IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri"

Transcrição

1 IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri

2 RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar Pode ocorrer tanto no núcleo como no citoplasma

3

4 GENE - PROTEÍNA DNA - Proteína

5 Transcrição A informação não é passada diretamente do DNA para proteína A transcrição do DNA produz uma molécula de RNA de cadeia simples que é complementar apenas a uma das cadeias de DNA

6 TRANSCRIÇÃO DO DNA Processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA fita dupla; Processo bastante variável para atender as necessidades fisiológicas da célula; Apenas uma das fitas é utilizada como molde para a síntese do RNA (fita molde direção 3 5 ). A outra fita é idêntica à fita de RNA sintetizada (fita codificadora direção 5 3 ), com a substituição de T por U;

7 Fitas molde e codificadora

8 Controle da transcrição O processo é catalisado pela enzima RNA polimerase RNA polimerase: não tem autonomia para iniciar a transcrição. É necessário que existam sequências promotoras e fatores de transcrição agindo em conjunto para o início da transcrição.

9 TRANSCRIÇÃO DO DNA INÍCIO Reconhecimento de sequências específicas no DNA ALONGAMENTO Incorporação dos ribonucleotídeos TERMINAÇÃO Sequências no DNA são reconhecidas e a síntese é interrompida

10 INÍCIO DA TRANSCRIÇÃO O DNA apresenta sequências específicas, denominadas PROMOTORES, que sinalizam exatamente onde a síntese do RNA deve ser iniciada; São sequências de 100 a 200 nucleotídeos próximos ao sítio de início da transcrição; Os promotores são, primeiramente, reconhecidos por fatores de transcrição que, ligados ao DNA, interagem com outros fatores, formando um complexo ao qual a RNA polimerase se associa; A RNA polimerase liga-se frouxamente à dupla fita de DNA e reconhece o promotor.

11 Uma unidade transcricional é uma porção de DNA transcrita numa única molécula de RNA (transcrito primário), começando no promotor e acabando no terminador.

12 Transcrição: Sinais de iniciação e finalização

13 INÍCIO DA TRANSCRIÇÃO No promotor, 2 sequências são altamente conservadas: a -10 (TATAAT) e a -35 (TTGACA), as quais separam-se por, aproximadamente 17 nucleotídeos; O primeiro nucleotídeo a ser transcrito é geralmente uma purina A ou G; A região -10 recebe o nome de TATAbox; Elementos enhancer ou amplificadores são sequências pequenas de DNA que podem ocorrer na região 5 do gene, as quais ativam a expressão do mesmo.

14 INÍCIO DA TRANSCRIÇÃO A holoenzima RNA polimerase liga-se especificamente nas regiões -10 e -35 em uma das faces da dupla fita (fita molde). Essa ligação ocorre na cavidade maior do DNA, onde as bases estão acessíveis a proteínas.

15

16 INÍCIO DA TRANSCRIÇÃO Após a ligação da RNA polimerase, forma-se o complexo de iniciação da transcrição; O complexo abre-se formando a bolha de transcrição; Essa abertura ocorre na região -10 (TATAbox) a qual é rica em AT.

17 RNA polimerase e a bolha transcricional

18 O molde é local Genes podem ser transcritos utilizando uma das fitas de DNA como molde, enquanto outros podem utilizar a outra fita do DNA. A escolha da fita molde depende da localização e orientação do promotor

19 TRANSCRIÇÃO DO DNA RNA informacional: RNA mensageiro. Sempre é codificado em polipeptídeos pela tradução; RNA funcional: nunca são traduzidos em polipeptídeos e sua ação é puramente no nível de RNA. Ex: trna, rrna, e outros pequenos RNA's; Síntese do RNA: RNA polimerase + ribonucleosídeos trifosfatados.

20 Estrutura do DNA e Expressão Gênica Expressão Gênica Diferencial: Músculo cardíaco Figado Neurônios

21 RNA POLIMERASE - EUCARIOTOS RNA polimerase I localizada no nucléolo e responsável pela síntese do RNA ribossômico; RNA polimerase II localizada no nucleoplasma e responsável pela síntese do RNA mensageiro; RNA polimerase III também localizada no nucleoplasma e responsável pela síntese do RNA transportador.

22 Expressão gênica em Eucariotos

23 E onde fica o RNA? É feito no núcleo e depois vai para o citoplasma Mas procarioto não tem núcleo... Por isso se diz que sua transcrição é acoplada com a tradução

24

25 Eucariotos O RNA vai para o citoplasma

26 TÉRMINO DA TRANSCRIÇÃO Quando a RNA polimerase encontra o sítio de terminação na fita molde, ela se desliga do DNA juntamente com a nova cadeia de RNA sintetizada devido à uma desestabilização do complexo de transcrição; O desligamento do RNA do sistema provoca a ruptura do complexo de transcrição e as fitas do DNA são renaturadas.

27 TÉRMINO DA TRANSCRIÇÃO Em procariotos a região terminadora apresenta uma longa sequência de A na fita molde. A RNA polimerase, ao longo do pareamento AU (mais fraco) desestabiliza o híbrido DNA:RNA e o DNA é renaturado; Em eucariotos, as 3 RNAs polimerases terminam a síntese em regiões de DNA ricas em T.

28 ATIVIDADES PÓS- TRANSCRICIONAIS Em procariotos, logo após o RNA ser liberado da bolha de transcrição, os ribossomos se ligam e iniciam a tradução; Em eucariotos, os RNAs sintetizados no núcleo durante o processo de transcrição são chamados de transcritos primários (hnrna); Na maioria das vezes, esses transcritos não representam a molécula madura, ou seja, aquela cuja sequência e estrutura correspondem à forma final do RNA funcional (mrna); Esses transcritos necessitam sofrer modificações que fazem parte do processamento do RNA.

Transcrição e Processamento de RNA

Transcrição e Processamento de RNA Transcrição e Processamento de RNA Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Biologia Molecular Básica-Arnaldo Zaha Lenhinger Principles of Biochemistry

Leia mais

DOGMA CENTRAL DA BIOLOGIA MOLECULAR

DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

Profa. Dra. Viviane Nogaroto

Profa. Dra. Viviane Nogaroto ESTRUTURA DO GENE GENE: Região do DNA capaz de ser transcrita a fim de produzir uma molécula de RNA funcional ou uma proteína -inclui sequências codificadoras e regulatórias transcrição tradução DNA RNA

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Genética de microrganismos Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Piracicaba, outubro 2014 Histórico 1868- Primeiro a estudar o núcleo

Leia mais

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA TRANSCRIÇÃO - Pontos Principais: Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA A transcrição é realizada por enzimas

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Transcrição e Processamento

Transcrição e Processamento transcrição do DNA maturação do RNA AAAA AAAA AAAA tradução em proteína NÚCLEO CITOPLASMA Transcrição e Processamento RNAs adotam estruturas terciárias complexas RNA carregado RNA transportador aminoácido

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos?

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos? O que significam as siglas? R: Ácido desoxirribonucleico. A molécula de tem mensagens codificadas em sequências de que contêm bases púricas e pirimídicas. R: nucleótidos Qual o nome das bases pirimídicas?.

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Sumário. A Transcrição do DNA

Sumário. A Transcrição do DNA Sumário A Transcrição do DNA A expressão dos genes: do DNA à proteína. Unidade transcricional. RNA: estrutura química e estrutura secundária. Transcrição do DNA: o enzima RNA polimerase. Fases da transcrição.

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon.

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon. FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA CÉLULAS Células são estruturas complexas e diversas; São capazes de autoreplicação; Realizam uma ampla variedade de papeis especializados em organismos multicelulares:

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP:

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP: Ácidos Nucleicos: Nucleotídeos, DNA e RNA Bianca Lobão - nº USP: 9370841 Caio Lourenço - nº USP: Giulia Santos - nº USP: 9370726 Nucleotídeos Compõem a estrutura das moléculas de DNA e RNA; São compostos

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017 Princípios Básicos de Genética Molecular Parte II Profª Ana Claudia 17/02/2017 Estrutura do material genético Estrutura de Genomas e variabilidade Replicação Transcrição Tradução Regulação da Expressão

Leia mais

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação.

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação. Organização estrutural e funcional do núcleo DNA RNA Proteínas Replicação Transcrição Processamento (Splicing) Tradução (citoplasma) Cromatina - Eucromatina - Heterocromatina Cromossomo - Mitose 1 DNA

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais

REVISÃO LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA. Aula 2

REVISÃO LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA. Aula 2 REVISÃO LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA Aula 2 LGN0232 Genética molecular Maria Carolina Quecine Departamento de Genética mquecine@usp.br O QUE EXISTE EM COMUM ENTRE OS ORGANISMOS? O QUE FAZ UM

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética Prof. Marcelo Langer Curso de Biologia Aula 16 Genética FUNCIONAMENTO DO GENE Um gene não funciona em todas as células, mas somente em um tipo de célula, onde tem relação à sua função. Isso ocorre devido

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA E CONTROLE DA EXPRESSÃO GÊNICA

LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA E CONTROLE DA EXPRESSÃO GÊNICA LEMBRANDO O DOGMA CENTRAL DA BIOLOGIA E CONTROLE DA EXPRESSÃO GÊNICA O QUE EXISTE EM COMUM ENTRE OS ORGANISMOS? O QUE FAZ UM ORGANISMO DIFERENTE DO OUTRO? TODOS VIERAM DE UM MESMO ANCESTRAL COMUM A MAQUINARIA

Leia mais

Núcleo. Vera Andrade Robert Brown (1833) descreveu o núcleo celular

Núcleo. Vera Andrade  Robert Brown (1833) descreveu o núcleo celular Vera Andrade http://histologiavvargas.wordpress.com/ Núcleo Robert Brown (1833) descreveu o núcleo celular Nux (grego) = semente, por ser considerado tão importante para a célula quanto a semente é para

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Transcrição Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica.

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. O processo de síntese de RNA, a partir de um molde de DNA, é denominado

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 Introdução a Biologia i Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Corpo Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

Sociedade, Tecnologia e Ciência. DR1 - O Elemento, Graça Mendonça. Núcleo Gerador 7 DNA

Sociedade, Tecnologia e Ciência. DR1 - O Elemento, Graça Mendonça. Núcleo Gerador 7 DNA DNA Trabalho realizado por: Rafael Lourenço Fábio Rodrigues Miguel Almeida Rodrigo Sambento 1 á g i n a Índice INTRODUÇÃO... 3 DNA... 4 Organização do DNA na célula... 4 Elementos básicos dos ácidos nucleicos...

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais Tradução José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Tradução em eucarióticos e procarióticos Eventos pós transcricionais 1 Processo de síntese de proteínas mrna contém o código do gene trna

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Regulação gênica em Eucariotos. Prof. Dr. Marcelo Ricardo Vicari

Regulação gênica em Eucariotos. Prof. Dr. Marcelo Ricardo Vicari Regulação gênica em Eucariotos REGULAÇÃO GÊNICA Neurônio e célula de fígado: células de um mesmo indivíduo e que contêm a mesmo genoma REGULAÇÃO GÊNICA Diferenciação celular 1973 REGULAÇÃO GÊNICA Dolly:

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

Fluxo da informação genética

Fluxo da informação genética UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE GENÉTICA E BIOLOGIA MOLECULAR Fluxo da informação genética Profa. Dra. Nívea Macedo DNA 5 3 Do DNA ao RNA A estrutura

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

GOIÂNIA, / / PROFESSOR: Mário Neto. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Mário Neto. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2017 PROFESSOR: Mário Neto DISCIPLINA: Ciências da natureza SÉRIE: 3º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Aula 2 biologia molecular

Aula 2 biologia molecular Aula 2 biologia molecular Processo de cópia de uma molécula de DNA em duplas moléculas filhas Este processo ocorre a cada fase S do ciclo celular Apresenta processos gerais e particularidades entre procariotos

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

Aula 6: Síntese protéica

Aula 6: Síntese protéica Aula 6: Síntese protéica 3 RNAs são necessários para efetuar a síntese protéica: mrna (RNA mensageiro) processado: carrega a informação (ou seja, a seqüência de bases) para a sintese da proteina rrna

Leia mais

DNA, Cromossomos e Replicação. Capítulos 5 e 6 (pág ) - Fundamentos da Biologia Celular - Alberts- 2ª edição

DNA, Cromossomos e Replicação. Capítulos 5 e 6 (pág ) - Fundamentos da Biologia Celular - Alberts- 2ª edição DNA, Cromossomos e Replicação Capítulos 5 e 6 (pág 199-210) - Fundamentos da Biologia Celular - Alberts- 2ª edição Ácidos ribonucléicos DNA e RNA Formado por nucleotídeos: uma base nitrogenada ligada a

Leia mais

MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA

MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA UNIVERSIDADE ESTADUAL DA BAHIA - UNEB DEPARTAMENTO DE CIÊNCIAS DA VIDA DCV MED049 - BIOLOGIA E BIOQUIMICA MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA Polyanna Carôzo 2016 Replicação Transcrição Tradução

Leia mais

Biologia Celular e Molecular:

Biologia Celular e Molecular: Disciplina: Biologia Celular e Molecular: Estrutura e Fisiologia da Célula Os Ácidos Nucleicos Os ácidos nucleicos são as maiores moléculas encontradas no mundo vivo e responsáveis pelo controle dos processos

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

Genes e Genomas Procarióticos

Genes e Genomas Procarióticos Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular Genes e Genomas Procarióticos Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Clique para editar o estilo do título mestre

Clique para editar o estilo do título mestre sub 23/07/2014 1 23/07/2014 1 AU09 Estrutura título e Função mestre do Material Genético Nalini subtítulo Drieli Josviak mestre Doutorado drinaly@gmail.com 23/07/2014 2 23/07/2014 2 Material Genético:

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

DNA, cromossomos e organização dos genes do genoma

DNA, cromossomos e organização dos genes do genoma DNA, cromossomos e organização dos genes do genoma Profa. Dra. Aline Maria da Silva Instituto de Química- USP Bibliografia: Genes VII - Benjamin Lewin Lenhinger Principles of Biochemistry (3a. Ed.) Genoma

Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

Sistemas de controle da transcrição gênica. Procariotos

Sistemas de controle da transcrição gênica. Procariotos Sistemas de controle da transcrição gênica Procariotos Controle Positivo e Negativo: Há dois tipos de controle transcricional: Controle negativo: no qual uma proteína reguladora atua como um repressor

Leia mais

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down)

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Aplicações: IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Mapeamento genético e identificação: mapeamento de genes

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais