AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren"

Transcrição

1

2 AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN

3 Resumo Introdução: revisão transcrição e tradução Regulação da expressão gênica em procariontes Regulação da expressão gênica em eucariontes Exercícios.

4 A base molecular da informação genética

5 Compactação do material genético (eucariontes) DNA + proteínas (histônicas e não histônicas) =

6 Heterocromatina x Eucromatina Heterocromatina: Mais condensada Transcricionalmente inativa Eucromatina: Menos condensada Trancricionalmente ativa

7 DNA RNA PROTEíNA

8 Gene Definição molecular: sequência completa de nucleotídeos necessária e suficiente para a síntese de um polipeptídeo ou de uma molécula de RNA estável. Composição: Regiões reguladoras (promotor, terminador,...) Região codificadora a montante a jusante

9 TRANSCRIÇÃO

10

11 RNA polimerase 5 3

12 Fases da transcrição Reconhecimento do promotor Iniciação Alongamento Terminação

13 TRANSCRIÇÃO EM PROCARIOTOS

14 Procariotos Transcrição e tradução simultâneas Subunidades da RNA polimerase (E. coli): Núcleo da enzima: α, β e β Reconhecimento do promotor: σ

15 Iniciação Ligação do fator σ (reconhecimento de promotores de genes bacterianos) Dissociação do fator σ (libera a RNA polimerase para o início da transcrição)

16 TRANSCRIÇÃO EM EUCARIOTOS

17 Transcrição Transcrição e tradução ocorrem em compartimentos distintos As histonas de desligam e depois voltam a se associar

18 RNA-polimerases: RNA-Pol II mrnas e snrnas RNA-Pol III trna e 5S rrna e snrnas Fatores de transcrição: ligam-se ao promotor e a regiões regulatórias formando complexos de iniciação. Fatores gerais: necessários para a expressão de todos os genes transcritos pela RNApol. Fatores específicos: expressão de proteínas célulaespecíficas.

19 Processamento do pré-mrna em mrna CAP 2. Adição da cauda poli(a) 3. Splicing (Encadeamento)

20 TRADUÇÃO

21 Tradução

22 Código genético

23 Estrutura secundária do trna (esquerda) e tradução (abaixo). P A

24 Fases da tradução 1. Iniciação 2. Alongamento 3. Terminação

25 REGULAÇÃO DA EXPRESSÃO GÊNICA

26 Por quê a expressão gênica deve ser regulada? Adaptação ao ambiente Diferenciação celular em organismos multicelulares

27 Em quais etapas a regulação da expressão gênica atua? Níveis de controle da expressão gênica: Modificações da cromatina Transcricão Modificações pós-transcricionais Degradação do mrna Tradução Atividade protéica

28

29 REGULAÇÃO DA EXPRESSÃO GÊNICA EM PROCARIOTOS

30 Regulação da expressão gênica em procariotos Estado basal: ON Regulação depende das condições nutricionais e físicas do meio externo. Maioria das proteínas regulatórias são negativas Fatores sigma alternativos

31 Padrões de expressão gênica Expressão constitutiva: genes housekeeping (manutenção da função celular básica da célula). Ex.: proteínas ribossômicas. Indução: Aumento da expressão em resposta a um sinal. Ex.:catabolismo da lactose Repressão: Diminuição da expressão em resposta a um sinal. Ex.: biossíntese de aminoácidos.

32 Regulação da transcrição

33 Operons Uma característica comum dos genes procarióticos é sua organização em operons. Operon: unidade funcional do genoma, na qual dois ou mais genes que codificam produtos com funções relacionadas ocupam posições adjacentes e estão sob o controle de uma única região reguladora.

34 Operon lac

35 Operon lac: controle negativo Ausência da lactose Presença da lactose

36 Operon lac: controle positivo A glicose é preferencialmente utilizada como fonte de energia pela E. coli. Quando os níveis de glicose diminuem, há um aumento do camp, que se se liga à CAP (proteína ativadora de catabólito) levando a sua ativação e ligação na sequencia alvo do DNA e ativando a transcrição.

37 REGULAÇÃO DA EXPRESSÃO GÊNICA EM EUCARIOTOS

38 Regulação da expressão gênica em eucariotos Estado basal: OFF Regulação temporal e espacial Os eucariotos são menos sensíveis às alterações externas. Os hormônios são importantes reguladores da expressão gênica.

39 Principais níveis de controle 1. Modificações da cromatina 2. Transcricão 3. Modificações pós-transcricionais 4. Degradação do mrna 5. Tradução 6. Modificações pós-traducionais

40 Ativação da transcrição 1. Modificações da cromatina (regulação epigenética)

41 Ativação da transcrição 2. Início da transcrição (RNApol II) Ligação de fatores de transcrição gerais a elementos proximais do promotor. Ligação de fatores específicos a acentuadores, intensificadores, reforçadores ou enhancers em eucariotos superiores ou a UAS (sequências ativadoras a montante) em leveduras.

42

43 Sistema GAL em leveduras Sistema modelo para o estudo da ativação transcricional em eucariotos. Na presença de galactose e ausência de glicose, os genes GAL são expressos. A proteína Gal4 regula vários genes do metabolismo da galactose através da ligação à UASs.

44 Ausência de galactose Promotor inativo Presença de galactose Promotor ativo

45 Exercícios 1) A partir da fita de DNA abaixo, crie a fita complementar e o mrna, indicando suas orientações: 5 ATT CAG CGC GTA GCT GAT 3 senso 2) Qual das seguintes estruturas é compartilhada por procariotos e eucariotos: a) Íntrons b) Cap 5 c) Fator sigma d) Cauda polia e) Promotores 3) Desenhe um gene eucarioto e um operon procarioto, indicando suas principais estruturas.

46 Respostas 1) A partir da fita de DNA abaixo, crie a fita complementar e o mrna, indicando suas orientações: 5 ATT CAG CGC ATA GCT GAT 3 senso (codificadora) 3 TAA GTG GCG TAT CGA CTA 5 anti-senso (molde) 5 AUU CAG CGC AUA GCU GAU 3 mrna 2) Qual das seguintes estruturas é compartilhada por procariotos e eucariotos: a) Íntrons (eucariotos) b) Cap 5 (eucariotos) c) Fator sigma (procariotos) d) Cauda polia (eucariotos) e) Promotores (eucariotos e procariotos)

47 Respostas 3) Desenhe um gene eucarioto e um operon procarioto, indicando suas principais estruturas.

48 Referências GRIFFITHS, A.J.F. et al. Introdução à Genética. Ed. Guanabara-Koogan, Rio de Janeiro, ZAHA, A. et al. Biologia Molecular Básica. Ed. Mercado aberto, Porto Alegre, ALBERTS, B. Biologia Molecular da Célula. Artmed, Porto Alegre, PHILLIPS, T. & HOOPES, L. Transcription factors and transcriptional control in eukaryotic cells. Nature Education, 2008, 1(1):119.

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO?

COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO? COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO? DIFERENTES TIPOS DE CÉLULAS NUM MESMO ORGANISMO DIFEREM DRAMÁTICAMENTE LINFÓCITOS NEURÔNIO É POSSÍVEL ATÉ OBTER UM NOVO ORGANISMO A

Leia mais

O Dogma Central da Biologia Molecular (Crick, em 1956) Transferência linear da Informação Genética

O Dogma Central da Biologia Molecular (Crick, em 1956) Transferência linear da Informação Genética Transcrição O Dogma Central da Biologia Molecular (Crick, em 1956) Transferência linear da Informação Genética Os genes (DNA) para serem expressos precisam passar por 2 etapas A Transcrição e a Tradução

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva Controle da expressão gênica Prof. Dr. José Luis da C. Silva Controle da Expressão gênica Procariotos Princípios da regulação gênica Organismos procariontes e eucariontes são sensíveis à pequenas variações

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior INTRODUÇÃO À BIOQUÍMICA DA CÉLULA Histórico INTRODUÇÃO 1665: Robert Hooke Compartimentos (Células) 1840: Theodor Schwann Teoria Celular 1. Todos os organismos são constituídos de uma ou mais células 2.

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme NÚCLEO CELULAR Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme A presença do núcleo é a principal característica que distingue a célula eucariótica da procariótica. No núcleo está

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

AU01. Aspectos Genéticos da Mitose e Meiose. Emanuele Cristina Pesenti. Doutoranda PPG-GEN

AU01. Aspectos Genéticos da Mitose e Meiose. Emanuele Cristina Pesenti. Doutoranda PPG-GEN AU01 Aspectos Genéticos da Mitose e Meiose Emanuele Cristina Pesenti Doutoranda PPG-GEN emanuelepesenti@gmail.com Resumo Cromossomos Eucarióticos: Intrudução acerca da estrutura e organização dos cromossomos

Leia mais

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2016 PROFESSOR: Fred DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: - É fundamental

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Nucléolo, cromatina e cromossomos

Nucléolo, cromatina e cromossomos Nucléolo, cromatina e cromossomos NUCLÉOLO Tem aspecto de grânulo, mas não é limitado por membrana. É o centro de produção de ribossomos. O DNA origina os RNAr que são conjugados com proteínas vindas

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Biologia Molecular. Volume 3 - Módulos 3 e 4. Gonçalo A. de Souza Filho Jacyara M. B. Macedo. Apoio:

Biologia Molecular. Volume 3 - Módulos 3 e 4. Gonçalo A. de Souza Filho Jacyara M. B. Macedo. Apoio: Biologia Molecular Volume 3 - Módulos 3 e 4 Gonçalo A. de Souza Filho Jacyara M. B. Macedo Apoio: Fundação Cecierj / Consórcio Cederj Rua Visconde de Niterói, 1364 Mangueira Rio de Janeiro, RJ CEP 20943-001

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Aula 6: Síntese protéica

Aula 6: Síntese protéica Aula 6: Síntese protéica 3 RNAs são necessários para efetuar a síntese protéica: mrna (RNA mensageiro) processado: carrega a informação (ou seja, a seqüência de bases) para a sintese da proteina rrna

Leia mais

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I Prof. Odir Dellagostin Woese 1978 3 domínios O QUE É UM GENE? Toda sequência nucleotídica necessária e suficiente para

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Unidade 2. jcmorais 09

Unidade 2. jcmorais 09 Unidade 2 jcmorais 09 Situação Problemática Que desafios se colocam à genética no melhoramento da qualidade de vida? Cap. 1.1. Transmissão das características Como são transmitidas as características dos

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4 Biologia 21. Associe os números das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna abaixo do desenho. A seguir, assinale a opção em que a seqüência coincida com o que foi

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes Transcrição e tradução são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes A informação contida nos genes é expressa através da transcrição e tradução

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Tema: Direção da síntese de polímeros biomoleculares DNA mrna Proteína Alunos: José Augusto M. Burgarelli Rafael da Fonseca Lameiro Seiti Inoue Venturini

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Bioquímica Metabólica ENZIMAS

Pontifícia Universidade Católica de Goiás Departamento de Biologia Bioquímica Metabólica ENZIMAS Pontifícia Universidade Católica de Goiás Departamento de Biologia Bioquímica Metabólica ENZIMAS Origem das proteínas e de suas estruturas Níveis de Estrutura Protéica Estrutura das proteínas Conformação

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Conceitos fundamentais de Biologia Celular

Conceitos fundamentais de Biologia Celular Conceitos fundamentais de Biologia Celular Principais estruturas da célula eucariótica O NÚCLEO Contém nos cromossomos todo o genoma (DNA) das células; Responsável pela síntese e processamento dos RNAs

Leia mais

Unidade 6: Núcleo Celular

Unidade 6: Núcleo Celular Núcleo: Localização Célula Animal Célula Vegetal: Unidade 6: Núcleo Celular Disciplina: Biologia Celular e Molecular Centro de Ciências da Saúde Profa. Dra. Marilanda Ferreira Bellini marilanda.bellini@usc.br

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Questões complementares

Questões complementares Questões complementares 1247-2005 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares

Leia mais

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica.

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. O processo de síntese de RNA, a partir de um molde de DNA, é denominado

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Núcleo celular. Robert Brown ( ) Componente fundamental para a célula Nux. Compreensão da importância Séc. XX

Núcleo celular. Robert Brown ( ) Componente fundamental para a célula Nux. Compreensão da importância Séc. XX Núcleo celular Robert Brown (1773-1858) Componente fundamental para a célula Nux Compreensão da importância Séc. XX Componentes do núcleo celular Núcleo celular Eucariontes (+ 1 núcleo) Presença de cromossomos

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Nutrigenômica x Nutrigenética - doenças relacionadas

Nutrigenômica x Nutrigenética - doenças relacionadas Nutrigenômica x Nutrigenética - doenças relacionadas Início Projeto Genoma Humano 20.000 genes (120.000 inicialmente estimados) Diversidade nucleotídica: 0,1 a 0,4% pares de base correspondente a aproximadamente

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

BIO12814 NA INTERNET:

BIO12814 NA INTERNET: Disciplina BIO12814 Organização e controle da gênica 2012/1 Carga horária: 60 horas/aula (4 créditos) Professor responsável: Arnaldo Zaha Horários: Terças-feiras, 08h30min às 10h10min (discussões/seminários)

Leia mais

Fisiologia Endócrina

Fisiologia Endócrina Fisiologia Endócrina Profa. Letícia Lotufo Claude Bernard: pai da endocrinologia Definiu o termo milieu intérieur Endocrinologia estudo das secreções internas do organismos. 1 Sistema Endócrino e Homeostasia

Leia mais

Controle da expressão gênica

Controle da expressão gênica Programa de Biologia Celular V Curso de Verão Controle da expressão gênica Renata Ramalho Oliveira roliveira@inca.gov.br Desenvolvimento e fenótipos explicados pela modulação da expressão gênica Lehninger.

Leia mais

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO Página 1 de 5 PLANO DE ENSINO I. IDENTIFICAÇÃO Unidade Acadêmica: Câmpus Jataí Curso:Biomedicina Disciplina:Biologia Molecular Carga horária semestral:64 Teórica: 48 Prática: 16 Semestre/ano:1/2013 Turma/turno:

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2015 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 27/04/2015 HORA 10.00H - 12.00H

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste Nome do Aluno: Nº: Curso: BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste 11/01/2012 (Duração: 1,5 h) Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

FISIOLOGIA CELULAR. 4. Diferenciação celular 5. Formação dos tecidos 6. Níveis de organização do corpo humano. 1.

FISIOLOGIA CELULAR. 4. Diferenciação celular 5. Formação dos tecidos 6. Níveis de organização do corpo humano. 1. FISIOLOGIA CELULAR Sumário 1. Estrutura celular 2. Constituintes moleculares 3. Organelas 4. Diferenciação celular 5. Formação dos tecidos 6. Níveis de organização do corpo humano Mas eu só queria um diploma

Leia mais

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes.

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 1ª Série

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica Biologia Molecular Básica Módulo III Avançado Aula 1 Staphylococcus aureus Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas

Leia mais

Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição

Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição EIXO BIOLÓGICO Unidade 6 Transcrição e regulação da expressão gênica Autor: Elisângela de Paula Silveira Lacerda I. Introdução II. Do DNA ao RNA III. Mecanismos de transcrição IV. Particularidades da RNAP

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Profº Lásaro Henrique

Profº Lásaro Henrique Profº Lásaro Henrique Proteínas são macromoléculas complexas, compostas de aminoácidos. São os constituintes básicos da vida e necessárias para os processos químicos que ocorrem nos organismos vivos. Nos

Leia mais

Classificação viral segundo Baltimore. DNA dupla fita DNA simples fita DNA dupla fita DNA dupla fita RNA fita+ RNA fita + mrna RNA fita +

Classificação viral segundo Baltimore. DNA dupla fita DNA simples fita DNA dupla fita DNA dupla fita RNA fita+ RNA fita + mrna RNA fita + Processos de Replicação Viral Vírus com genoma a RNA Classificação viral segundo Baltimore. DNA dupla fita DNA dupla fita RNA fita+ RNA fita + DNA dupla fita mrna DNA simples fita DNA dupla fita RNA fita

Leia mais

Augusto Adolfo Borba. Miriam Raquel Moro Conforto

Augusto Adolfo Borba. Miriam Raquel Moro Conforto AUTORIA: EDIÇÃO DE CONTEÚDO: EDIÇÃO: CRÉDITOS DAS IMAGENS DE ABERTURA: Augusto Adolfo Borba Elvira Sampaio Miriam Raquel Moro Conforto Shutterstock/Sebastian Kaulitzki; istockphoto.com/henrik Jonsson;

Leia mais

Proteínas catalisadoras que AUMENTAM a VELOCIDADE das reações, sem sofrerem alterações no processo global.

Proteínas catalisadoras que AUMENTAM a VELOCIDADE das reações, sem sofrerem alterações no processo global. ENZIMAS Proteínas catalisadoras que AUMENTAM a VELOCIDADE das reações, sem sofrerem alterações no processo global. Toda enzima é uma proteína, mas nem toda proteína é uma enzima! CARACTERÍSTICAS GERAIS:

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

Prof. Tiago Collares, Dr.

Prof. Tiago Collares, Dr. Biologia Celular organelas Prof. Tiago Collares, Dr. tiago_collares@hotmail.com (MSN) collares.t@gmail.com (E-mail) Introdução à Biologia Celular Estrutura Celular: de acordo com o tipo estrutural de célula

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula.

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Aula 01 Composição química de uma célula O que é uma célula? Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Toda célula possui a capacidade de crescer,

Leia mais

Organização do Genoma

Organização do Genoma Organização do Genoma Bibliografia: The Cell A Molecular Approach (Fourth Edition) Geoffrey M. Cooper & Robert E. Hausman. ASM Press & Sinauer Associates, Inc. 2007. (Disponível para ser requisitado na

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Trabalho de biologia. Nome: Naiheverton e wellinton. Turma:103

Trabalho de biologia. Nome: Naiheverton e wellinton. Turma:103 Trabalho de biologia Nome: Naiheverton e wellinton Turma:103 VITAMINAS São compostos orgânicos imprescindível para algumas reações metabólicas especificas,requeridos pelo corpo em quantidade minimas para

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

Composição e Estrutura Molecular dos Sistemas Biológicos

Composição e Estrutura Molecular dos Sistemas Biológicos Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Composição e Estrutura Molecular dos Sistemas Biológicos Átomos e Moléculas Hierarquia

Leia mais

Importância dos processos de sinalização. Moléculas sinalizadoras (proteínas, peptídeos, aminoácidos, hormônios, gases)

Importância dos processos de sinalização. Moléculas sinalizadoras (proteínas, peptídeos, aminoácidos, hormônios, gases) Sinalização celular Importância dos processos de sinalização Seres unicelulares Seres multicelulares Moléculas sinalizadoras (proteínas, peptídeos, aminoácidos, hormônios, gases) Receptores Proteínas -

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

TRANSCRIÇÃO DO DNA: Tipos de RNA

TRANSCRIÇÃO DO DNA: Tipos de RNA TRANSCRIÇÃO DO DNA: Síntese do mrna Gene (Unidades transcricionais) Tipos de RNA Tipos de RNA polimerase Tipos de RNA polimerase DNA dependente Transcrição em Procariotos Transcrição em Eucariotos Mecanismos

Leia mais

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA Aula teórica 4 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br FUNÇÃO DO MATERIAL GENÉTICO 1. Função genotípica:

Leia mais