Princípios de Sistemática Molecular

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Princípios de Sistemática Molecular"

Transcrição

1 ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos! Árvores filogenéticas Introdução! Inferência filogenética critério de matrizes de distâncias! Inferência filogenética critério de parcimônia! Inferência filogenética critério de verossimilhança máxima! Busca! Confiabilidade! Discussão de trabalhos em sistemática molecular 1. SEQÜÊNCIAS DE NUCLEOTÍDEOS GENOMAS E REPLICAÇÃO DE DNA GENES E ESTRUTURA GÊNICA Genes codificadores de proteínas Genes especificadores de RNA Pseudogenes Tradução e código genético Mutação

2 SEQÜÊNCIAS DE NUCLEOTÍDEOS Informação hereditária dos organismos vivos Ácido desoxiribonucleico DNA Duas fitas complementares dupla hélice Nucleotídeos Purinas Adenina (A) e Guanina (G) Pirimidinas Timina (T) e Citosina (C) Abreviações

3 SEQÜÊNCIAS DE NUCLEOTÍDEOS Informação hereditária dos organismos vivos Duas cadeias de DNA são unidas por pontes de hidrogênio Purina Pirimidina Ligação fraca (A T) Ligação forte (G C) G:C e A:T pareamento canônico de bases

4 SEQÜÊNCIAS DE NUCLEOTÍDEOS Informação hereditária dos organismos vivos A molécula de DNA é polarizada, com uma extremidade tendo um radical fósforo ( P) no carbono 5 do terminal do nucleotídeo e a outra extremidade tendo uma hidroxila livre ( OH) no carbono 3 A direção das pontes de fosfodiester determina a natureza da molécula 5 C C A A T 3 3 C C A A T 5 Por convenção, os nucleotídeos em uma molécula de DNA são escritos na ordem de transcrição Direção 5 3 SEQÜÊNCIAS DE NUCLEOTÍDEOS Informação hereditária dos organismos vivos Dupla hélice de DNA tem duas fitas dispostas em ordenação anti-paralela ou de complementaridade reversa A fita pesada contém mais que 50% das purinas, A e G A fita leve contém mais que 50% das pirimidinas, C e T

5 SEQÜÊNCIAS DE NUCLEOTÍDEOS Informação hereditária dos organismos vivos O comprimento de uma fita simples de ácidos nucleicos é medido pelo número de nucleotídeos O comprimento de uma fita dupla de ácidos nucleicos é medido em pares de bases (bp) milhares de pares de bases (kilobases, Kb) milhões de pares de bases (megabases, Mb)

6 GENOMAS E REPLICAÇÃO DE DNA Genoma theentirecomplementof genetic material carried by an individual A replicação do DNA ocorre antes da divisão celular Durante a replicação, cada uma das fitas de DNA serve como um molde para a formação de uma nova fita Replicação conservativa Cada célula resultante da divisão celular recebe uma dupla hélice contendo uma fita antiga e uma fita nova GENOMAS E REPLICAÇÃO DE DNA Origem de replicação Local onde as duas fitas do DNA parental foram separadas Replicação segue em ambas direções

7 GENES E ESTRUTURA GÊNICA Definição de gene Um segmento de DNA que codifica uma cadeia polipeptídica ou especifica uma molécula funcional de RNA Uma seqüência de DNA ou RNA genômico que é essencial para uma função específica A realização de uma função não exige que o gene seja traduzido ou mesmo transcrito GENES E ESTRUTURA GÊNICA Tipos de genes Genes que codificam proteínas (= Genes estruturais) Genes transcritos em RNA e traduzidos em proteínas Genes que especificam RNA (=Genes estruturais) Genes que são somente transcritos Genes não-transcritos

8 GENES E ESTRUTURA GÊNICA Transcrição Síntese de uma molécula complementar de RNA a partir de um molde de DNA A transcrição de genes estruturais é realizada por RNA polimerases GENES E ESTRUTURA GÊNICA Genes codificadores de proteínas Partes transcritas e não-transcritas Partes não-transcritas são designadas de acordo com sua localização relativa as partes transcritas Regiões flanqueadoras 5 e 3 5 seqüências específicas (sinais) que determinam initiation, tempo, timing, and tissue specificity of the transcription process Seqüências reguladoras que promovem o processo de transcrição» seqüências promotoras - região promotora

9 GENES E ESTRUTURA GÊNICA Genes codificadores de proteínas Regiões flanqueadoras 5 e 3 3 sinais para o término do processo de transcrição GENES E ESTRUTURA GÊNICA Genes codificadores de proteínas RNA transcrito = RNA mensageiro precursor (pré-mrna) Fita antisense fita do DNA da qual o prémrna é transcrito Fita sense fita complementar não-transcrita que é idêntica em seqüência ao pré-mrna

10 GENES E ESTRUTURA GÊNICA Genes codificadores de proteínas Pré-mRNA Introns seqüências transcritas que são spliced out durante o processamento do pré-mrna Exons seqüências que permanecem no mrna após o splicing GENES E ESTRUTURA GÊNICA Genes especificadores de RNA São transcritos em RNA mas não são traduzidos em proteínas Pseudogenes Um gene inativo originado de um gene ancestral ativo

11 TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Informação genética presente em uma molécula de mrna é traduzida em aminoácidos através de RNA transportadores (trna) TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Informação genética presente em uma molécula de mrna é traduzida em aminoácidos através de RNA transportadores (trna) trna Molécula pequena, nucleotídeos de comprimento Cada um dos 20 aminoácidos tem pelo menos um tipo de trna

12 TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Tradução envolve o reconhecimento sequencial de triplas de nucleotídeos adjacentes nãosobrepostos, codon, por uma seqüência complementar de três nucleotídeos, anti-codon, no trna trna que reconhece o codon UUA e carrega o aminoácido leucina é designado Leu trna UUA TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Tradução inicia em um codon de iniciação e prossegue que um codon de parada seja encontrado A fase na qual a seqüência é traduzida é determinada pelo codon de iniciação Quadro de leitura (reading frame)

13 TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Código genético Conjunto de regras que determina a correspondência entre os codons e os aminoácidos Código genético universal (padrão) 4 3 = 64 codons possíveis 61 codons especificam aminoácidos (codons sense) e 3 determinam o término da tradução (codon stop) UAA, UAG, UGA» TRADUÇÃO E CÓGIGO GENÉTICO

14 TRADUÇÃO E CÓGIGOS GENÉTICOS Síntese de proteínas envolve um processo de decodificação Degeneração Existem 61 codons sense e 20 aminoácidos Maioria dos aminoácidos (18 em 20) são codificados por mais de um codon Codons sinônimos Codons diferentes que codificam o mesmo aminoácido Família de codons Codons sinônimos que diferem somente na terceira posição Valina GUU, GUC, GUA, GUG TRADUÇÃO E CÓGIGOS GENÉTICOS Genoma mitocondrial animal utiliza codons que diferem do código genético universal

15 MUTAÇÃO Seqüências de DNA são de um modo geral copiadas exatamente durante o processo de replicação Erros na replicação de DNA ou no reparo ocorrem e dão origem a novas seqüências Mutação fonte de variação e novidade no processo de evolução Mutações podem ocorrem nas células germinativas ou somáticas Mutações somáticas não são herdadas Não são importantes do ponto de vista evolutivo MUTAÇÃO Classificação pelo comprimento da seqüência de DNA influenciada pelo evento de mutação Mutação de ponto Um único nucleotídeo é influenciado Classificação pelo tipo de mudança da seqüência de DNA influenciada pelo evento de mutação

16 MUTAÇÃO Classificação pelo tipo de mudança da seqüência de DNA influenciada pelo evento de mutação Substituição Substituição de um nucleotídeo por outro Recombinação Troca de uma seqüência por outra Deleção Remoção de um ou mais nucleotídeos Inserção Adição de um ou mais nucleotídeos Inversão Rotação de 180 de um segmento de fita dupla de DNA contendo duas ou mais bases MUTAÇÃO Substituição Substituição de um nucleotídeo por outro Transição A e G (Purinas ) ou C e T (Pirimidinas) Transversão Mudanças entre uma purina e uma pirimidina Quatro tipos de transições»a G, G A, C T, T C Oito tipos de transversões»a C, A T, C A, C G»T A, T C, G C, G T

17 MUTAÇÃO Substituição Substituição de um nucleotídeo por outro Efeito sobre o produto da tradução (regiões codantes)» Mutação sinônima Não causa mudança no aminoácido especificado» Mutação não-sinônima Causa mudança no aminoácido especificado» Missense Muda o codon para outro que especifica um aminoácido diferente» Nonsense Muda o codon para outro que especifica um codon de parada MUTAÇÃO Substituição Substituição de um nucleotídeo por outro

18 MUTAÇÃO Taxas Taxa. Mat. Razão entre as variações de duas grandezas das quais a primeira é dependente da segunda. (Aurélio) Rate. 1. a measurement of the speed at which something happens. (Oxford) MUTAÇÃO Taxas de mutação Estimativas indiretas a partir da taxa de substituição em pseudogenes Taxa média de mutação no DNA nuclear de mamíferos 3 a substituições de nucleotídeos por sítio de nucleotídeo por ano Taxa varia com a região do genoma > 10-3 para micro-satélites

19 MUTAÇÃO Taxas de mutação Taxa de mutação no DNA mitocondrial de mamíferos Pelo menos 10 vezes mais alta que a média da taxa nuclear Taxa de mutação do virus da gripe A 10-2 mutações por sítio de nucleotídeo por ano» 2 milhões de vezes mais alta que a taxa de mutação do DNA nuclear de vertebrados MUTAÇÃO Distribuição espacial das mutações Mutações não ocorrem aleatoriamente no genoma Algumas regiões são mais susceptíveis a mutações» Hotspots

20 ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação "! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos! Árvores filogenéticas Introdução! Inferência filogenética Critério de matrizes de distâncias! Inferência filogenética Critério de parcimônia! Inferência filogenética Critério de verossimilhança máxima! Busca! Confiabilidade! Discussão de trabalhos em sistemática molecular

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas FICHA (IN)FORMATIVA Nº 1 Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas Ácidos nucleicos Os ácidos nucleicos armazenam e transmitem a informação hereditária.

Leia mais

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição DNA e Cromossomos Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição Ácidos nucléicos Formado por nucleotídeos: uma base nitrogenada ligada a uma ribose ou desoxirribose e um ou mais grupos

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS Unidade básica dos Ácidos Nucleicos Existem apenas 4 bases em cada um dos ácidos nucleicos DNA DNA e RNA RNA Ácido fosfórico Ácido fosfórico Pentose Desoxirribose

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Estrutura e Função de proteínas. Continua...

Estrutura e Função de proteínas. Continua... Estrutura e Função de proteínas Continua... Estrutura Quaternária Descreve o número e as posições relativas das subunidades nas proteínas multiméricas; O nível + alto da estrutura são os arranjos macromoleculares...

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes.

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 1ª Série

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE CONCEITOS EM EPIDEMIOLOGIA E FILOGENIA MOLECULARES PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE DE

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA Aula teórica 4 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br FUNÇÃO DO MATERIAL GENÉTICO 1. Função genotípica:

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA BIOVESTIBA.NET VIRTUAL UFRGS BIOQUÍMICA 1. (Ufrgs 2015) Observe a tira abaixo. Se o filho do Radicci tornar-se vegetariano do tipo que não utiliza produtos derivados de animais, ficará impossibilitado

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

2 Contexto Biológico Genômica

2 Contexto Biológico Genômica 15 2 Contexto Biológico Neste capítulo abordaremos o contexto biológico para o entendimento deste trabalho. Serão abordados os aspectos gerais da genômica, expostos os processos do sequenciamento genético

Leia mais

SABADÃO CSP BIOLOGIA FELIPE FERNANDES 1

SABADÃO CSP BIOLOGIA FELIPE FERNANDES 1 Parte 1 Fotossíntese Questão 1 O gás carbônico e o oxigênio estão envolvidos no metabolismo energético das plantas. cerca desses gases pode-se dizer que: a) o gás carbônico é produzido apenas durante o

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS anticódon códon Como pode cair no enem (ENEM) Define-se genoma como o conjunto de todo o material genético de uma espécie, que, na

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

FUNÇÕES DO DNA E RNA

FUNÇÕES DO DNA E RNA FUNÇÕES DO DNA E RNA FUNÇÕES DOS NUCLEÓTIDOS Transportadores de energia; Componentes dos cofatores enzimáticos; Mensageiros químicos. Modelo da Dupla Hélice do DNA A complementaridade dos 2 filamentos

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges

Aula de Bioquímica II. Tema: O Código Genético. Prof. Dr. Júlio César Borges Aula de Bioquímica II Tema: O Código Genético Prof. Dr. Júlio César Borges Depto. de Química e Física Molecular DQFM Instituto de Química de São Carlos IQSC Universidade de São Paulo USP E-mail: borgesjc@iqsc.usp.br

Leia mais