Site:

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Site:"

Transcrição

1

2

3 Código Genético É o conjunto dos genes humanos. Neste material genético está contida toda a informação para a construção e funcionamento do organismo humano. Este código está contido em cada uma das nossas células.

4 Código Genético Cada conjunto de três bases constitui um códon (RNAm). 64 códons constituem o código genético. Os 20 aminoácidos são especificados por mais de um códon o código é redundante (degenerado). Três códons são sinais de parada (UGA, UAA e UAG). É universal DNA nuclear e DNA mitocondrial. A tradução acontece no Ribossomo (RNAt, RNAr e enzimas). A tradução de um RNAm processado sempre se inicia num códon que especifica a metionina (iniciador AUG) e geralmente é removida antes da síntese de proteína ser terminada.

5 CÓDIGO GENÉTICO CÓDONS (RNAm)

6 CÓDIGO GENÉTICO CÓDONS (RNAm)

7 Características do Código Genético TRIPLO: baseado em trincas de nucleotídeos - permite a formação de 64 códons diferentes, sendo 61 ativos e 3 inativos (stop codon); UNIVERSAL: é válido para todos os SV. Permite a transgenia (OGM); DEGENERADO: o código genético é repleto de sinônimos. Um único aminoácido pode ser codificado por vários códons diferentes. Ex: prolina (CCC, CCG, CCU, CCA).

8 CÓDIGO GENÉTICO CÓDONS (RNAm) U C A G U UUU Phe UUC Phe UUA Leu UUG Leu UCU Ser UCC Ser UCA Ser UCG Ser UAU Tyr UAC Tyr UAA End UAG End UGU Cys UGC Cys UGA End UGG Trp C CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg A AUU Ile AUC Ile AUA Ile AUG Met ACU Thr ACC Thr ACA Thr ACG Thr AAU Asn AAC Asn AAA Lys AAG Lys AGU Ser AGC Ser AGA Arg AGG Arg G GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly

9 GENES Fragmento de DNA que pode ser transcrito na síntese de proteínas. É uma seqüência do DNA cromossômico que constitui uma unidade transcricional e que contém informação para a síntese de proteínas Cada trecho de DNA que contém informações é conhecido como Gene - região do genoma que pode ser transcrita em um RNA funcional no momento e no lugar correto durante o desenvolvimento É um Fator hereditário de determina uma característica Conjunto de nucleotídeos de DNA que especifica a seqüência de aminoácidos de uma proteína Assim, em um cromossomo há Genes encarregados das mensagens que determinaram as características dos seres vivos. Os genes são seqüências especiais de centenas ou até milhares de pares (do tipo A-T ou C-G) que oferecem as informações básicas para a produção de compostos necessários que o corpo precisa produzir.

10

11

12

13 Estrutura e organização dos genes A molécula de DNA apresenta ÉXONS (regiões codificadoras) e ÍNTRONS (regiões não codificadoras) Os íntrons são eliminados no processo de maturação do RNA mensageiro A maioria dos genes são constituídos de éxons e íntrons. Apenas 3% do genoma humano é formado por genes. O resto é apenas "lixo", agrupamentos de proteínas que não contêm informações necessárias.

14 Gene Dentro da célula os genes são organizado numa estrutura chamada cromossomo. Organismos simples como bactérias têm cerca de 500 genes. Humanos: cerca de genes O conjunto de cromossomos forma o que denominamos GENOMA

15

16 GENOMA É o conjunto de genes de uma espécie e está contido na célula. A área da ciência denominada genética, é responsável pelos estudos hereditários, relacionados à descendência, obtidos após o cruzamento de indivíduos de uma mesma espécie. Estudo da reprodução, herança, variação e de aspectos relacionados à descendência O DNA inútil compõe 97% do genoma humano e, apesar de seu nome, ele é necessário para o funcionamento adequado dos genes.

17 Cerca de 6 bilhões de pb. 23 pares de cromossomos Aproximadamente genes Controlam a embriogênese, desenvolvimento, crescimento, reprodução e metabolismo do ser humano Um Cromossomo Grande pode ter até 250 milhões de pb como o cromossomo 1. Um cromossomo pequeno como o 21 tem 50 milhões de pb. GENOMA HUMANO

18 Os genes estão distribuídos ao longo do genoma; Cromossomo 1 tem a maioria dos genes (2968), e o Y a menor parte (231); Menos de 2% do genoma codifica proteínas; Maioria do genoma é não codificador. Estima-se que 99,9% da seqüência é exatamente a mesma entre todos os seres humanos Tamanho dos genes: varia enormemente Gene médio: 3000 bases Genoma Humano Maior gene conhecido: distrofina (2,4 milhões de bases) Número total de genes: estimado em (muito menos que as estimativas prévias de a ) Mais de 50% genes encontrados ainda não tem função definida.

19 Composição do Genoma Humano

20 Tipos de DNA no Genoma Humano 6 bilhões de pb, 10% codificam genes 75% consistem de DNA de cópia única - seqüências de nucleotídeos vistas apenas uma/algumas vezes no genoma. 25% são classes de DNA repetitivo.

21 PROJETA GENOMA 1985 Grupo de cientista pretendiam detectar mutações em homens Com isso foi criado o Projeto Genoma Humano, que faz parte de um financiamento público O Departamento de Energia dos Estados Unidos e o Instituto Nacional de Saúde daquele país, investiram no primeiro momento por volta de 3 milhões de dólares, em um audacioso projeto que propunha o mapeamento de todo o material genético encontrado na células de seres humanos. Mais tarde Craig Venter funda a empresa Celera Genomics, que faz parte de um financiamento particular e que tinha como um dos principais objetivos seqüênciar todo o genoma humano antes do projeto genoma humano.

22 PROJETA GENOMA Para fazer a pesquisa a Celera diz ter usado o DNA de pessoas anônimas e que estas não eram nem atores, políticos e muito menos de pessoas que tenham um intelecto assustador. No dia 26 de junho de 2000 a Celera anunciou que havia seqüenciado 100% do genoma humano. Logo após a Celera já fez o pedido da patente de 6500 genes, mesmo tendo usado informações do Projeto Genoma Humano Este projeto foi denominado Projeto Genoma Humano e tinha como prazo inicial para sua conclusão 15 anos, atualmente ainda em andamento conta com a participação de cientistas de 250 laboratórios espalhados pelo mundo.

23

24 PROJETA GENOMA 12 de fevereiro de 2001 É anunciada a publicação da análise da seqüência do Genoma humano. Empreendimento internacional (Mais de 50 países) Celera Genomics Bioética Brasil: Xilella

25

26 OBJETIVOS DO PROJETA GENOMA Objetivos do Projeto Genoma: Principal objetivo: Conseguir identificar todos os genes que constituem o genoma humano. Identificar e fazer o mapeamento de cerca de 80 mil genes Determinar as seqüências dos 3 bilhões de bases do DNA Armazenar e analisar as amostras Melhorias na Biologia e Medicina

27

28 PROJETA GENOMA Existem dois métodos que possibilitaram aos cientistas de todo o mundo a realização desta proposta do projeto genoma humano. O primeiro é pela analise da seqüência de proteínas que levaria ao conhecimento da seqüência de DNA correspondente. O outro método e mapear o gene de um cromossomo e depois isola-lo, processo conhecido como Clonagem.

29

30 PROJETA GENOMA A compreensão do genoma humano tem como objetivo facilitar o entendimento e o tratamento de doenças genéticas como, por exemplo, a Síndrome de Down, apesar dos vários grupos de estudos que trabalham nesta área, este objetivo não esta tão próximo ainda de ser alcançado. Contudo, o efeito mais evidente do PGH (Projeto Genoma Humano) e a disponibilidade de testes genéticos, que auxiliam a medicina na confirmação de diagnósticos, identificação de portadores (sadios) de algum gene patogênico e a informatização de présintomatica, incluindo risco de doenças futuras.

31

32

33

34

35

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir)

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Pergunta 1 Abaixo estão apresentadas as estruturas de três aminoácidos. Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Usando os espaços em branco abaixo, classifique os três na ordem da hidrofobicidade

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES 1 3AMIپ0 9CIDS PLASMپ0 9TICS LIVRES پ0 9CIDS AMIADS PLASMپ0 9TICS LIVRES CBPM 4.03.01.29-0 AMB 28.13.043-0 CBPM 4.03.01.67-2 AMB 28.04.099-6/92 Sinon ھmia: پ0 9cido asp rtico, پ0 9cido glutپ0 9mico, Alanina,

Leia mais

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo.

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo. BIOLOGIA 01. Considere o enunciado abaixo e as três propostas para completá-lo. Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactérias, observou que elas eram incapazes de crescer

Leia mais

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D.

EVOLUÇÃO. Prof. Nelson Jorge da Silva Jr. Ph.D. EVOLUÇÃO EVIDÊNCIAS DO PROCESSO EVOLUTIVO Prof. Nelson Jorge da Silva Jr. Ph.D. Professor Titular PREMISSAS BÁSICAS DA EVOLUÇÃO 1. As espécies mudam no sentido da descendência com modificação. 2. Todos

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS Estrutura de um bacteriófago Proteína cabeça DNA cauda Proteínas cromossomo bacteriano Fago DNA Como pode cair no enem (MACKENZIE) O ser humano tem travado batalhas constantes

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V

BIOLOGIA. Assinale a alternativa que preenche corretamente os parênteses, de cima para baixo. a) V V V b) V F F c) F F F d) V V F e) F V V BIOLOGIA 01 Não é somente o sabor agradável ao paladar que faz dos cogumelos comestíveis um dos alimentos mais cobiçados pelos asiáticos e europeus. Esses cogumelos são ricos em proteínas, sais minerais,

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Introdução à Teoria da Informação

Introdução à Teoria da Informação Introdução à Teoria da Informação Probabilidade e Estatística I Antonio Roque Aula 8 O conceito de quantidade de informação associada a um evento foi introduzido pelo engenheiro norte-americano Claude

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Aula 8 Síntese de proteínas

Aula 8 Síntese de proteínas Aula 8 Síntese de proteínas As proteínas que podem ser enzimas, hormônios, pigmentos, anticorpos, realizam atividades específicas no metabolismo dos seres vivos. São produzidas sob o comando do DNA. Observe

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir. EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

Professora Priscila F Binatto

Professora Priscila F Binatto Professora Priscila F Binatto Característica 5 3 AUTODUPLICAÇÃO (Replicação) Ocorre em presença da enzima DNA polimerase Molécula DNA As pontes de hidrogênio se rompem H Nucleotídeos LIVRES encaixam se

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE

ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE ROTEIRO DE RECUPERAÇÃO DE BIOLOGIA - 3º BIMESTRE - 2016 Nome: Nº 3ª Série Data: 04/ 10/ 2016 Professor(a): Danilo, Davis e Glauco Nota: (Valor 1,0) APRESENTAÇÃO: A estrutura da recuperação bimestral paralela

Leia mais

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA Gabarito Exercícios Ácidos Nucléicos EXERCÍCIO EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA 1) O mofamento de grãos durante a estocagem causa perdas nutricionais e de valor de mercado, além de

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

Área de Biológicas e Exatas

Área de Biológicas e Exatas Vestibular 2010 Área de Biológicas e Exatas Prova de Conhecimentos Específicos Assinatura do candidato Caderno de Questões Verifique se estão corretos seu nome e número de inscrição impressos na capa deste

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

ROTEIRO DE RECUPERAÇÃO SEMESTRAL DE BIOLOGIA

ROTEIRO DE RECUPERAÇÃO SEMESTRAL DE BIOLOGIA ROTEIRO DE RECUPERAÇÃO SEMESTRAL DE BIOLOGIA Nome: Nº Série: 1ª Data: / 10 / 2015 Professores: Gisele / Marcelo / Thierry (valor: 1,0 ponto) 3º Bimestre Antes de mais nada lembre-se! A prova de recuperação

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01 BOLOGA TPO 1 QUESTÃO 01 Leia o trecho a seguir. No processo evolutivo, muitos animais foram extintos depois de se diferenciarem de seus parentes mais próximos. Boa parte deles virou fóssil e, quando descobertos,

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais

Genética e Câncer. Viviane Ferreira Esteves

Genética e Câncer. Viviane Ferreira Esteves Genética e Câncer Viviane Ferreira Esteves Fatores de risco Fatores internos Predisposição hereditária Fatores externos Ambientais Predisposição Genética para o Câncer Tipo de câncer Mama Cólon Leucemias

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS anticódon códon Como pode cair no enem (ENEM) Define-se genoma como o conjunto de todo o material genético de uma espécie, que, na

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Glicídios - Carboidratos. Professor: Paulo Disciplina: Biologia Campus Aquidauana

Glicídios - Carboidratos. Professor: Paulo Disciplina: Biologia Campus Aquidauana Glicídios - Carboidratos Professor: Paulo Disciplina: Biologia Campus Aquidauana GLICÍDIS São formados, basicamente, por carbono, hidrogênio e oxigênio. Sinônimos: Carboidratos, Açúcares, ses, idratos

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

Bioquímica ENZIMAS ÁC. NUCLEICOS

Bioquímica ENZIMAS ÁC. NUCLEICOS Bioquímica ENZIMAS ÁC. NUCLEICOS As enzimas são substâncias orgânicas, geralmente proteínas, que catalisam reações biológicas pouco espontâneas e muito lentas. O poder catalítico de uma enzima relaciona

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

EXERCÍCIOS DE VESTIBULAR

EXERCÍCIOS DE VESTIBULAR EXERCÍCIOS DE VESTIBULAR PRÉ-VESTIBULAR BIOLOGIA PROF. MARCONI 1º Bimestre 01. (Ufal 2006) Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam ambos

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

DESVENDANDO O GENOMA HUMANO

DESVENDANDO O GENOMA HUMANO 2º EM Biologia Professor João DESVENDANDO O GENOMA HUMANO Um breve histórico da Genética Hereditariedade (1865); Localização dos genes nos cromossomos (1911); É proposta a molécula helicoidal de DNA (1953);

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 7ª aula teórica 11 Outubro 2010 Proteínas estruturais e funcionais Organização estrutural das proteínas Estrutura e diferentes funções de proteínas

Leia mais

Genética Bacteriana. Julliane Dutra Medeiros

Genética Bacteriana. Julliane Dutra Medeiros Genética Bacteriana Julliane Dutra Medeiros 1 A célula bacteriana 2 Relembrando conceitos... Genoma informação genética de uma célula (cromossomo e plasmídeos) Estruturas contendo DNA que transportam fisicamente

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

Aminoácidos peptídeos e proteínas

Aminoácidos peptídeos e proteínas Pontifícia Universidade Católica de Goiás Departamento de Biologia Aminoácidos peptídeos e proteínas Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Algumas funções de proteínas A luz produzida

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Departamento de Genética Nilce M. Martinez Rossi

Departamento de Genética Nilce M. Martinez Rossi ORGANIZAÇÃO E FUNCIONALIDADE DO GENOMA HUMANO Departamento de Genética Nilce M. Martinez Rossi Fenótipo = GENÓTIPO + Ambiente O que é o genoma? Projetos Genoma Genoma: sequencia de DNA de todos os cromossomos

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

Número de genes versus número de proteínas em eucariotos

Número de genes versus número de proteínas em eucariotos Número de genes versus número de proteínas em eucariotos Bioquímica II SQM0416 Júlia Assirati Tomie Kuriyama Victória Montenegro de Campos Resumo Introdução Características do genoma humano Como foram

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Ficha de Trabalho de Biologia e Geologia 11º ano outubro 2015

Ficha de Trabalho de Biologia e Geologia 11º ano outubro 2015 Estruturas Pedagógicas Direção-Geral dos Estabelecimentos Escolares Direção de Serviços da Região Centro Área disciplinar de Biologia e Geologia Ano letivo 2015/2016 Ficha de Trabalho de Biologia e Geologia

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec Guia mangá Biologia Molecular Masaharu Takemura Sakura Becom Co., Ltd. novatec Original Japanese-language edition Manga de Wakaru Bunshi Seibutsugaku ISBN 978-4-274-06702-0 2008 by Masaharu Takemura and

Leia mais

Na sala de aula Materiais Didáticos Resenhas Um gene

Na sala de aula Materiais Didáticos Resenhas Um gene ISSN 1980-3540 Volume 8 N o 1 2013 Conceitos de Genética Genética e Sociedade Investigações em Ensino de Genética Na sala de aula Materiais Didáticos Resenhas Um gene MATERIAIS DIDÁTICOS Por que alguns

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

Revisão SPLICING TRANSGÊNICO

Revisão SPLICING TRANSGÊNICO Revisão SPLICING Durante a transcrição para a formação do RNAm, o DNA (gene) transcreve as partes ativas (éxons) e as inativas (íntrons), porém, antes de sair para o citoplasma, o RNAm "perde" os íntrons,

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais