

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA Aula teórica 4 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br FUNÇÃO DO MATERIAL GENÉTICO 1. Função genotípica:

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

CAPÍTULO 1: Pré-Mendelismo e Genética Mendeliana

CAPÍTULO 1: Pré-Mendelismo e Genética Mendeliana CAPÍTULO 1: Pré-Mendelismo e Genética Mendeliana Prof. João Biologia I Prof. João O DNA Cromossomo DNA: Ácido Desoxirribonucleico (em inglês deoxyribonucleic acid). É encontrado organizado sob a forma

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme NÚCLEO CELULAR Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme A presença do núcleo é a principal característica que distingue a célula eucariótica da procariótica. No núcleo está

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Nucleotídeos e Ácidos Nucléicos

Nucleotídeos e Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO Escola de Engenharia de Lorena EEL Programa de Aperfeiçoamento de Ensino - PAE Nucleotídeos e Ácidos Nucléicos Angela da Silva Machado Súmula da aula... Estrutura e função dos

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS META Introduzir o estudo das funções biológicas, propriedades químicas e estruturas dos nucleotídeos. OBJETIVOS Ao final desta aula,

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes.

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 1ª Série

Leia mais

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira Faculdade de Tecnologia de Araçatuba Curso Superior de Tecnologia em Bioenergia Sucroalcooleira 1 ÁCIDOS NUCLÉICOS Estrutura e funções 2 Ácidos nucléicos são polímeros de nucleotídeos adenina citosina

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin Organização Gênica de Eucariotos Prof. Odir A. Dellagostin Classificação dos seres vivos Domínio Eukarya Reinos Protistas (protozoários e leveduras) Fungi (fungos) Plantae (vegetais) Animalia (animais)

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

NÚCLEO e DIVISÃO CELULAR

NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

Estudo Dirigido Sequenciamento de DNA

Estudo Dirigido Sequenciamento de DNA Estudo Dirigido Sequenciamento de DNA Professores Dra. Daniela Alves Silvestre OBJETIVOS Compreender a partir do estudo da técnica de sequenciamento do DNA através da utilização de didesoxinucleotídeos,

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais