Save this PDF as:

Tamanho: px
Começar a partir da página:



1 Transcrição do DNA

2 DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna).

3 Todos os RNAs são moléculas de fita simples, com orientação 5 para 3 Possuem estrutura secundária com pontes de H INTRACADEIA. Pareamento das bases A-U; C-G

4 Tipos principais de RNA mensageiro (carrega a informação p/ a síntese da proteína) transportador (carrega aminoácidos p/a síntese de proteínas) ribossômico (entra na composição dos ribossomos onde ocorre a síntese da proteína) snrna (auxiliares no splicing do mrna) micro RNAs (controle da expressão gênica) NOTA: Cada tipo de RNA é codificado por um gene próprio

5 Um gene é uma dupla fita de DNA Fita Fita Qual das duas fitas codifica a proteina? Fita 1 ou Fita 2? Informação Importante: Um aminoácido é codificado por uma trinca de bases (códon)

6 Gene Fita Fita mrna 1 Prot 1 UACGGUGAUCGUGCA A1 A2 A3 A4 A5 mrna 2 Prot 2 AUGCCACUAGCACGU Ax Ay Aw A5 A4 Desta forma, um gene daria 2 proteínas diferentes

7 Qual das duas fitas codifica a proteína? Resposta: a fita de orientação 5 3 Fita codificadora 5 3 Fita molde 3 5

8 Sentido das Fitas Fita codificadora 5 3 Fita molde A fita molde foi transcrita no mrna. Serviu de molde para inserir bases complementares Notar que a sequência nucleotídica do RNA é IGUAL à da fita codificadora. Exceto troca de T por U

9 Fita codificadora Fita molde

10 RNA polimerases Enzimas que catalisam a transcrição do DNA em RNA Catalisam a formação da ligação fosfodiéster entre os RIBOnucleotídios ATP + CTP+ GTP + UTP + DNA molde RNA + PP A fita molde do DNA está sendo transcrita a partir da sua extremidade 3 O RNA está sendo sintetizado pela RNA POLIMERASE sempre no sentido 5 3

11 Características do Processo

12 Como as RNAs polimerases reconhecem o início de um gene a ser transcrito? Existem regiões específicas chamadas promotores que antecedem o começo do gene A sequência dos promotores é bastante conservada nos genes Os promotores são reconhecidos pela subunidade SIGMA da RNA polimerase. Após reconhecimento, a enzima se liga ao DNA.

13 Promotores de procariotos Início do gene A subunidade sigma (σ) da RNA polimerase reconhece a sequência do promotor

14 A RNA polimerase de procariotos Enzima possui cinco subunidades proteicas: a 2 bb s a - estrutural b e b - atuam na catálise s reconhece promotores. Identifica o início da transcrição

15 Ligação ao Promotor Fita molde Separação das duas fitas de DNA Entra o 1º nucleotídio Entra o 2º nucleotídio; formação da ligação fosfodiéster Propagação da síntese

16 Término da transcrição em procariotos No final de cada gene há sequências de terminação Que são reconhecidas por uma proteína chamada fator r (Rho) O fator Rho não faz parte da estrutura da RNA polimerase

17 Rho 5 3 mrna é liberado, juntamente com a RNA polimerase e fator Rho


19 A transcrição em procariotos é acoplada à tradução

20 Animação

21 A transcrição em Eucariotos é mais complexa. A sequência dos promotores é diferente. Existem vários fatores de iniciação diferentes do fator σ. Existem ativadores e inibidores da transcrição Existem 3 tipos de RNA polimerases de eucariotos RNA pol I - genes para RNA ribossômico RNA pol II precursores de mrnas; snrna, micro RNAs RNA pol III genes para trnas

22 A transcrição em eucariotos ocorre no núcleo RNA amadurece e vai para o citoplasma Se for mrna, liga-se ao ribossomo para a síntese proteica

23 COMPLEXIDADE DO GENOMA O tamanho do genoma dos organismos aumenta com a sua complexidade evolutiva Organismo N o de pares de bases N o de genes (genoma haplóide) Bactéria 4 x Levedura 1,4 x Mosca 1,7 x Homem 3,9 x Nota: Aumenta muito a quantidade de DNA mas não aumenta muito o número de genes codificadores de proteínas. Como?

24 Nos organismos mais evoluídos aumenta o número de sequências de DNA que não são codificadoras de proteína ou de RNA Um exemplo são os íntrons Íntron = região de DNA de um gene que não é traduzida na proteína Exon = região de DNA de um gene que é traduzida na proteína

25 Estrutura de um gene de eucariotos exon = sequência codificadora íntron = sequência NÃO codificadora Pré mrna Transcrição mrna maduro Processamento

26 Processamento do pré-mrna UsnRNP Partículas que contém Proteinas e snrna snrna tem atividade enzimática de quebra de RNA

27 Etapas para a formação de um mrna maduro Adição da estrutura CAP na extremidade 5 do pré-rna Adição de 200 a 250 unidades de AMP na extremidade 3

28 Todas as etapas de processamento ocorrem no NÚCLEO CAP e polia para proteção do mrna contra nucleases O mrna maduro sai do núcleo e vai para o citoplasma onde ocorre a síntese proteica

29 Observação Os genes que codificam os rrnas e trnas são transcritos, mas não são processados. 1 2 Transcrição Transcrição Tradução trna Protein Não há tradução dos trnas ou rrnas

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA.

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN Resumo Introdução: revisão transcrição e tradução

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: Transcrição. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: Transcrição Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail:

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais


MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais


UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais


ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: NÚCLEO Abriga do material genético

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais


Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 O RNA

Leia mais


REGULAÇÃO DO MATERIAL GENÉTICO REGULAÇÃO DO MATERIAL GENÉTICO Prof. Ana Rita Rainho Controlo da actividade celular Se todas as células de um organismo possuem a mesma informação genética, qual o mecanismo que permite às células diferenciar-se?

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Organização do genoma e variação individual

Organização do genoma e variação individual Organização do genoma e variação individual José Francisco Diogo da Silva Junior Mestrando CMANS/UECE PLASTICIDADE CELULAR 1 PLASTICIDADE CELULAR PLASTICIDADE CELULAR 2 COMPOSIÇÃO DO DNA ESTRUTURA DO DNA

Leia mais

Armazenamento da informação genética

Armazenamento da informação genética Universidade Federal do Pampa Curso de Nutrição Biologia celular e molecular Armazenamento da informação genética Profª Ms. Vanessa Retamoso Prof Ms. Vanessa Retamoso NÚCLEO INTERFÁSICO: é o núcleo da

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

RNA catalítico e suas funções

RNA catalítico e suas funções Bioquímica II Profº Drº Júlio Borges RNA catalítico e suas funções Bruna Uebelhart Grandino Nº USP: 8928423 Gisleine Moretti Franhani Nº USP: 8928548 Gustavo Augusto Nº USP: 8928274 Luana Toyama Nº USP:

Leia mais

Aula 6: Síntese protéica

Aula 6: Síntese protéica Aula 6: Síntese protéica 3 RNAs são necessários para efetuar a síntese protéica: mrna (RNA mensageiro) processado: carrega a informação (ou seja, a seqüência de bases) para a sintese da proteina rrna

Leia mais

Número de genes versus número de proteínas em eucariotos

Número de genes versus número de proteínas em eucariotos Número de genes versus número de proteínas em eucariotos Bioquímica II SQM0416 Júlia Assirati Tomie Kuriyama Victória Montenegro de Campos Resumo Introdução Características do genoma humano Como foram

Leia mais


DUPLICAÇÃO DO DNA REPLICAÇÃO DO DNA DUPLICAÇÃO DO DNA OU REPLICAÇÃO DO DNA 18/04/2017 1 MITOSE EM CÉLULAS EUCARIÓTICAS 2n A mitose ocorre em células somáticas 1. Intérfase 1.1 Prófase 1.2 Metáfase 1.3 Anáfase 1.4 Telófase 1.4.1 Citocinese

Leia mais



Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas

Introdução a Bioinformática Curso de Verão Nivelamento na área de Biológicas Introdução a Bioinformática Curso de Verão 2011 Nivelamento na área de Biológicas 1 O que é genoma? Um genoma é o DNA completo de um organismo, incluindo os genes. Os genes levam a informação para produzir

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Departamento de Genética Nilce M. Martinez Rossi

Departamento de Genética Nilce M. Martinez Rossi ORGANIZAÇÃO E FUNCIONALIDADE DO GENOMA HUMANO Departamento de Genética Nilce M. Martinez Rossi Fenótipo = GENÓTIPO + Ambiente O que é o genoma? Projetos Genoma Genoma: sequencia de DNA de todos os cromossomos

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

BioMol (CV novo) Questões sobre os Seminários. GRUPO 1 Teoria unificada da expressão gênica

BioMol (CV novo) Questões sobre os Seminários. GRUPO 1 Teoria unificada da expressão gênica BioMol (CV novo) Questões sobre os Seminários GRUPO 1 Teoria unificada da expressão gênica Compare a expressão gênica de genes que são utilizados para a manutenção básica da célula, com genes que são usados

Leia mais

Núcleo. Vera Andrade Robert Brown (1833) descreveu o núcleo celular

Núcleo. Vera Andrade  Robert Brown (1833) descreveu o núcleo celular Vera Andrade Núcleo Robert Brown (1833) descreveu o núcleo celular Nux (grego) = semente, por ser considerado tão importante para a célula quanto a semente é para

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais


TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais


EXERCÍCIOS DE VESTIBULAR EXERCÍCIOS DE VESTIBULAR PRÉ-VESTIBULAR BIOLOGIA PROF. MARCONI 1º Bimestre 01. (Ufal 2006) Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam ambos

Leia mais


EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges

Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Seminário de Bioquímica II Prof. Dr. Júlio C. Borges Tema: Direção da síntese de polímeros biomoleculares DNA mrna Proteína Alunos: José Augusto M. Burgarelli Rafael da Fonseca Lameiro Seiti Inoue Venturini

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

No entanto, as três funções enumeradas acima não são as únicas funções que as moléculas de RNA possuem na célula.

No entanto, as três funções enumeradas acima não são as únicas funções que as moléculas de RNA possuem na célula. A Evolução Funcional do RNA 1. Três funções principais para o RNA hoje. Poderíamos dizer, de uma maneira grosseira, que na maior parte dos organismos que conhecemos hoje, há uma grande divisão de trabalho

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica.

A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. A síntese de DNA tem como objetivo replicar, de modo exato, o genoma. Já a síntese de RNA está relacionada com a própria expressão gênica. O processo de síntese de RNA, a partir de um molde de DNA, é denominado

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Organização de Genomas e Estrutura Fina dos Genes

Organização de Genomas e Estrutura Fina dos Genes Organização de Genomas e Estrutura Fina dos Genes Genoma Humano Genoma nuclear Genoma mitocondrial 3 bilhões pb 16,6Kb ~19000 genes 37 genes Genes e seqüências relacionadas DNA extragênico 2 genes de rrna

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais


BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais


UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

Biologia Molecular. Texto 4 TRANSCRIÇÃO E processamento DO rna. Transcrição e Processamento do RNA

Biologia Molecular. Texto 4 TRANSCRIÇÃO E processamento DO rna. Transcrição e Processamento do RNA Texto 4 TRANSCRIÇÃO E processamento DO rna Transcrição e Processamento do RNA A Natureza Química do RNA O Dogma Central da Biologia As Classes de RNA As Polimerases do RNA A polimerase do RNA das bactérias

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes

Transcrição e tradução. são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes Transcrição e tradução são os processos através dos quais as células lêm (ou expressam) as instruções genéticas contidas nos genes A informação contida nos genes é expressa através da transcrição e tradução

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

Introdução à Bioquímica Celular

Introdução à Bioquímica Celular Pontifícia Universidade Católica de Goiás Departamento de Biologia Introdução à Bioquímica Celular Prof. Msc. Macks Wendhell Gonçalves O que é Biologia Celular? É o ramo da ciência

Leia mais

Sistemas de controle da transcrição gênica. Procariotos

Sistemas de controle da transcrição gênica. Procariotos Sistemas de controle da transcrição gênica Procariotos Controle Positivo e Negativo: Há dois tipos de controle transcricional: Controle negativo: no qual uma proteína reguladora atua como um repressor

Leia mais

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Replicação do DNA Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Processo de replicação do DNA. Mediado por diversas enzimas Principais enzimas

Leia mais



Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais


ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 1. Crescimento e

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Genética Bacteriana. Julliane Dutra Medeiros

Genética Bacteriana. Julliane Dutra Medeiros Genética Bacteriana Julliane Dutra Medeiros 1 A célula bacteriana 2 Relembrando conceitos... Genoma informação genética de uma célula (cromossomo e plasmídeos) Estruturas contendo DNA que transportam fisicamente

Leia mais