COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI"

Transcrição

1 COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO MURTA TEXTO COMPLEMENTAR 03 / 2015: CÓDIGO GENÉTICO / TRADUÇÃO PRIMEIRA BASE URACILA (U) CITOSINA (C) ADENINA (A) GUANINA (G) SEGUNDA BASE U C A G TERCEIRA BASE PHE SER TYR CYS U PHE SER TYR CYS C LEU SER FIM FIM A LEU SER FIM TRP G LEU PRO HIS ARG U LEU PRO HIS ARG C LEU PRO GLN ARG A LEU PRO GLN ARG G ILE THR ASN SER U ILE THR ASN SER C ILE THR LYS ARG A MET / INÍCIO THR LYS ARG G VAL ALA ASP GLY U VAL ALA ASP GLY C VAL ALA GLU GLY A VAL ALA GLU GLY G OBS.: O código genético é elaborado a partir das sequências de triplets, trios ou tríades de nucleotídeos (bases) do RNA mensageiro (RNA m ), também denominadas códons. LEGENDA PHE: FENILALANINA (2 CÓDONS). LEU: LEUCINA (6 CÓDONS). ILE: ISOLEUCINA (3 CÓDONS). MET: METIONINA (1 CÓDON) VAL: VALINA (4 CÓDONS). SER: SERINA (6 CÓDONS). PRO: PROLINA (4 CÓDONS). THR: TREONINA (4 CÓDONS). ALA: ALANINA (4 CÓDONS). TYR: TIROSINA (2 CÓDONS). HIS: HISTIDINA (2 CÓDONS). GLN: GLUTAMINA (2 CÓDONS). ASN: ASPARAGINA (2 CÓDONS). LYS: LISINA (2 CÓDONS). ASP: ÁCIDO ASPÁRTICO (2 CÓDONS). GLU: ÁCIDO GLUTÂMICO (2 CÓDONS). CYS: CISTEÍNA (2 CÓDONS). TRP: TRIPTOFANO (1 CÓDON). ARG: ARGININA (6 CÓDONS). GLY: GLICINA (4 CÓDONS). FIM: SEM SENTIDO (3 CÓDONS). COLÉGIO PEDRO II TEXTO COMPLEMENTAR 03 / 2015 PÁGINA 1 DE 5

2 OBSERVAÇÕES: 1. O número de códons diferentes existentes (64) sustenta a tese de que o código é estabelecido a partir de tríades de bases (4 bases combinadas 3 a 3 [4 3 = 64]). 2. O código genético é dito degenerado (ou repetitivo), uma vez que há aminoácidos que são codificados por mais do que um códon diferente (a recíproca não é verdadeira, isto é, dois aminoácidos diferentes não podem ser codificados pelo mesmo códon) e universal, uma vez que ele é válido para todos os seres vivos, ou seja, estes códons codificam os mesmos aminoácidos em qualquer organismo vivo. Há exceções apenas para o código observado no RNA de mitocôndrias, cloroplastos e algumas espécies unicelulares (tabela 1). 3. O códon AUG codifica, além do aminoácido metionina, o início da síntese proteica pela tradução do código contido no RNA m. 4. Os códons UAA, UAG e UGA são ditos sem sentido ( stop, nonsense ou parada ) ou terminalizadores porque não codificam aminoácidos, mas, ao contrário, determinam a parada da tradução do RNA m, uma vez que não existem, nos RNA t, anticódons específicos para eles. 5. Os genes de organismos eucarióticos são denominados monocistrônicos, pois codificam um único peptídeo, haja vista possuírem um único ponto de início de transcrição e tradução no RNA m correspondente (AUG). Já os organismos procarióticos têm genes policistrônicos. O cístron é uma sequência de nucleotídeos que codifica um único polipeptídio, isto é, o DNA procariótico possui vários pontos de início de transcrição e tradução contínuos, a partir dos quais podem ser produzidos diversos peptídeos diferentes entre eles (figura 1). A figura 2 ilustra a ação conjunta dos três tipos de RNA no processo de tradução (síntese proteica), tanto em eucariotos quanto em procariotos. 6. Nos procariotos, o início da tradução depende do reconhecimento de uma sequência sinalizadora anterior ao primeiro AUG, denominada sequência de Shine-Dalgarno, inexistente nos eucariotos. Contudo, nestes há uma série de fatores de iniciação relacionados à tradução. Cerca de 90% de todos os transcritos de RNA têm sua tradução iniciada pelo reconhecimento do primeiro AUG, ligado a um resíduo especial, chamado cap. Figura 1. Tradução de RNAs de procariotos e eucariotos (5 : início da leitura; 3 : final da leitura). COLÉGIO PEDRO II TEXTO COMPLEMENTAR 03 / 2015 PÁGINA 2 DE 5

3 Figura 2. Ação conjunta dos três tipos de RNA no processo de síntese proteica. Fontes (parciais): Tabela 1. Desvios conhecidos do sistema do código genético universal. CÓDON CÓDIGO UNIVERSAL CÓDIGO NÃO USUAL OCORRÊNCIA UGA stop TRP Mycoplasma sp. Spiroplasma sp. Mitocôndrias de diversas espécies CUG LEU THR Mitocôndria de leveduras (Candida sp.) UAA Acetabularia sp., Tetrahymena sp. stop GLN UAG Paramaecium spp. UGA stop CYS Euplotes sp. Fonte: Osawa et al. (1992). Recent evidence for evolution of the genetic code. Microbiology Review 56: COLÉGIO PEDRO II TEXTO COMPLEMENTAR 03 / 2015 PÁGINA 3 DE 5

4 O RNA E SEUS TIPOS O RNA é o Ácido Ribonucleico, formado por uma sequência linear e fita-simples de nucleotídeos que carrega informação genética de alguns vírus e em outros organismos é transcrito a partir do DNA para dar origem às proteínas, entre outras funções. Possui três tipos principais: o RNA transportador (RNA t ), RNA mensageiro (RNA m ) e RNA ribossômico (RNA r ), além de algumas variantes mais específicas: 1. RNA MENSAGEIRO (RNA m ): Transcrito a partir do DNA, contém a sequência de nucleotídeos (códon) que corresponde aos aminoácidos que irão dar origem a sua proteína correspondente. 2. RNA TRANSPORTADOR (RNA t ): RNA que possui a sequência anticódon e carrega o seu aminoácido correspondente, ele reconhece o códon no RNA m e promove a tradução de proteínas. 3. RNA RIBOSSOMAL (RNA r ): Molécula de RNA associada a algumas proteínas específicas para formar os ribossomos. Destas três variedades, percebe-se que: (1) o RNA r e o RNA t são de vida longa, podendo ser reutilizados pela célula por longos períodos de tempo; (2) o RNA m possui vida curta pode ser traduzido algumas vezes, o que resultará na síntese de algumas cópias do polipeptídio de interesse, sendo posteriormente degradado. Esta característica garante economia de energia para a célula, prevenindo a síntese excessiva (e desnecessária) de material celular (que promoveria alteração na relação superfície/volume) e gasto desnecessário de energia. Se a célula necessitar de mais cópias deste polipeptídio, um novo RNA m codificante deverá ser transcrito a partir do gene de interesse (DNA). 4. RNA POLICISTRÔNICO: Exclusivo de procariotos. RNA mensageiro que promove a síntese de mais de uma proteína, pois possui vários pontos diferentes de origem de tradução. 5. RNA ANTISENSE: RNA capaz de inibir a tradução de proteínas ao formar um duplex com o RNA m. 6. RNA GUIA: Molécula de RNA que (...) edita o RNA mensageiro ao acrescentar bases nitrogenadas por complementaridade. 7. RNA INTERFERENTE (RNA i ): Molécula de RNA que promove silenciamento gênico ao degradar os RNA mensageiros recém formados. 8. RNA NUCLEAR HETEROGÊNEO (RNA hn ): Molécula precursora de RNA presente no núcleo que irá tornar-se um RNA mensageiro maduro após sofrer algum tipo de processamento. 9. RNA POLIMERASE: Enzima cuja principal atividade é catalisar a transcrição de RNA a partir do DNA. 10. RNA TRANSPORTADOR SUPRESSOR: RNA que possui anticódons que sofreram mutação e lê novos códons. Fonte (editada): COLÉGIO PEDRO II TEXTO COMPLEMENTAR 03 / 2015 PÁGINA 4 DE 5

5 OS POLIRRIBOSSOMOS (POLISSOMOS) Garantem a produção de várias cópias de um dado polipeptídio de interesse, em pouco tempo, tornando desnecessário que o RNA m possua longa duração ou tenha que ser transcrito repetidas vezes dentro de um mesmo ciclo celular. COLÉGIO PEDRO II TEXTO COMPLEMENTAR 03 / 2015 PÁGINA 5 DE 5

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Professora Priscila F Binatto

Professora Priscila F Binatto Professora Priscila F Binatto Característica 5 3 AUTODUPLICAÇÃO (Replicação) Ocorre em presença da enzima DNA polimerase Molécula DNA As pontes de hidrogênio se rompem H Nucleotídeos LIVRES encaixam se

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA. Aminoácidos. Prof. Willame Bezerra

CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA. Aminoácidos. Prof. Willame Bezerra CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA Aminoácidos Prof. Willame Bezerra As proteínas são as biomoléculas mais abundantes nos seres vivos e exercem funções fundamentais em

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Soluções de Conjunto de Problemas 1

Soluções de Conjunto de Problemas 1 Soluções de 7.012 Conjunto de Problemas 1 Questão 1 a) Quais são os quatro tipos principais de moléculas biológicas discutidos na aula? Cite uma função importante de cada tipo de molécula biológica na

Leia mais

UFABC Bacharelado em Ciência & Tecnologia

UFABC Bacharelado em Ciência & Tecnologia UFABC Bacharelado em Ciência & Tecnologia Transformações Bioquímicas (BC0308) Prof Luciano Puzer http://professor.ufabc.edu.br/~luciano.puzer/ Propriedades, funções e transformações de aminoácidos e proteínas

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

TRADUÇÃO SÍNTESE PROTEICA

TRADUÇÃO SÍNTESE PROTEICA TRADUÇÃO SÍNTESE PROTEICA Formação do Aminoacil-tRNA Durante a formação do aminoacil-trna, o aminoácido é primeiramente ativado, reagindo com o ATP. Após, é transferido do aminoacil-amp para a extremidade

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

BÁSICA EM IMAGENS. Aminoácidos, peptídeos e proteínas

BÁSICA EM IMAGENS. Aminoácidos, peptídeos e proteínas Universidade Federal de Pelotas Instituto de Química e Geociências Departamento de Bioquímica 04 BÁSICA EM IMAGENS - um guia para a sala de aula Aminoácidos, peptídeos e proteínas Generalidades AAs x Proteínas

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Influência da Genética desempenho

Influência da Genética desempenho UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Professor Antônio Ruas

Professor Antônio Ruas Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: BIOLOGIA GERAL Aula 4 Professor Antônio Ruas 1. Temas: Macromoléculas celulares Produção

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

ESCOLA TÉCNICA ESTADUAL FREDERICO GUILHERME SCHMIDT Escola Técnica Industrial. Disciplina de Biologia Primeiro Ano Curso Técnico de Eletromecânica

ESCOLA TÉCNICA ESTADUAL FREDERICO GUILHERME SCHMIDT Escola Técnica Industrial. Disciplina de Biologia Primeiro Ano Curso Técnico de Eletromecânica ESCOLA TÉCNICA ESTADUAL FREDERICO GUILHERME SCHMIDT Escola Técnica Industrial Disciplina de Biologia Primeiro Ano Curso Técnico de Eletromecânica Prof. Diogo Schott diogo.schott@yahoo.com Substâncias orgânicas

Leia mais

4/14/2015. Proteínas. Fundamentos da Estrutura de Proteínas Parte 1. Funções biológicas das Proteínas

4/14/2015. Proteínas. Fundamentos da Estrutura de Proteínas Parte 1. Funções biológicas das Proteínas 1 Todo o material disponibilizado é preparado para as disciplinas que ministramos e colocado para ser acessado livremente pelos alunos ou interessados. Solicitamos que não seja colocado em sites nãolivres.

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Química da Vida Nutrição

Química da Vida Nutrição Química da Vida Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto FEV/2011 Propriedades Atômicas Elementos e Compostos químicos; Alguns símbolos são derivados do latim Por Exemplo: o símbolo do

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

SABADÃO CSP BIOLOGIA FELIPE FERNANDES 1

SABADÃO CSP BIOLOGIA FELIPE FERNANDES 1 Parte 1 Fotossíntese Questão 1 O gás carbônico e o oxigênio estão envolvidos no metabolismo energético das plantas. cerca desses gases pode-se dizer que: a) o gás carbônico é produzido apenas durante o

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES

UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila

Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila Aminoácidos e Peptídios 1 Aminoácidos Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila aaminoácido: têm um grupo carboxila e um grupo amino ligados ao mesmo átomo de carbono

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir)

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Pergunta 1 Abaixo estão apresentadas as estruturas de três aminoácidos. Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Usando os espaços em branco abaixo, classifique os três na ordem da hidrofobicidade

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza

RNA transportador. Bruna Antonioli L. Flinto Leticia Jordao Marques de Oliveira : Michele Maria de Souza RNA transportador Bruna Antonioli L. Flinto : Leticia Jordao Marques de Oliveira : 8063197 Paloma Cunha Ferraz : 9006058 Michele Maria de Souza : 8928490 Roteiro Introdução Estrutura do DNA (1ª, 2ª e 3ª)

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Professor Antônio Ruas

Professor Antônio Ruas Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: BIOLOGIA GERAL Aula 4 Professor Antônio Ruas 1. Temas: Macromoléculas celulares Produção

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

UNIVERSO TERRA SERES VIVOS ORIGEM

UNIVERSO TERRA SERES VIVOS ORIGEM UNIVERSO TERRA SERES VIVOS ORIGEM BIOLOGIA Surgiu da observação, da curiosidade de se compreender a vida e da utilização da natureza em benefício humano Grande salto com Aristóteles Baseada na observação

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Aula 2. Replicação, Transcrição, Tradução e Regulação

Aula 2. Replicação, Transcrição, Tradução e Regulação Aula 2 Replicação, Transcrição, Tradução e Regulação Dogma Central da Biologia Molecular Replicação Replicação é o processo de duplicação de uma molécula de DNA que antecede a divisão celular. Semiconservativa

Leia mais

Revisão SPLICING TRANSGÊNICO

Revisão SPLICING TRANSGÊNICO Revisão SPLICING Durante a transcrição para a formação do RNAm, o DNA (gene) transcreve as partes ativas (éxons) e as inativas (íntrons), porém, antes de sair para o citoplasma, o RNAm "perde" os íntrons,

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente:

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: 1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: a) tradução, transcrição, duplicação b) duplicação, transcrição, tradução c) duplicação, tradução, transcrição d) tradução, duplicação,

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

Aminoácidos. subunidades monoméricas que compõe a estrutura de milhares de proteínas diferentes

Aminoácidos. subunidades monoméricas que compõe a estrutura de milhares de proteínas diferentes . Aminoácidos subunidades monoméricas que compõe a estrutura de milhares de proteínas diferentes aminoácido Para entender a estrutura 3D das proteínas, vamos dissecá-la em níveis organizacionais para facilitar

Leia mais

EVENTOS CO e PÓS TRADUCIONAIS

EVENTOS CO e PÓS TRADUCIONAIS EVENTOS CO e PÓS TRADUCIONAIS EVENTOS CO e PÓS TRADUCIONAIS Enovelamento natural e assistido (Chaperonas e HSPs) Ubiquitinação e degradação via proteassomo de proteínas não enoveladas Endereçamento (peptídeo

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011

BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 BIOQUÍMICA I 1º ano de Medicina Ensino teórico 2010/2011 7ª aula teórica 11 Outubro 2010 Proteínas estruturais e funcionais Organização estrutural das proteínas Estrutura e diferentes funções de proteínas

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas

Biologia Molecular TEXTO 7 SÍNTESE DE PROTEÍNAS. A Síntese de Proteínas A Síntese de Proteínas O RNA e a Síntese de Proteínas O papel do RNAt e das sintetases do aminoacil-rnat O emparelhamento códon-anticódon O papel do RNAm e dos ribossomos Etapas da Síntese de Proteínas

Leia mais

Faculdade Anhanguera Curso de Graduação em Educação Física

Faculdade Anhanguera Curso de Graduação em Educação Física Faculdade Anhanguera Curso de Graduação em Educação Física Profa. Dra. Amabile Vessoni Arias E-mail: Amabile.arias@anhanguera.com 2016-2 Mês de agosto Conteúdo 9 Unidade 1 16 Unidade 1 23 Unidade 1 30

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

Aminoácidos. Bioquímica Prof. Dr. Marcelo Soares

Aminoácidos. Bioquímica Prof. Dr. Marcelo Soares Aminoácidos Aminoácidos Nutrição Século XIX: produtos contendo Nitrogênio eram essenciais para a sobrevivência dos animais G. J. Mulder (1839): termo Proteínas Gr Proteios (Primário) Teoria: Proteínas

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

Aminoácidos AMINOÁCIDOS, PEPTÍDEOS E PROTEÍNAS. Universidade Federal de Mato Grosso Disciplina de Bioquímica H2N C COOH

Aminoácidos AMINOÁCIDOS, PEPTÍDEOS E PROTEÍNAS. Universidade Federal de Mato Grosso Disciplina de Bioquímica H2N C COOH 1 2 Universidade Federal de Mato Grosso Disciplina de Bioquímica AMINOÁCIDOS, PEPTÍDEOS E PROTEÍNAS Vagalume (fireflies) Prof. Ms. Reginaldo Vicente Ribeiro Eritrócitos Luciferina Rinoceronte Queratina

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Soluções para Conjunto de Problemas 1

Soluções para Conjunto de Problemas 1 Soluções para 7.012 Conjunto de Problemas 1 Pergunta 1 a) Quais são os quatro principais tipos de moléculas biológicas discutidas na palestra? Cite uma função importante para cada tipo de molécula biológica

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais