EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

Tamanho: px
Começar a partir da página:

Download "EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir."

Transcrição

1 EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações microclimáticas e à redução do contato humano com o vetor Aedes aegyptis. 2. (UFRJ) Os gráficos a seguir apresentam o crescimento de uma espécie de bactéria e de um vírus bacteriófago em ciclo lítico, ambos em ambientes sem limitação de recursos. Desde a década de 1930, são conhecidos os processos de desenvolvimento e controle da febre amarela e da dengue no Brasil. Entretanto, estas doenças continuam ocorrendo na maior parte do território brasileiro, com variações espaciais e temporais. Neste contexto, verifica-se que, a) na região Nordeste, ocorreu, no período de 1996 a 2005, uma epidemia de dengue em razão da concentração da população nas cidades, o que facilitou a proliferação do vetor Aedes aegyptis. b) na região Sul, foi notificado o menor número de casos de febre amarela devido à distribuição regular das chuvas ao longo de todos os meses do ano e às temperaturas elevadas no verão, cujo vetor Haemagogus não se reproduz, nestas condições, em regiões urbanas. c) na região Sudeste, ocorreu, no período de 2001 a 2005, o segundo maior número de casos de dengue dentre todas as regiões por causa da concentração das chuvas no verão e da proliferação do vetor Haemagogus. d) na região Norte, no período de 1996 a 2000, foi registrado o maior número de casos de febre amarela em virtude das transformações socioambientais da expansão da agricultura, facilitando a proliferação do vetor Haemagogus. Identifique qual gráfico (A ou B) representa o crescimento das bactérias e qual representa o crescimento dos bacteriófagos. Justifique sua resposta.

2 3. (PUCRS) A pesquisa 2 investigou qual a porção viral que infectava as bactérias. Para isso, uma quantidade de vírus bacteriófagos teve seu capsídeo proteico marcado com fluorescência vermelha, e seu DNA, com fluorescência azul. As células foram então infectadas por esses vírus e, após, analisadas. O processo de infecção mostrou que das bactérias havia ficado. a) o citoplasma - vermelho b) o citoplasma - azul c) o núcleo - vermelho d) a parede celular - azul e) a parede celular - vermelha 4. (CFTSC) A influenza A (H1N1), mais conhecida como Gripe A, marcou o mundo em 2009 constituindo-se em uma doença respiratória viral. Os vírus influenza são compostos de RNA, e subdividem-se em três tipos: A, B e C. Os tipos A e B causam maior morbidade (doença) e mortalidade (mortes) que o tipo C. Geralmente as epidemias e pandemias (epidemia em vários países) estão associadas ao vírus influenza A. Uma pessoa pode ter influenza mais de uma vez, mas não pelo subtipo de vírus com o qual tenha sido infectada. Isso porque a pessoa fica imunizada pelo subtipo de vírus depois de ter a doença. O vírus é transmitido de pessoa a pessoa, principalmente por meio da tosse, espirro ou de secreções respiratórias de pessoas infectadas. Entre os principais medicamentos utilizados no tratamento da Gripe A encontra-se o Tamiflu, cujo princípio ativo interfere na entrada do vírus em células não infectadas e também na liberação de partículas virais formadas recentemente a partir de células infectadas. Disponível em: Acesso em: 06 set Texto adaptado de: www3.pucrs.br/notícias. Acesso em: 06 set Leia as proposições abaixo: I Os seres vivos podem ser classificados em cinco reinos: Monera, Protista, Plantae, Fungi e Animalia. Por serem unicelulares procariontes, os vírus estão enquadrados no Reino Monera. II Por serem partículas infecciosas acelulares, os vírus são obrigatoriamente parasitas celulares, necessitando de outros seres vivos para a formação de novas partículas virais. III A imunização de uma pessoa a uma doença virótica após o contágio ou através de vacina se deve ao sistema imunológico humano, composto basicamente pelas hemácias ou glóbulos vermelhos. IV Os vírus são formados basicamente por ácido nucleico envolvido por uma capa proteica denominada capsídeo. Os vírus da Influenza A apresentam RNA como ácido nucleico. O RNA é uma molécula formada por duas cadeias de nucleotídeos em antiparalelo, com estrutura helicoidal de acordo com o modelo da dupla hélice proposto por Watson e Crick em Com base nos seus conhecimentos e no texto acima sobre vírus, classificação, morfologia e fisiologia dos seres vivos, assinale a alternativa correta. a) Apenas a proposição III é verdadeira. b) Apenas as proposições I e II são verdadeiras. c) Apenas as proposições III e IV são verdadeiras. d) Apenas as proposições I e IV são verdadeiras. e) Apenas a proposição II é verdadeira. 5. (UFPR) Na década de 1990 foram descobertas, no genoma de aves e mamíferos, inúmeras sequências de DNA que tinham grande similaridade com os retrovírus infecciosos e por isso foram denominadas retrovírus endógenos (RVEs). Sabemos hoje que esses estranhos elementos constituem 8% do genoma humano. (Fonte: Instituto Ciência Hoje coluna Deriva Genética.) Sobre os retrovírus endógenos, considere as seguintes afirmativas: 1. Retrovírus endógenos surgem a partir da evolução de genes mutantes do próprio organismo. 2. Para que esses elementos surjam, é necessária a presença, em algum momento do processo, da enzima transcriptase reversa. 3. Os retrovírus endógenos são encontrados no citoplasma das células infectadas. 4. A origem de retrovírus endógeno pode se dar a partir da infecção de organismos por vírus que possuem RNA como material genético. Assinale a alternativa correta. a) Somente a afirmativa 2 é verdadeira. b) Somente as afirmativas 1 e 3 são verdadeiras. c) Somente as afirmativas 2, 3 e 4 são verdadeiras. d) Somente as afirmativas 2 e 4 são verdadeiras. e) Somente as afirmativas 1 e 4 são verdadeiras. 6. (FUVEST) Considere as seguintes características atribuídas aos seres vivos: I. Os seres vivos são constituídos por uma ou mais células. II. Os seres vivos têm material genético interpretado por um código universal. III. Quando considerados como populações, os seres vivos se modificam ao longo do tempo. Admitindo que possuir todas essas características seja requisito obrigatório para ser classificado como ser vivo, é correto afirmar que: a) os vírus e as bactérias sãeres vivos, porque ambos preenchem os requisitos I, II e III. b) os vírus e as bactérias não são seres vivos, porque ambos não preenchem o requisito I. c) os vírus não são seres vivos, porque preenchem os requisitos II e III, mas não o requisito I. d) os vírus não são seres vivos, porque preenchem o requisito III, mas não os requisitos I e II. e) os vírus não são seres vivos, porque não preenchem os requisitos I, II e III.

3 7. (UFPE) A gripe causada pelo Influenza A H1N1 tem provocado uma pandemia sem precedentes, com gravidade somente comparada à gripe espanhola do início do século passado. Sobre estes vírus, observe a figura a seguir e considere as afirmações que se seguem. 5 3 AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 2. a tabela com os códons representativos do código genético universal: UUU Phe UUC Phe UUA Leu UUG Leu UCU Ser UCC Ser UCA Ser UCG Ser UAU Tyr UAC Tyr UAA pare* UAG pare* UGU Cys UGC Cys UGA pare* UGG Trp CUU Leu CCU Pro CAU His CGU Arg CUC Leu CCC Pro CAC His CGC Arg CUA Leu CCA Pro CAA Gin CGA Arg CUG Leu CCG Pro CAG Gin CGG Arg AUU IIe ACU Thr AAU Asn AGU Ser AUC IIe ACC Thr AAC Asn AGC Ser AUA IIe ACA Thr AAA Lys AGA Ser AUG iniciar* ACG Thr AAG Lys AGG Ser GUU Val GCU Ala GAU Asp GGU Gly GUC Val GCC Ala GAC Asp GGC Gly GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly ( ) Os vírus Influenza se ligam às células alvo por meio de espículas (1), que também são utilizadas para diferenciar os tipos de Influenza. ( ) Após a entrada na célula, o nucleocapsídeo deposita no núcleo celular o material genético de RNA (2), que é replicado (3) e transcrito em RNAm (4). ( ) O RNAm é traduzido (5) em proteínas das espículas (6) e enzimas, dentre estas, a transcriptase reversa que volta ao núcleo celular (7) para sintetizar DNA viral. ( ) A probabilidade é que a disseminação desses vírus seja ainda maior nos períodos de inverno da América do Norte e da Europa. ( ) As vacinas produzidas contra o vírus da gripe são geralmente pouco eficientes devido à variação antigênica das espículas H (hemaglutinina) e N (neuraminidase), o que dificulta o reconhecimento dos vírus pelos anticorpos. 8. (UNIFESP) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vírus influenza A (H1N1), causando perdas econômicas, sociais e de vidas. O referido vírus possui, além de seus receptores proteicos, uma bicamada lipídica e um genoma constituído de 8 genes de RNA. Considerando: 1. a sequência inicial de RNA mensageiro referente a um dos genes deste vírus: Abreviaturas dos aminoácidos Phe = fenilalanina His = histidina Leu = leucina Gin = glutanina IIe = isoleucina Asn = aspargina Met = Iniciar (metionina) Lys = lisina Val = vallina Asp = ácido aspártico Ser = serina Glu = ácido glutâmico Pro = prolina Cys = cisteína Thr = Treonina Trp = triptofano Ala = alanina Arg = arginina Tyr = tirosina Gly = Glicina a) Qual será a sequência de aminoácidos que resultará da tradução da sequência inicial de RNA mensageiro, referente a um dos genes deste vírus indicada em 1?

4 b) Considerando os mecanismos de replicação do genoma viral, qual a principal diferença entre o vírus da gripe e o vírus que causa a AIDS? 9. (MACKENZIE) O ser humano tem travado batalhas constantes contra os vírus. A mais recente é contra o vírus H1N1, que causa a gripe suína. A respeito dos vírus, assinale a alternativa correta. a) São todos endoparasitas celulares. b) Os antibióticos só são eficazes contra alguns tipos. c) Todos eles possuem o DNA e o RNA como material genético. d) Atualmente existem vacinas contra todos os tipos. e) Alguns deles possuem reprodução sexuada. 10. (UFOP) O beneficiamento do lixo urbano e o tratamento da água e do esgoto são medidas essenciais com que todas as cidades devem se preocupar. Considerando essas medidas, ponha V (verdadeira) ou F (falsa) em cada uma das alternativas a seguir. ( ) O beneficiamento do lixo urbano permite a obtenção de gases para a produção de energia e reduz o número de organismos transmissores de doenças. ( ) O beneficiamento do lixo urbano permite o reaproveitamento de material não biodegradável e, a partir da matéria orgânica, a produção de adubos. ( ) Água e esgoto não tratados propiciam a elevação da incidência das hepatites A e B e da disenteria amebiana, devido à presença de vírus e cistos, que saem nas fezes dos indivíduos contaminados. ( ) Água e esgoto não tratados propiciam o aparecimento da esquistossomose, que é causada por vermes do gênero Schistosoma, cujos ovos, presentes nas fezes dos indivíduos doentes, são os agentes infecciosos humanos. A sequência correta é a) V F F - F. b) V V F - F. c) F F V - F. d) V V F - V. 11. (UEL) Leia atentamente o texto adiante e responda as perguntas propostas a seguir: "A gripe é uma das doenças que mais matou na história do homem. Suas epidemias, que ainda ocorrem todo o ano, já assustaram mais do que a AIDS. As epidemias, quase sempre no inverno, ocorrem quando o vírus sofre uma mutação que o torna mais virulento e irreconhecível pelos sistemas imunológicos das pessoas infectadas. As mutações ocorrem numa proteína chamada HA, que fica espetada na membrana do vírus. Toda a interação inicial entre vírus e célula do paciente ocorre através da HA. É ela que os glóbulos brancos reconhecem e procuram atacar. A HA se liga à superfície de uma célula, fazendo com que ela acione suas defesas e "engula" o vírus com uma bolsa digestiva. Dentro dessa bolsa, a célula solta ácidos para digerir o vírus. No entanto, o aumento da acidez provoca a mudança de forma na HA, que faz com que a membrana do vírus se funda com a membrana da célula. Dessa forma, o conteúdo do vírus - seu material genético - é liberado no interior da célula, e ele continua sua reprodução sem ser molestado." a) Por que o sistema imunológico de uma pessoa não reconhece um vírus mutante, mesmo que já tenha tido uma forma da doença? b) Explique como o vírus consegue "enganar" uma célula e infectá-la. 12. (UEG) A figura representada a seguir refere-se ao ranking dos principais municípios goianos com maiores números absolutos de casos de dengue registrados até o mês de março do corrente ano, segundo informações da Gerência de Vigilância Epidemiológica da Secretaria Estadual de Saúde do estado de Goiás. Acerca destas informações, responda ao que se pede: a) cite dois fatores que explicam a diferença entre a ocorrência de casos em Goiânia com os demais municípios apresentados;

5 b) explique como se dá a transmissão da dengue. 13. (UERJ) A gripe conhecida popularmente como gripe suína é causada por um vírus influenza A. Esse tipo de vírus se caracteriza, dentre outros aspectos, por: - ser formado por RNA de fita simples (-), incapaz de atuar como RNA mensageiro ou de sintetizar DNA nas células parasitadas; - os RNA complementares do RNA viral poderem ser traduzidos em proteínas pelo aparelhamento celular. Os esquemas a seguir apresentam um resumo de etapas dos processos de replicação de alguns dos vírus RNA, após penetrarem nas células. O tipo de replicação encontrado no vírus infuenza A está representado no esquema de número: a) I b) II c) III d) IV 14. (UNESP) Dengue tipo 4 reaparece após 25 anos A dengue é causada por quatro tipos de vírus: DENV-1, DENV-2, DENV-3 e DENV-4. O tipo DENV-4 não era encontrado no país desde 1982, mas exames de sangue feitos em Manaus mostram que a dengue tipo 4 está de volta ao país. Embora a infecção causada pelo DENV-4 não seja, por si só, muito agressiva, o retorno dela é, ainda assim, uma má notícia para a saúde pública brasileira. Isso porque aumenta a possibilidade de que as pessoas desenvolvam a forma hemorrágica da doença, muito mais letal. (Notícia veiculada por diferentes agências, março de 2009.) Em razão do contido na notícia, pode-se afirmar que, antes do reaparecimento do vírus DENV-4, a) eram menores as possibilidades de as pessoas desenvolverem a forma hemorrágica da doença, pois os tipos virais, embora mais agressivos que o vírus DENV- 4, raramente levavam ao quadro hemorrágico. Com o reaparecimento de uma quarta variante viral, menos agressiva, porém letal, a questão da dengue no Brasil agravou-se. b) havia no Brasil apenas três tipos virais e, portanto, eram três as diferentes possibilidades de uma pessoa adquirir dengue. Com o reaparecimento de um quarto tipo, a possibilidade de se adquirir dengue passou a ser 25% maior. A dengue adquirida a partir de qualquer um desses quatro tipos de vírus, se não tratada pode evoluir para a forma hemorrágica da doença. c) havia no Brasil apenas três tipos virais e, portanto, a possibilidade de as pessoas virem a adquirir a dengue era menor. O reaparecimento do vírus DENV-4 aumentou a possibilidade de as pessoas terem um primeiro contato com qualquer uma das variantes virais e, consequentemente, desenvolver a dengue, que, se não tratada, pode evoluir para a forma hemorrágica da doença. d) uma pessoa que tenha adquirido dengue poderia vir a desenvolver a forma hemorrágica da doença se entrasse em contato com mais um dentre os dois outros tipos virais. Com o reaparecimento de um quarto tipo viral, aumenta a possibilidade de que esta pessoa entre em contato com um tipo diferente e desenvolva a forma hemorrágica da doença. e) uma pessoa que tenha adquirido dengue poderia vir a desenvolver a forma hemorrágica da doença se entrasse novamente em contato com o tipo a partir da qual desenvolveu a doença. Com o reaparecimento de um quarto tipo viral, aumenta a possibilidade de que esta pessoa entre em contato com uma variante de mesmo tipo e desenvolva a forma hemorrágica da doença. 15. (UFG) A dengue é uma doença caracterizada, dentre outros sintomas, por fortes dores de cabeça, febre e diminuição das plaquetas sanguíneas. Uma

6 dificuldade no combate ao Aedes aegypti, mosquito vetor dessa doença, é sua elevada capacidade de reprodução em ambientes com água parada. A tabela a seguir apresenta dados sobre as fases do ciclo de vida desse vetor. Relação de diferentes temperaturas do ar e do número de indivíduos das diferentes fases do ciclo de vida de Aedes aegypti em ambientes urbano e natural. Temper atura do ar ( C) 25 C 30 C 35 C 40 C Número de ovos Cid ade Flor esta Número de larvas Cid ade Flor esta Número de adultos Cid ade Flor esta Com base nos dados apresentados, explique: a) a relação direta entre a temperatura e o número de indivíduos observados nas diferentes fases desses insetos; b) a causa da maior incidência das diferentes fases desses insetos em ambientes urbanos quando comparados com o ambiente natural. GABARITO 1: [A] A região Nordeste sofreu, no período de 1996 a 2005, uma epidemia de dengue em razão da concentração da população nas cidades, fato que facilitou a proliferação do vetor Aedes aegyptis, o mosquito transmissor do vírus da dengue. 2: Bactéria, B; bacteriófago, A. As bactérias possuem divisão binária, por isso seu número dobra a cada ciclo. Os bacteriófagos são vírus que infectam as bactérias e utilizam seu metabolismo para formar novos vírus. A cada ciclo lítico, um único bacteriófago gera muitos outros. 3: [B] Apenas o DNA de um bacteriófago entra na célula bacteriana. Como bactérias não possuem núcleo, espera-se que o citoplasma fique com a coloração azul devido à presença do DNA viral marcado com fluorescência daquela cor. 4: [E] Os vírus, por serem acelulares, não são classificados em nenhum dos cinco Reinos. As hemácias têm a função de transportar o gás oxigênio para as células e tecidos, não possuem função de defesa. O RNA é formado por uma cadeia simples de nucleotídeos. 5: [D] A afirmativa 1 é falsa, pois retrovírus endógenos surgem de mutações em retrovírus preexistentes, não de genes mutantes do próprio organismo. A afirmativa 3 é falsa porque o material genético de um retrovírus endógeno pode ser encontrado no núcleo das células infectadas. As afirmativas 2 e 4 são verdadeiras. 6: [C] Os vírus não são seres vivos, pois são acelulares, apesar de terem material genético e de, quando considerados como populações, modificarem-se ao longo do tempo. 7: VVFVV Verdadeiro: os vírus Influenza possuem espículas H (hemaglutinina) e N (neuraminidase), o que permite sua diferenciação, por exemplo: H1N1 (Influenza humano), H5N1 (Influenza aviária) etc; se ligam às células alvo por meio de espículas H. Verdadeiro: os vírus Influenza apresentam material genético de RNA que é replicado, para formar cópias do material genético viral e transcrito em RNAm, para a síntese de proteínas. Falso: os vírus Influenza não possuem a enzima transcriptase reversa e não transcrevem seu RNA em DNA. Algumas proteínas se dirigem ao núcleo (7) para auxiliar na composição do nucleocapsídeo viral. As espículas virais, formadas no citoplasma, se associam primeiramente a membrana celular (6) e, após o brotamento da célula, estes vírus carregam uma parte da membrana com as espículas para compor o envelope viral. Verdadeiro: as baixas temperaturas no inverno aumentam a frequência de doenças respiratórias na população, entre elas, a gripe, aumentando a chance de novas recombinações genéticas ou mutações nos subtipos virais.

7 Verdadeiro: as espículas H e N representam os principais antígenos virais do Influenza que estimulam a produção de anticorpos. Todavia, frequentemente, sofrem modificações decorrentes de mutações ou recombinações genéticas, o que dificulta suas utilizações como alvos de vacinas. 8: a) A sequência de aminoácidos que resultará da tradução da sequência inicial de RNA mensageiro indicada na questão será: metionina arginina tirosina ácido glutâmico triptofano tirosina alanina tirosina. b) O vírus da gripe contém RNA viral, que, por pareamento complementar, produz cópias desse RNA, que posteriormente serão incorporados aos novos vírus. O vírus HIV é um retrovírus. Seu RNA forma, no núcleo da célula hospedeira, uma cadeia de DNA através de uma transcrição reversa. Na sequência, o DNA viral gerado dará origem a RNA viral que se incorporará aos novos vírus. 9: [A] A alternativa A é a correta. Todos os vírus são endoparasitas celulares obrigatórios, pois necessitam utilizar os recursos bioquímicos de uma célula para sua reprodução. Os vírus possuem DNA ou RNA como material genético, nunca os dois juntos. 10: [B] A hepatite B é uma virose transmitida por meio de relações sexuais, transfusões sanguíneas e contato com sangue ou secreções humanas contaminadas com o agente etiológico (exemplo: compartilhamento de seringas entre usuários de drogas injetáveis). A esquistossomose é adquirida pelo homem por meio da penetração ativa de larvas cercarias presentes em coleções de água doce infestadas por caramujos transmissores. síntese de proteínas virais. Algumas das moléculas de RNA viral complementar permanecem no núcleo e são utilizadas como molde para a produção de RNA viral, que constituirão o material genético dos novos vírus. 14: [D] Se um indivíduo que já contraiu anteriormente um tipo de dengue contrair posteriormente um tipo diferente dessa virose, poderá desenvolver a forma hemorrágica da doença. Dessa forma, com o reaparecimento do quarto tipo de vírus da dengue, as probabilidades de uma pessoa adquirir dengue hemorrágica aumentam. 15: a) Quanto maior a temperatura, maior o número de indivíduos, pois a elevação de temperatura reflete a elevação do metabolismo e o aumento das divisões celulares, resultando em maior taxa de crescimento nas diferentes fases desses insetos. b) A maior incidência das diferentes fases do ciclo de vida de Aedes aegypti em áreas urbanas se deve a uma maior adaptação dessa espécie em áreas úmidas com água parada (lixo, caixas d água, pneus velhos etc.), além do fato de que, em áreas urbanas, os inimigos naturais (predadores) dessas diferentes fases de desenvolvimento (ovo, larva e adulto) desse inseto ocorrem em baixa frequência ou inexistem, enquanto em áreas naturais existem predadores em maior riqueza e abundância. 11: a) Porque ocorre uma mudança no seu material genético, fazendo com que mude a proteína de associação do vírus tornando-o irreconhecível pelo sistema imunológico, que identifica o vírus por essa proteína. b) Alterando sua proteína de associação, chamada HA, que se funde com a membrana da célula. 12: a) Desigualdades sociais, condições de habitação (infraestrutura urbana), perfil sócio cultural da população. b) A transmissão se dá pela picada do mosquito Aedes agegypti, que ficou infectado porque picou uma pessoa doente. Esse mosquito infectado, picando uma pessoa sadia passa o vírus do dengue e esta pessoa fica doente. A doença só acomete a população humana. 13: [B] As moléculas de RNA viral são utilizadas como molde para produzir moléculas complementares, as quais saem para o citoplasma e atuam como RNAm na

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Vírus - Características Gerais. Seres acelulares Desprovidos de organização celular. Não possuem metabolismo próprio

Vírus - Características Gerais. Seres acelulares Desprovidos de organização celular. Não possuem metabolismo próprio vírus Vírus - Características Gerais Seres acelulares Desprovidos de organização celular Não possuem metabolismo próprio Capazes de se reproduzir apenas no interior de uma célula viva nucleada Parasitas

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS Estrutura de um bacteriófago Proteína cabeça DNA cauda Proteínas cromossomo bacteriano Fago DNA Como pode cair no enem (MACKENZIE) O ser humano tem travado batalhas constantes

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo.

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo. BIOLOGIA 01. Considere o enunciado abaixo e as três propostas para completá-lo. Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactérias, observou que elas eram incapazes de crescer

Leia mais

1. Os textos a seguir apresentam notícias na mídia sobre duas doenças: a AIDS e a Dengue.

1. Os textos a seguir apresentam notícias na mídia sobre duas doenças: a AIDS e a Dengue. 1. Os textos a seguir apresentam notícias na mídia sobre duas doenças: a AIDS e a Dengue. HIV-2 é identificado em 15 pacientes no Brasil São Paulo estudo realizado pela Fiocruz confirmou a presença de

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 35 VÍRUS

BIOLOGIA - 1 o ANO MÓDULO 35 VÍRUS BIOLOGIA - 1 o ANO MÓDULO 35 VÍRUS Como pode cair no enem? Sobre os vírus, podemos afirmar que: a) A transmissão dos vírus das plantas ocorre exclusivavamente por difusão mecânica, ou seja, quando uma

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais

6) (ANÁPOLIS) Dois seres vivos pertencentes à mesma ordem são necessariamente:

6) (ANÁPOLIS) Dois seres vivos pertencentes à mesma ordem são necessariamente: Lista de Exercícios Pré Universitário Uni-Anhanguera Aluno(a): Nº. Professor: Mário Neto Série: 1 Ano Disciplina: Biologia 1) Com que finalidade se classificam os seres vivos? 2) Considere os seguintes

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

DISCIPLINA: Ciências da Natureza SÉRIE: 3º. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

DISCIPLINA: Ciências da Natureza SÉRIE: 3º. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2015 PROFESSOR: Mário Neto DISCIPLINA: Ciências da Natureza SÉRIE: 3º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

Leia mais

2º ano do Ensino médio Lista de exercícios sobre vírus e bactérias

2º ano do Ensino médio Lista de exercícios sobre vírus e bactérias 1 2º ano do Ensino médio Lista de exercícios sobre vírus e bactérias 1) A palavra vírus vem do Latim virus que significa fluido venenoso ou toxina. Sobre os vírus biológicos, é correto afirmar-se que a)

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

VÍRUS. DISCIPLINA: BIOLOGIA http://danutaw.webnode.com.br

VÍRUS. DISCIPLINA: BIOLOGIA http://danutaw.webnode.com.br VÍRUS DISCIPLINA: BIOLOGIA 1. CARACTERÍSTICAS GERAIS DOS VÍRUS - 20 a 300 nm; Micrômetro Nanômetro UNIDADE REPRESENTAÇÃO / VALOR 1 μm = 0,001 milímetro 1 nm = 0,001 micrômetro - Ácido nucléico + proteína

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Biologia. Diversidade da Vida Capítulo 2 Vírus: apesar de pequenos...

Biologia. Diversidade da Vida Capítulo 2 Vírus: apesar de pequenos... 1. (UFSC) Do mesmo modo que os vírus de computador estragam programas inteiros e podem comprometer seriamente o disco rígido, tornando-o imprestável, os vírus biológicos funcionam como verdadeiros hackers

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

VÍRUS. Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html

VÍRUS. Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html VÍRUS Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html RESUMO -Os vírus não pertencem a nenhum reino específico, são estudados como um caso à parte. -Os vírus são

Leia mais

Várias classificações já foram propostas. Adotaremos a classificação proposta por Whittaker e adotada pelo naturalista sueco Lineu (1707-1778).

Várias classificações já foram propostas. Adotaremos a classificação proposta por Whittaker e adotada pelo naturalista sueco Lineu (1707-1778). NOMENCLATURA CIENTÍFICA E AS CATEGORIAS TAXONÔMICAS Nome científico de uma espécie Para escrevermos o nome científico de uma espécie, utilizamos as regras propostas por Lineu: 1. O nome deve ser escrito

Leia mais

Exercícios de Monera e Principais Bacterioses

Exercícios de Monera e Principais Bacterioses Exercícios de Monera e Principais Bacterioses 1. (Fuvest) O organismo A é um parasita intracelular constituído por uma cápsula protéica que envolve a molécula de ácido nucléico. O organismo B tem uma membrana

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Bioquímica ENZIMAS ÁC. NUCLEICOS

Bioquímica ENZIMAS ÁC. NUCLEICOS Bioquímica ENZIMAS ÁC. NUCLEICOS As enzimas são substâncias orgânicas, geralmente proteínas, que catalisam reações biológicas pouco espontâneas e muito lentas. O poder catalítico de uma enzima relaciona

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

BATERIA DE EXERCÍCIOS Nº 02 7º ANO

BATERIA DE EXERCÍCIOS Nº 02 7º ANO Professor: CRISTINO RÊGO Disciplina: CIÊNCIAS Assunto: BIODIVERSIDADE, CLASSIFICAÇÃO E VÍRUS Belém /PA BATERIA DE EXERCÍCIOS Nº 02 7º ANO 1 - Entre as doenças abaixo, assinale a alternativa que contem

Leia mais

A maioria dos vírus mede entre 15 e 300 nanometros (nm);

A maioria dos vírus mede entre 15 e 300 nanometros (nm); Vírus são as menores entidades biológicas conhecidas; A maioria dos vírus mede entre 15 e 300 nanometros (nm); Um dos maiores vírus conhecidos, que causa a varíola humana, tem cerca 300 nm (0,3 µm), e

Leia mais

C n o c n e c i e tos o s i ni n ci c ai a s C n o c n e c i e tos o s i ni n ci c ai a s

C n o c n e c i e tos o s i ni n ci c ai a s C n o c n e c i e tos o s i ni n ci c ai a s Conceitos iniciais Parasita: organismo que vive em associação com outros e dos quais retiram os meios para a sua sobrevivência, normalmente prejudicando o organismo hospedeiro. Hospedeiro: organismo que

Leia mais

BIOLOGIA BIOQUÍMICA PROF ESTEVAM

BIOLOGIA BIOQUÍMICA PROF ESTEVAM BIOLOGIA BIOQUÍMICA PROF ESTEVAM 1) (MACK-96) Considere as duas relações abaixo. I- Ferro 1- Essencial à coagulação do sangue. II- Potássio 2- Componente dos hormônios da tireóide. III- Iodo 3- Principal

Leia mais

VÍRUS (complementar o estudo com as páginas 211-213 do livro texto)

VÍRUS (complementar o estudo com as páginas 211-213 do livro texto) COLÉGIO E CURSO INTELECTUS APOSTILA NOME: MAT.: Biologia I PROFº: EDUARDO SÉRIE: TURMA: DATA: VÍRUS (complementar o estudo com as páginas 211-213 do livro texto) Os vírus são os únicos organismos acelulares,

Leia mais

VIRUS O QUE SÃO VIRUS São as menores entidades biológicas: têm DNA e proteínas. Medem entre 15 e 300 nm. São seres acelulares: São parasitas intracelulares obrigatórios: Só se reproduzem dentro de células.

Leia mais

ESTRUTURA VIRAL. Visualização: apenas ao ME. Não apresentam estrutura celular (acelulares) Estrutura básica: Cápsula protéica (capsídeo)

ESTRUTURA VIRAL. Visualização: apenas ao ME. Não apresentam estrutura celular (acelulares) Estrutura básica: Cápsula protéica (capsídeo) VÍRUS CARACTERÍSTICAS Organismos acelulares Não possuem metabolismo Características vitais: Reprodução Evolução Possui grande capacidade proliferativa Só se reproduz no interior de células que estejam

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

Seres muito simples: cápsula protéica envolvendo o material genético (DNA ou RNA) Vírus que infectam Bactérias

Seres muito simples: cápsula protéica envolvendo o material genético (DNA ou RNA) Vírus que infectam Bactérias Seres muito simples: cápsula protéica envolvendo o material genético (DNA ou RNA) Estrutura de Vírus Menores que as menores células conhecidas Vírus que infectam Bactérias Exemplo: vírus que infectam a

Leia mais

A genética do vírus da gripe

A genética do vírus da gripe A genética do vírus da gripe Para uma melhor compreensão das futuras pandemias é necessário entender sobre as pandemias passadas e os fatores que contribuem para a virulência, bem como estabelecer um compromisso

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Aula 8 Síntese de proteínas

Aula 8 Síntese de proteínas Aula 8 Síntese de proteínas As proteínas que podem ser enzimas, hormônios, pigmentos, anticorpos, realizam atividades específicas no metabolismo dos seres vivos. São produzidas sob o comando do DNA. Observe

Leia mais

No espaço ao lado de cada definição, escreva claramente a letra do termo apropriado da lista de termos fornecida na página 21.

No espaço ao lado de cada definição, escreva claramente a letra do termo apropriado da lista de termos fornecida na página 21. Questão 1 No espaço ao lado de cada definição, escreva claramente a letra do termo apropriado da lista de termos fornecida na página 21. Um DNA curto, de filamento único, que serve como o material de partida

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Retrovírus: AIDS. Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos

Retrovírus: AIDS. Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos Retrovírus: AIDS Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos HIV (Vírus da Imunodeficiência Humana) Surgimento: -Provável origem durante

Leia mais

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial?

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial? Q.01 Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo nome, enquanto outros estão

Leia mais

VIROSES. Prof. Edilson Soares www.profedilson.com

VIROSES. Prof. Edilson Soares www.profedilson.com VIROSES Prof. Edilson Soares www.profedilson.com CATAPORA OU VARICELA TRANSMISSÃO Saliva Objetos contaminados SINTOMAS Feridas no corpo PROFILAXIA Vacinação HERPES SIMPLES LABIAL TRANSMISSÃO Contato

Leia mais

COMISSÃO PERMANENTE DE SELEÇÃO COPESE PRÓ-REITORIA DE GRADUAÇÃO PROGRAD VESTIBULAR 2011 PROVA DE BIOLOGIA

COMISSÃO PERMANENTE DE SELEÇÃO COPESE PRÓ-REITORIA DE GRADUAÇÃO PROGRAD VESTIBULAR 2011 PROVA DE BIOLOGIA Questão 1: É sabido que indivíduos homozigotos recessivos para alelos mutados do gene codificador da enzima hexosaminidase desenvolvem uma doença conhecida como Tay-Sachs, e morrem antes do quarto ano

Leia mais

FEBRE AMARELA: Informações Úteis

FEBRE AMARELA: Informações Úteis FEBRE AMARELA: Informações Úteis Quando aparecem os sintomas? Os sintomas da febre amarela, em geral, aparecem entre o terceiro e o sexto dia após a picada do mosquito. Quais os sintomas? Os sintomas são:

Leia mais

Fuvest 2005 2ª fase BIOLOGIA

Fuvest 2005 2ª fase BIOLOGIA Fuvest 2005 2ª fase BIOLOGIA 1. Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo

Leia mais

CORPO DE BOMBEIRO MILITAR DO DISTRITO FEDERAL DIRETORIA DE ENSINO E INSTRUÇÃO - CENTRO DE ASSISTÊNCIA AO ENSINO COLÉGIO MILITAR DOM PEDRO II

CORPO DE BOMBEIRO MILITAR DO DISTRITO FEDERAL DIRETORIA DE ENSINO E INSTRUÇÃO - CENTRO DE ASSISTÊNCIA AO ENSINO COLÉGIO MILITAR DOM PEDRO II CORPO DE BOMBEIRO MILITAR DO DISTRITO FEDERAL DIRETORIA DE ENSINO E INSTRUÇÃO - CENTRO DE ASSISTÊNCIA AO ENSINO COLÉGIO MILITAR DOM PEDRO II Estudo Dirigido de Biologia Vírus e Doenças virais 1) (Vunesp)

Leia mais

CARACTERÍSTICAS DOS VÍRUS

CARACTERÍSTICAS DOS VÍRUS CAPÍTULO 2 p. 25 VÍRUS os seres de organização mais simples O rapaz acordou gripado. Escovou os dentes. Pouco comeu, apenas queijo. Quais são os seres vivos envolvidos nessa situação? GRIPE ESPANHOLA -1918

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

UFABC Bacharelado em Ciência & Tecnologia

UFABC Bacharelado em Ciência & Tecnologia UFABC Bacharelado em Ciência & Tecnologia Transformações Bioquímicas (BC0308) Prof Luciano Puzer http://professor.ufabc.edu.br/~luciano.puzer/ Propriedades, funções e transformações de aminoácidos e proteínas

Leia mais

Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013

Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013 Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013 1. A origem da vida na Terra 1) A 2) B 3) E 4) E 5) C 6) C 7) C 8) C 9) D 10) C 11) A 12) C 13) C 14) B 15) D 2. A evolução biológica

Leia mais

Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia

Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia VIROLOGIA Prof. Me Leandro Parussolo Introdução à Virologia Vírus (latim = veneno ); Classe de agentes

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

ESTRUTURA DOS VÍRUSV

ESTRUTURA DOS VÍRUSV Departamento de Microbiologia Disciplina de Virologia Básica ESTRUTURA DOS VÍRUSV Fabrício Souza Campos Mestrando do PPG em Microbiologia Agrícola e do Ambiente Adaptado Prof. Dr. Paulo Roehe EXISTEM VÍRUS

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

GABARITO AULA DA CECÍLIA BIO 03 VIRUS, BACTÉRIAS, FUNGOS E PROTOZOÁRIOS. Gabarito:

GABARITO AULA DA CECÍLIA BIO 03 VIRUS, BACTÉRIAS, FUNGOS E PROTOZOÁRIOS. Gabarito: GABARITO AULA DA CECÍLIA BIO 03 VIRUS, BACTÉRIAS, FUNGOS E PROTOZOÁRIOS Gabarito: 1) a) Porque ocorre uma mudança no seu material genético, fazendo com que mude a proteína de associação do vírus tornando-o

Leia mais

e o processo de liberação de energia em nível celular, explique o que ocorre nas células do miocárdio em uma situação de infarto.

e o processo de liberação de energia em nível celular, explique o que ocorre nas células do miocárdio em uma situação de infarto. BIOLOGIA UNIFESP. DIA 1 Acidentes cardiovasculares estão entre as doenças que mais causam mortes no mundo. Há uma intricada relação de fatores, incluindo os hereditários e os ambientais, que se conjugam

Leia mais

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado Biologia-Geologia 11ºano Novembro de 2006 Científico-Humanísticos Curso Ciências e Tecnologias A hemoglobina Cada molécula de hemoglobina consiste em dois pares separados de globinas alfa e beta (cadeias

Leia mais

Cartilha da Influenza A (H1N1)

Cartilha da Influenza A (H1N1) Cartilha da Influenza A (H1N1) Agosto 2009 SECRETARIA MUNICIPAL DE SAÚDE SECRETARIA ADJUNTA DE ATENÇÃO INTEGRADA Á SAÚDE DEPARTAMENTO DE VIGILÂNCIA EM SAÚDE Micarla de Sousa Prefeita da Cidade do Natal

Leia mais

Vírus e Viroses. Professora Gilcele

Vírus e Viroses. Professora Gilcele Vírus e Viroses Professora Gilcele Quais são as principais características dos vírus? - São organismos acelulares; - São parasitas intracelulares obrigatórios; - Não possuem metabolismo próprio, portanto

Leia mais

Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: Microbiologia Aula 8 1.

Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: Microbiologia Aula 8 1. Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: Microbiologia Aula 8 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 2 4. Vírus:

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 36 PRINCIPAIS VIROSES

BIOLOGIA - 1 o ANO MÓDULO 36 PRINCIPAIS VIROSES BIOLOGIA - 1 o ANO MÓDULO 36 PRINCIPAIS VIROSES Variedade de influenza A de aves Ave hospedeira antigeno NA antigeno HA A-1 Sem sofrer mudança genética, uma variedade da Influenza A de aves pode saltar

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec Guia mangá Biologia Molecular Masaharu Takemura Sakura Becom Co., Ltd. novatec Original Japanese-language edition Manga de Wakaru Bunshi Seibutsugaku ISBN 978-4-274-06702-0 2008 by Masaharu Takemura and

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

PROF. LUCIANO MAGUARY TURMA DE MEDICINA UP-2013. Vírus

PROF. LUCIANO MAGUARY TURMA DE MEDICINA UP-2013. Vírus PROF. LUCIANO MAGUARY TURMA DE MEDICINA UP-2013 Vírus Virologia: Início no final do século XIX; Agentes infecciosos capazes de passar por filtros que retinham bactérias; Evolução técnico-científica; Nem

Leia mais

4. CLASSIFICAÇÃO DOS SERES VIVOS QUESTÃO 47 até 55

4. CLASSIFICAÇÃO DOS SERES VIVOS QUESTÃO 47 até 55 4. CLASSIFICAÇÃO DOS SERES VIVOS QUESTÃO 47 até 55 QUESTÃO - 47 A distribuição dos seres vivos em cinco Reinos (Monera, Protista, Fungi, Vegetal, Animal) foi proposta em 1969 pelo cientista norte-americano

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Vírus - conceito (Enciclopédia Britânica)

Vírus - conceito (Enciclopédia Britânica) Vírus - conceito (Enciclopédia Britânica) Partículas infecciosas de tamanho pequeno e composição simples que multiplicam-se somente em células vivas (animais, plantas, insetos, peixes, bactérias, etc)

Leia mais

Gripe A (H1N1) de origem suína

Gripe A (H1N1) de origem suína Gripe A (H1N1) de origem suína A gripe é caracterizada como uma doença infecciosa com alto potencial de contagio causado pelo vírus Influenza. Este vírus apresenta três tipos, sendo eles o A, B e C. Observam-se

Leia mais

INTRODUÇÃO À VIROLOGIA MORFOLOGIA E CLASSIFICAÇÃO VIRAL. Larissa dos Santos Professora Auxiliar de Virologia larissa.ss@gmail.com

INTRODUÇÃO À VIROLOGIA MORFOLOGIA E CLASSIFICAÇÃO VIRAL. Larissa dos Santos Professora Auxiliar de Virologia larissa.ss@gmail.com INTRODUÇÃO À VIROLOGIA MORFOLOGIA E CLASSIFICAÇÃO VIRAL Larissa dos Santos Professora Auxiliar de Virologia larissa.ss@gmail.com APRESENTAÇÃO Site: virologia UFF http://www.proac.uff.br/virologia/ Livros:

Leia mais

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01 BOLOGA TPO 1 QUESTÃO 01 Leia o trecho a seguir. No processo evolutivo, muitos animais foram extintos depois de se diferenciarem de seus parentes mais próximos. Boa parte deles virou fóssil e, quando descobertos,

Leia mais

Caso tenha dúvidas entre em contato conosco através do e-mail Biologia.sem.duvidas@gmail.com ou

Caso tenha dúvidas entre em contato conosco através do e-mail Biologia.sem.duvidas@gmail.com ou Professor Fernanda & Suellen Disciplina Biologia Lista nº 2 Assuntos Biomédicas Lista ENEM complemento do projeto UERJ Caso tenha dúvidas entre em contato conosco através do e-mail Biologia.sem.duvidas@gmail.com

Leia mais

BIOLOGIA. Questões de 01 a 06. 01. As figuras abaixo representam organelas e estruturas citoplasmáticas.

BIOLOGIA. Questões de 01 a 06. 01. As figuras abaixo representam organelas e estruturas citoplasmáticas. GRUPO 2 BIO. 1 BIOLOGIA Questões de 01 a 06 01. As figuras abaixo representam organelas e estruturas citoplasmáticas. (Adaptado de CÉSAR & SEZAR, Biologia. São Paulo: Saraiva, vol 1, 1995.) Com base nas

Leia mais

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático)

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) VIRUS CONCEITOS E DEFINIÇÕES Características: 1. Não têm estrutura celular, mas multiplicam-se»

Leia mais

::: Fonte Do Saber - Mania de Conhecimento :::

::: Fonte Do Saber - Mania de Conhecimento ::: Virus adsense1 Vírus adsense2 Ser vivo microscópico e acelular (não é composto por células) formado por uma molécula de ácido nucléico (DNA ou RNA), envolta por uma cápsula protéica. Apresenta-se sob diferentes

Leia mais

Resolução Resolução OBJETIVO 2004

Resolução Resolução OBJETIVO 2004 1 Nas bactérias, a cadeia respiratória encontra-se associada à membrana plasmática e os ácidos nucléicos estão associados ao citoplasma. a) É assim também em um protista, em um animal e em um vegetal?

Leia mais

AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS

AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS AULA 1 ORGANIZAÇÃO CELULAR DOS SERES VIVOS Apesar da diversidade entre os seres vivos, todos guardam muitas semelhanças, pois apresentam material genético (DNA) em que são encontradas todas as informações

Leia mais

Multicausalidade das doenças Conceitos básicos

Multicausalidade das doenças Conceitos básicos Biologia 1ª série Multicausalidade das doenças Conceitos básicos Profª Reisila Mendes Saúde é o estado de completo bem-estar físico, mental e social e não apenas a ausência de doença. Homeostase Equilíbrio

Leia mais

COLÉGIO SOUZA MARQUES Rio de Janeiro,... de... de 2012. Professora: Priscilla Moniz Aluno(a):...Turma: 611 Nº:

COLÉGIO SOUZA MARQUES Rio de Janeiro,... de... de 2012. Professora: Priscilla Moniz Aluno(a):...Turma: 611 Nº: COLÉGIO SOUZA MARQUES Rio de Janeiro,... de... de 2012. Professora: Priscilla Moniz Aluno(a):...Turma: 611 Nº: GABARITO 1. (0,5) (UPE) Dentre as categorias taxonômicas apresentadas abaixo, assinale aquela

Leia mais

Biologia Professor Leandro Gurgel de Medeiros

Biologia Professor Leandro Gurgel de Medeiros Biologia Professor Leandro Gurgel de Medeiros Vírus e Viroses 1. O que são Vírus? Os vírus são definidos com base em suas propriedades: São considerados entidades biológicas e não seres vivos; São parasitas

Leia mais

Influência da Genética desempenho

Influência da Genética desempenho UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA Aluno: Módulo I Professor: Leandro Parussolo Unidade Curricular: Biologia Celular ATIVIDADE

Leia mais

Informativo Empresarial Especial

Informativo Empresarial Especial Informativo Empresarial Especial Gripe Suína Plano de Contingência Empresarial A Gripe Influenza A H1N1 e o Transporte Rodoviário A gripe que ficou conhecida como gripe suína é causada por vírus que se

Leia mais

ESCOLA ESTADUAL DR. JOSÉ MARQUES DE OLIVEIRA - ANO 2014. Trabalho de Estudos Independentes Biologia Janeiro/2015

ESCOLA ESTADUAL DR. JOSÉ MARQUES DE OLIVEIRA - ANO 2014. Trabalho de Estudos Independentes Biologia Janeiro/2015 ESCOLA ESTADUAL DR. JOSÉ MARQUES DE OLIVEIRA - ANO 2014 Trabalho de Estudos Independentes Biologia Janeiro/2015 Nome Nº Turma 2º EJA Data Nota Disciplina Biologia Prof. Marisa Medeiros Teixeira Valor 30

Leia mais

UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL INSTITUTO DE CIÊNCIAS BÁSICAS DA SAÚDE DEPARTAMENTO DE MICROBIOLOGIA, IMUNOLOGIA E PARASITOLOGIA

UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL INSTITUTO DE CIÊNCIAS BÁSICAS DA SAÚDE DEPARTAMENTO DE MICROBIOLOGIA, IMUNOLOGIA E PARASITOLOGIA UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL INSTITUTO DE CIÊNCIAS BÁSICAS DA SAÚDE DEPARTAMENTO DE MICROBIOLOGIA, IMUNOLOGIA E PARASITOLOGIA REPLICAÇÃO VIRAL FABRÍCIO SOUZA CAMPOS* *Dr, MSc, Medico Veterinário

Leia mais

Ministério da Saúde esclarece as principais dúvidas sobre a doença e apresenta recomendações para viajantes internacionais.

Ministério da Saúde esclarece as principais dúvidas sobre a doença e apresenta recomendações para viajantes internacionais. Ministério da Saúde esclarece as principais dúvidas sobre a doença e apresenta recomendações para viajantes internacionais. Fonte: Agência Fiocruz 1. Há casos de influenza A (H1N1) no Brasil? Não. Até

Leia mais