Síntese de RNA e Proteínas

Tamanho: px
Começar a partir da página:

Download "Síntese de RNA e Proteínas"

Transcrição

1 Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser expressos a taxas diferentes quando necessário um gene pode produzir muitos RNA cada RNA pode dirigir a síntese de muitas proteínas a célula pode produzir rapidamente grande quantidade duma proteína

2 Antes de poder ocorrer a síntese duma proteína tem de ser produzida a molécula de RNA correspondente transcrição produção do RNA complementar de uma das cadeias de DNA transcrito a nova cadeia não fica associada ao DNA representa a cópia de uma região muito limitada de DNA As células produzem vários tipos de RNA mrna 3-5% do total

3 A transcrição é catalizada pelas RNA polimerases formação de pontes fosfodiéster entre os ribonucleóridos para formar a cadeia - polimerização como a cadeia vai sendo libertada, o mesmo gene pode originar muitos RNA em pouco tempo (20 nucleótidos/s mil transcritos/hora) Os eucariotas têm 3 polimerases

4 Sinais codificados do DNA indicam à RNA polimerase o início (promotores) e o fim (terminadores) da transcrição cada segmento de DNA transcrito é uma unidade de transcrição nos eucariotas 1 gene = 1 RNA ou 1 proteína (ou grupo relacionado) nos procariotas conjunto de genes adjacentes

5

6

7 Nos procariotas

8 As sequências promotoras são assimétricas em relação ao ponto de iniciação da transcrição Embora o DNA seja uma cadeia dupla cada gene tem apenas um promotor a RNA polimerase só se pode ligar segundo uma orientação só uma das cadeia de DNA é transcrita (3 5 polimerização 5 3 ) a escolha da cadeia que serve de molde édeterminada pela localização e pela orientação do promotor

9 Nos eucariotas a iniciação da transcrição requer várias proteínas factores gerais de transcrição transcription factor for... (TF...) TATA-binding protein (TBP)

10 activadores e mediadores de transcrição complexos remodeladores de cromatina acetiltransferases de histonas

11 O produto dos genes pode ser a própria molécula de RNA (e.g., rrna) intermediários para a produção de proteínas (mrna) A conversão da informação de RNA para proteínas representa uma tradução (descodificação) não há correspondência directa entre um nucleótido e um aminoácido a sequência de mrna é descodificada em conjuntos de 3 nucleótidos cada grupo de 3 nucleótidos é um codon cada codon especifica um aminoácido ou o fim da tradução o código é redundante (degenerado) 64 combinações aminoácidos (alguns codificados por mais dum codon)

12 O mrna não reconhece directamente os aminoácidos a tradução depende de pequenas moléculas adaptadoras RNA transportadores (trna) ±80 nucleótidos 4 segmentos formam uma dupla hélice 2 regiões não emparelhadas o anticodon a extremidade simples 3 no homem 497 genes de trna apenas 48 anticodons

13 Cada aminoácido é acoplado ao seu trna por uma enzima específica aminoacil-trna sintetase O aminoácido é selecionado pela sequência nucleotídica complementaridade das bases do codon e do anticodon

14 Cada aminoácido é adicionado à extremidade COOH (C-terminal) de uma cadeia polipeptídica em crescimento A proteína é sintetizada a partir da extreminada amina (N-terminal) para a extremidade ácido (C-terminal) durante o processo a extremidade carboxilo permanece activada pela sua ligação covalente (energética) à molécula de t-rna peptidil-trna esta ligação é quebrada a cada edição, mas logo reposta

15 A mensagem do mrna é descodificada nos ribossomas uma máquina catalítica complexa uma subunidade menor (emparelhamento trna/mrna) uma subunidade maior (formação da cadeia polipeptídica)

16 O ribossoma contém 4 locais de ligação ao RNA 1 para mrna 3 para trna A (aminoacil-trna) P (peptidil-trna) E (exit) A adição de cada novo aminoácido envolve 3 passos ligação de um aminoacil-trna ao codon do mrna exposto no locus A formação da ligação peptídica (A-P) acção da peptidil transferase (subunidade maior) modificação conformacional do ribossoma libertação do trna (E) reposicionamento do ribossoma

17 O início e final da síntese proteica são determinados por sequências nucleotídicas próprias a iniciação e a terminação da tradução são variações do ciclo de extensão a tradução inicia-se com codon AUG (codon iniciador) trna iniciador carrega metionina (formilmetionina) factores de iniciação eucariotas (eifs) o final da tradução é sinalizado por um de 3 codons UAA, UAG, UGA os codons de terminação não são reconhecidos por um trna factores de libertação adição de H 2 O à extremidade COOH dissociação do complexo

18 As proteínas são produzidas nos polissomas Muitos inibidores da síntese proteica são usados como antibióticos na maioria produzidos por fungos

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Transcrição Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Tradução. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Tradução Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

objetivos Fluxo da informação genética tradução III AULA

objetivos Fluxo da informação genética tradução III AULA Fluxo da informação genética tradução III AULA 28 objetivos Nesta aula, você terá a oportunidade de: Descrever cada uma das etapas da tradução: iniciação, alongamento e terminação. Relatar alguns mecanismos

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes Transcrição e tradução são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes A informação contida nos genes é expressa através da transcrição e tradução

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Aula 6: Síntese protéica

Aula 6: Síntese protéica Aula 6: Síntese protéica 3 RNAs são necessários para efetuar a síntese protéica: mrna (RNA mensageiro) processado: carrega a informação (ou seja, a seqüência de bases) para a sintese da proteina rrna

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

TRADUÇÃO SÍNTESE PROTEICA

TRADUÇÃO SÍNTESE PROTEICA TRADUÇÃO SÍNTESE PROTEICA Formação do Aminoacil-tRNA Durante a formação do aminoacil-trna, o aminoácido é primeiramente ativado, reagindo com o ATP. Após, é transferido do aminoacil-amp para a extremidade

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas A Síntese de Proteínas O RNA e a Síntese de Proteínas O papel do RNAt e das sintetases do aminoacil-rnat O emparelhamento códon-anticódon O papel do RNAm e dos ribossomos Etapas da Síntese de Proteínas

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

REGULAÇÃO DO MATERIAL GENÉTICO

REGULAÇÃO DO MATERIAL GENÉTICO REGULAÇÃO DO MATERIAL GENÉTICO Prof. Ana Rita Rainho Controlo da actividade celular Se todas as células de um organismo possuem a mesma informação genética, qual o mecanismo que permite às células diferenciar-se?

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: O Código Genético Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas FICHA (IN)FORMATIVA Nº 1 Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas Ácidos nucleicos Os ácidos nucleicos armazenam e transmitem a informação hereditária.

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste Nome do Aluno: Nº: Curso: BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste 11/01/2012 (Duração: 1,5 h) Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente:

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: 1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: a) tradução, transcrição, duplicação b) duplicação, transcrição, tradução c) duplicação, tradução, transcrição d) tradução, duplicação,

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

SUGESTÃO DE ATIVIDADE

SUGESTÃO DE ATIVIDADE SESTÃO DE TIVIDDE D-ROM POIO DIDÁTIO mabis e Martho Simulando a síntese de proteínas Esta atividade sugere a utilização de modelos em papel para simular as principais etapas da síntese de proteínas, o

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_1ª Época 16/1/2010. (Duração: 2 h)

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_1ª Época 16/1/2010. (Duração: 2 h) BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_1ª Época 16/1/2010 (Duração: 2 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Actividade prática: Constrói os teus Kits de Genética!

Actividade prática: Constrói os teus Kits de Genética! Actividade prática: Constrói os teus Kits de Genética! Mais uma vez vais vestir a tua bata de cientista e investigador e preparar o teu dia a dia no laboratório. Hoje é um dia especial, vais receber a

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR

UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR UNIVERSIDADE FEDERAL DO PARANÁ MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA BIOLOGIA MOLECULAR CURITIBA 2014 MICHELE DE SIQUEIRA ANSELMO MODELO DIDÁTICO SOBRE O DOGMA CENTRAL DA

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves mackswendhell@gmail.com O que é Biologia Celular? É o ramo da ciência

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

QBQ 0102 Educação Física. Carlos Hotta. Código Genético e Tradução 16/06/15

QBQ 0102 Educação Física. Carlos Hotta. Código Genético e Tradução 16/06/15 QBQ 0102 Educação Física Carlos Hotta Código Genético e Tradução 16/06/15 Previously... replicação DNA transcrição RNA tradução proteína RNAm possuem informação para gerar novas proteínas A RNA polimerase

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

Na sala de aula Materiais Didáticos Resenhas Um gene

Na sala de aula Materiais Didáticos Resenhas Um gene ISSN 1980-3540 Volume 8 N o 1 2013 Conceitos de Genética Genética e Sociedade Investigações em Ensino de Genética Na sala de aula Materiais Didáticos Resenhas Um gene MATERIAIS DIDÁTICOS Por que alguns

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2014 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 05/05/2014 HORA 10.00H - 12.00H

Leia mais