ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA"

Transcrição

1 ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma; no núcleo. e) no citoplasma; no núcleo e no citoplasma. substâncias radioativas. Essas bactérias sofreram três divisões no novo meio, produzindo 800 bactérias. A análise dos ácidos nucléicos mostrou que, dessas 800 bactérias: a) 100 apresentavam o DNA marcado, mas não o b) 200 apresentavam o DNA marcado, mas não o c) 400 apresentavam o DNA marcado, mas não o d) 50 apresentavam o DNA marcado, mas não o 2. Ácido fosfórico, açúcar e uma base se ligam com perda de moléculas de água, formando um: a) ácido nucléico. b) nucleosídio. c) nucleotídeo. d) ribonucleotídio. e) desoxirribonucleotídio. 3. (UEL) Com relação à composição química, as moléculas de DNA e RNA diferem entre si quanto ao tipo de: a) açúcar, apenas. b) base nitrogenada, apenas. c) base nitrogenada e de açúcar, apenas. d) base nitrogenada e de fosfato, apenas. e) base nitrogenada, de açúcar e de fosfato. 6. (UEL) Considere as seguintes afirmações referentes a molécula de ácidos nucléicos: I. Sua duplicação ocorre durante a interfase. II. Uma cadeia simples da molécula original conserva-se íntegra em cada uma das moléculas-filhas. III. As duas moléculas-filhas têm exatamente a mesma seqüência de bases nitrogenadas e são idênticas à molécula original. IV. Após associarem-se a proteínas, as moléculasfilhas vão para o citoplasma participar da síntese de novas proteínas. Relacionam-se ao ácido desoxirribonucléico (DNA) as afirmações: a) I e II, apenas. d) II, III e IV, apenas. b) I e III, apenas. e) I, II, III e IV. c) I, II e III, apenas. 4. Genes atualmente podem ser definidos como: a) seqüências específicas de aminoácidos. b) segmentos de informações genéticas que não mais se modificam. c) equivalentes sempre a uma molécula de DNA. d) unidades encontradas somente em células especializadas. e) segmentos de DNA que codificam polipeptídeos específicos. 5. (FUVEST) Bactérias foram cultivadas em um meio nutritivo contendo timina radioativa, por centenas de gerações. Dessa cultura, foram isoladas 100 bactérias e transferidas para um meio sem 7. (FUVEST) A tabela mostra a composição das bases nitrogenadas púricas, adenina e guanina, nos DNAs do homem e do boi. Adenina Guanina Homem 30,4%? APOSTILA 2 55 SISTEMA LOSANGO DE ENSINO

2 Boi? 21,0% As porcentagens que estão faltando para o homem e para o boi são, respectivamente: a) 19,6 e 29,0 d) 19,6 e 21,0 b) 21,0 e 30,4 e) 30,4 e 21,0 c) 29,0 e 30,4 8. (UFPel) A síntese de proteínas, na célula, inicia-se quando uma determinada região da molécula de DNA é aberta e o RNA produzido ao longo de uma das fitas, através da ação da enzima RNA polimerase. Cada base do RNA é complementar a uma determinada base do DNA. Esse RNA é chamado RNA mensageiro, pois carrega a mensagem genética do DNA para a síntese da proteína. Considerando que... AATGACGCCTAGCTAC... é a seqüência de bases em uma certa região do DNA que está sendo transcrita, assinale a alternativa que apresenta o trecho do RNA mensageiro correspondente. a)...aatgacgcctagctac... b)...uuacugcggaucgaug... c)...ttactgcggatcgatg... d)...ttuctgcggutgcutg... e)...aaugacgccuagcuac (UniABC) O seguinte esquema resume, parcialmente, as inter-relações funcionais dos ácidos nucléicos ocorrentes em grande parte das células vivas. Considerando-se apenas células eucarióticas, as 3 etapas I, II e III, assinaladas no esquema, ocorrem: a) todas no núcleo. b) todas no citoplasma. c) respectivamente no núcleo, núcleo e citoplasma. d) respectivamente no núcleo, citoplasma e citoplasma. e) respectivamente no citoplasma, núcleo e núcleo. 10. (VUNESP) Na célula eucarionte, estabelecem-se, entre núcleo e citoplasma, trocas de substâncias que, sintetizadas em um desses compartimentos, migram para o outro a fim de atender suas necessidades. O esquema apresenta algumas dessas substâncias. Assinale a resposta que dá a direção correta de migração das mesmas. a) A, D, F, G. d) A, D, E, G. b) B, D, F, G. e) A, D, F, H. c) B, D, F, H. 11. (UEL) Para síntese de uma determinada proteína, são necessários RNA mensageiro, RNA ribossômico, RNA transportador e aminoácidos. Sobre o assunto, considere as seguintes afirmativas: I. A tradução ocorre no citoplasma da célula. II. O RNA transportador carrega a mensagem para a produção da proteína. III. Cada 3 nucleotídeos do RNA mensageiro determinam a colocação de um aminoácido específico na proteína. IV. Moléculas de RNA transportador, ligadas a aminoácidos, unem-se ao RNA ribossômico por uma seqüência de 3 bases. V. Enquanto o ribossomo se desloca sobre a fita de RNA mensageiro, outros RNA transportadores se encaixam, trazendo novos aminoácidos. Assinale a alternativa correta. a) Apenas as afirmativas I e II são corretas. b) Apenas as afirmativas I, III e V são corretas. c) Apenas as afirmativas II e V são corretas. d) Apenas as afirmativas I, II, IV e V são corretas. e) Apenas as afirmativas III e IV são corretas. 12. (PUC-CAMP) O quadro a seguir contém um segmento de DNA, os códons e os anticódons correspondentes. DNA ATT GAC TCA SISTEMA LOSANGO DE ENSINO 56 APOSTILA 2

3 TAA...I... RNAm...II... GAC...III... RNAt UAA...IV... AGU Para preenchê-lo corretamente, os algarismos I, II, III e IV devem ser substituídos, respectivamente, por: a) GAC, TAA, AGT e CTG. b) GTC, AUU, UCA e GUC. c) GTC, ATT, TCA e GUC. d) CTG, ATT, UCA e CUG. e) CTG, AUU, UCA e CUG 3. (UFJF) EXERCÍCIOS COMPLEMENTARES 1. (UNICAMP) A análise da composição de nucleotídeos do ácido nucléico, que constitui o material genético de quatro diferentes organismos, mostrou o seguinte resultado: Organismos % de nucleotídeos A G T C U A 23,3 26,7 23,5 26,5 0 B 17,3 40,5 28,2 14,0 0 C 27,5 14,3 0 35,5 22,7 D 18,5 31,5 18,3 31,7 0 Com base nesses resultados responda o que se pede e justifique as respostas: a) Qual é o ácido nucléico de cada um desses organismos? A: adenina B: citosina C: guanina T: timina U: urucila Identifique as estruturas numeradas: a) 1 molécula de DNA e 2 molécula de RNA b) 1 código genético e 2 DNA replicado c) 2 síntese de DNA e 1 RNA d) 1 síntese de DNA e síntese de RNA e) 1 e 2 separação e duplicação da molécula, originando duas réplicas do original 4. (UFV 2005) A seqüência dos cinco primeiros aminoácidos (aa), de um peptídeo em início de síntese, está representada a seguir. Na tabela, aparecem também representados alguns RNAs transportadores (trna) e seus respectivos aminoácidos. b) Quantas cadeias poli-nucleotídicas possui o ácido nucléico de cada um desses organismos? 2. (UFV 2004) Este ano comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). Dentre as afirmativas a seguir, assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. A polimerização de uma fita simples de DNA é dita semiconservativa, pois independe da existência de uma fita molde. b) As duas cadeias de uma dupla-hélice possuem a mesma orientação, e suas seqüências de bases são complementares. a) 5 -AUG-CUC-CCC-CAA-GCA- 3 b) 5 -CCC-CAA-GCA-CUC-AUG- 3 c) 5 -CAA-GCA-GAG-UAC-CCC- 3 d) 5 -GCA-CUC-GUU-AUG-CAA- 3 e) 5 -UAC-GAG-GGG-GUU-CGU-3 5. (UFV 2004) A tabela a seguir representa uma versão fictícia do código genético. Entretanto, esse código segue o APOSTILA 2 57 SISTEMA LOSANGO DE ENSINO

4 padrão do código genético universal, no qual três bases codificam um aminoácido. Trinca de bases Aminoácido Trinca de bases Aminoácido AAC N CUA R AAU O GAA K AGG C GCA T AUA O GCC N AUC S GCU T AUG iniciação GGC W CAU O GGG S CCU S UAA terminação CGA W UAC A CGC I UAU E UCG A Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. c) Qual a seqüência de aminoácidos que resultará da tradução da seguinte molécula de RNA mensageiro? 5 3 AUAUGCGAUCGGCUAUCCAUGCCUAUAGGCUACGCAGGGAAUAACUAA d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mrna, após uma deleção do terceiro nucleotídeo? 6. (UFAL) Um segmento de uma fita de DNA possui a trinca TAC. Assinale, no quadro a seguir, a alternativa que identifica corretamente o códon e o anticódon correspondentes. RNAm RNAt a) ATG TAC b) AUG UAC c) UTC AUG d) UAC TAG e) UGA TUG 7. (PUC-MG) O desenho a seguir representa o processo de síntese protéica. Os números 1, 2, e 3, são, respectivamente: a) DNA, RNAm, RNAt. b) RNAm, RNAT, Ribossomo. c) RNAt, DNA, RNAm. d) RNAm, RNAt, DNA. e) Ribossomo, RNAm, RNAt. 8. (UFV) A composição química das células é formada por substâncias inorgânicas e orgânicas. Entre estas últimas detacam-se as proteínas, os ácidos nucléicos os carboidratos e os lipídios. Com relação a estas substâncias orgânicas, assinale a alternativa INCORRETA. a) Os lipídios caracterizam-se por serem pouco solúveis em água e são os principais componentes das membranas celulares. b) As proteínas são formadas por aminoácidos ligados covalentemente entre si e muitas têm função enzimática. c) Entre os tipos de RNA têm-se o RNA de transferência, o RNA ribossômico o RNA mensageiro, sendo este último o único envolvido na síntese de proteínas. d) Os carboidratos podem desempenhar função estrutural, como a celulose ou de reserva, como o amido. e) O DNA é o ácido nucléico responsável pela transmissão da informação genética e encontrase quase todo no núcleo. 9. (FUVEST) APOSTILA SISTEMA LOSANGO DE ENSINO

5 O esquema apresenta a síntese de um polipeptídeo a partir de uma molécula de DNA. É licito dizer que o diagrama mostra: a) a tradução do código genético b) a transcrição do código genético c) a transcrição e a tradução do código genético d) a replicação do DNA e) a replicação do DNA, a transcrição e a tradução do código genético. 25 aminoácidos de uma enzima mitocondrial (NAD desidrogenase) do homem (a), do gorila (b) e do orangotango (c). Examine essas seqüências e responda: Que macacos ocupam os espaços I e II do diagrama a seguir, em função do grau de proximidade de parentesco com o homem? Justifique sua escolha. Obs.: Cada aminoácido abaixo está representado por uma letra, de acordo com o novo código internacional. a) I T M H S T I T T L T L T S L I P P I L T T L V N b) I T M Y A T I T T L A L T S L I P P I L T T F I N c) T A M F T T I T A L T L T S L I P P I T A T L I N 10. (UFRJ) Temos a seguir a seqüência dos primeiros CÓDIGO GENÉTICO 2 a LETRA 1 a LETRA U C A G 3 a LETRA UUU (Fenilalanina) UCU (Serina) UAU (Tirosina) UGU (Cisteína) U U UUC (Fenilalanina) UCC (Serina) UAC (Tirosina) UGC (Cisteína) C UUA (Leucina) UCA (Serina) UAA (Parada) UGA (Parada) A UUG (Leucina) UCG (Serina UAG (Parada) UGG (Triptofano) G CUU (Leucina CCU (Prolina) CAU (Histidina) CGU (Arginina) U C CUC (Leucina) CCC (Prolina) CAC (Histidina) CGC (Arginina) C CUA (Leucina) CCA (Prolina) CAA (Glutamina) CGA (Arginina) A CUG (Leucina CCG (Prolina) CAG (Glutamina) CGG (Arginina) G AUU (Isoleucina) ACU (Treonina) AAU (Asparagina) AGU (Serina) U A AUC (Isoleucina) ACC (Treonina) AAC (Asparagina) AGC (Serina) C AUA (Isoleucina) ACA (Treonina) AAA (Lisina) AGA (Arginina) A AUG (Metionina) ACG (Treonina) AAG (Lisina) AGG (Argina) G GUU (Valina) GCU (Alanina) GAU (Ác. Aspártico) GGU (Glicina U G GUC (Valina GCC (Alanina GAC (Ác. Aspártico) GGC (Glicina) C GUA (Valina) GCA (Alanina) GAA (Ác. Glutâmico) GGA (Glicina) A GUG (Valina) GCG (Alanina) GAG (Ác. Glutâmico GGG (Glicina G APOSTILA 2 59 SISTEMA LOSANGO DE ENSINO

6 11. (UFJF) Considere que, em uma planta de milho transgênica, foi inserida uma cópia de um gene relacionado à produção de um hormônio de crescimento em seres humanos. Dessa forma, as sementes de milho contendo a proteína de interesse poderiam ser utilizadas pela indústria para a produção de remédios a um custo inferior, beneficiando milhares de crianças com problemas de crescimento. (Adaptado de O Globo, 17/10/99). Uma das fitas do segmento de DNA humano inserido apresentava a seqüência: TACGAGCCTAACATC De posse dessas informações, responda: a) Em que compartimento celular da planta, o gene humano deve ser inserido para que a proteína funcional seja produzida? b) Que tipos de RNA estão envolvidos na produção dessa proteína na planta? c) Qual é a seqüência de base do RNA mensageiro transcrito a partir do segmento de DNA inserido na planta? d) Utilizando a tabela do código genético apresentado, informe quais aminoácidos farão parte da proteína sintetizada a partir da seqüência de DNA inserida na planta. e) Imagine agora, que após a inserção do fragmento de DNA, um evento imprevisível levou à substituição da 5 a base, da esquerda para a direita, por uma timina (T). Este fato causará alguma alteração na seqüência de aminoácidos da proteína a ser formada? Em caso positivo, qual será essa alteração? 13. (LOSANGO) Ao se isolar uma molécula pura e completa de RNAm, contou-se nela 1600 nucleotídeos. Destes, 300 eram uracilas e não havia adenina. Assim sendo, pede-se o número de citosinas presentes no gene (ou a molécula de DNA) que organìzou tal RNAm. a) 600 d) 1200 b) 800 e) 1300 c) (LOSANGO) Com relação à síntese de proteínas em uma célula, foram feitas as seguintes afirmativas: I. Todas as células sintetizam sempre os mesmos tipos de proteínas, nas mesmas proporções. II. A seqüência de bases nitrogenadas ao longo da molécula de RNAm determina a seqüência dos aminoácidos incorporados na cadeia polipeptídica. III. Durante a sintese proteica, o RNAt tem por função levar os aminoácidos às mitocôndrias. IV. As mitocôndrias não têm relação direta com a síntese de proteina, já que esta ocorre nos ribossomos. V. Um RNAm sintético, que contenha apenas um determinado tipo de códon em seqüência, condicionará a síntese de uma cadeia polipeptídica com um único tipo de aminoácido. As afirmativas corretas são: a) I, II d) II, V b) I, IV e) II, III c) III, V 12. (CESGRANRIO) A análise de esquema anterior nos permite afirmar que: I. os ribossomas nessa molécula de RNA traduzirão os mesmos códons II. durante o processo a proteína depende, em última análise, de uma molécula de DNA III. qualquer proteína formada será conseqüência direta de uma transcrição do A(s) afirmativa(s) correta(s) é (são): a) I apenas d) I, II e III b) I e II apenas e) II e III apenas c) I e III apenas SISTEMA LOSANGO DE ENSINO 60 APOSTILA 2

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES 1 3AMIپ0 9CIDS PLASMپ0 9TICS LIVRES پ0 9CIDS AMIADS PLASMپ0 9TICS LIVRES CBPM 4.03.01.29-0 AMB 28.13.043-0 CBPM 4.03.01.67-2 AMB 28.04.099-6/92 Sinon ھmia: پ0 9cido asp rtico, پ0 9cido glutپ0 9mico, Alanina,

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Introdução à Teoria da Informação

Introdução à Teoria da Informação Introdução à Teoria da Informação Probabilidade e Estatística I Antonio Roque Aula 8 O conceito de quantidade de informação associada a um evento foi introduzido pelo engenheiro norte-americano Claude

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA

EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA Gabarito Exercícios Ácidos Nucléicos EXERCÍCIO EXERCÍCIOS SOBRE ÁCIDOS NUCLÉICOS E SÍNTESE PROTÉICA 1) O mofamento de grãos durante a estocagem causa perdas nutricionais e de valor de mercado, além de

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS

BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS BIOLOGIA - 3 o ANO MÓDULO 34 RIBOSSOMOS E SÍNTESE DE PROTEÍNAS anticódon códon Como pode cair no enem (ENEM) Define-se genoma como o conjunto de todo o material genético de uma espécie, que, na

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Aula 8 Síntese de proteínas

Aula 8 Síntese de proteínas Aula 8 Síntese de proteínas As proteínas que podem ser enzimas, hormônios, pigmentos, anticorpos, realizam atividades específicas no metabolismo dos seres vivos. São produzidas sob o comando do DNA. Observe

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS

BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS BIOLOGIA - 3 o ANO MÓDULO 26 VÍRUS Estrutura de um bacteriófago Proteína cabeça DNA cauda Proteínas cromossomo bacteriano Fago DNA Como pode cair no enem (MACKENZIE) O ser humano tem travado batalhas constantes

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo.

BIOLOGIA. 01. Considere o enunciado abaixo e as três propostas para completá-lo. BIOLOGIA 01. Considere o enunciado abaixo e as três propostas para completá-lo. Fleming, um microbiologista, ao examinar placas de cultivo semeadas com bactérias, observou que elas eram incapazes de crescer

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

UNIVERSO TERRA SERES VIVOS ORIGEM

UNIVERSO TERRA SERES VIVOS ORIGEM UNIVERSO TERRA SERES VIVOS ORIGEM BIOLOGIA Surgiu da observação, da curiosidade de se compreender a vida e da utilização da natureza em benefício humano Grande salto com Aristóteles Baseada na observação

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

Revisão SPLICING TRANSGÊNICO

Revisão SPLICING TRANSGÊNICO Revisão SPLICING Durante a transcrição para a formação do RNAm, o DNA (gene) transcreve as partes ativas (éxons) e as inativas (íntrons), porém, antes de sair para o citoplasma, o RNAm "perde" os íntrons,

Leia mais

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01

Processo Seletivo/UFU - julho 2007-2ª Prova Comum BIOLOGIA QUESTÃO 01 BOLOGA TPO 1 QUESTÃO 01 Leia o trecho a seguir. No processo evolutivo, muitos animais foram extintos depois de se diferenciarem de seus parentes mais próximos. Boa parte deles virou fóssil e, quando descobertos,

Leia mais

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2016 PROFESSOR: Fred DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: - É fundamental

Leia mais

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir. EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Bioquímica ENZIMAS ÁC. NUCLEICOS

Bioquímica ENZIMAS ÁC. NUCLEICOS Bioquímica ENZIMAS ÁC. NUCLEICOS As enzimas são substâncias orgânicas, geralmente proteínas, que catalisam reações biológicas pouco espontâneas e muito lentas. O poder catalítico de uma enzima relaciona

Leia mais

As seguintes estruturas somente podem ser encontradas numa célula eucariótica: Pode-se dizer, corretamente, que o teor de água nos animais superiores:

As seguintes estruturas somente podem ser encontradas numa célula eucariótica: Pode-se dizer, corretamente, que o teor de água nos animais superiores: As seguintes estruturas somente podem ser encontradas numa célula eucariótica: ( ) mitocôndrias e carioteca. ( ) ribossomos e membrana plasmática ( ) mitocôndrias e parede celular ( ) membrana plasmática

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Profº Lásaro Henrique

Profº Lásaro Henrique Profº Lásaro Henrique Proteínas são macromoléculas complexas, compostas de aminoácidos. São os constituintes básicos da vida e necessárias para os processos químicos que ocorrem nos organismos vivos. Nos

Leia mais

ABECEDÁRIO GENÉTICO 1

ABECEDÁRIO GENÉTICO 1 ABECEDÁRIO GENÉTICO 1 Isabel Cristina BOLELI 2 Edlaine Faria de Moura VILLELA, Paula Ericson GUILHERME 3 Vanessa de Souza MORENO 4 Resumo: Este trabalho apresenta um kit simples para abordagem lúdica dos

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes.

A tabela resumida do código genético mostra alguns códons e seus aminoácidos correspondentes. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 1ª Série

Leia mais

ORIENTAÇÃO DE ESTUDOS

ORIENTAÇÃO DE ESTUDOS ORIENTAÇÃO DE ESTUDOS RECUPERAÇÃO SEMESTRAL 1º Ano do Ensino Médio Disciplina: Biologia 1- Na composição celular são encontrados vários elementos, entre os quais, os sais minerais. Por serem fundamentais

Leia mais

Ficha de Trabalho de Biologia e Geologia 11º ano outubro 2015

Ficha de Trabalho de Biologia e Geologia 11º ano outubro 2015 Estruturas Pedagógicas Direção-Geral dos Estabelecimentos Escolares Direção de Serviços da Região Centro Área disciplinar de Biologia e Geologia Ano letivo 2015/2016 Ficha de Trabalho de Biologia e Geologia

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

A SÍNTESE DE PROTEÍNAS NAS CÉLULAS

A SÍNTESE DE PROTEÍNAS NAS CÉLULAS Biologia > Citologia > Síntese Protéica> Alunos Prof. Zell (Biologia) A SÍNTESE DE PROTEÍNAS NAS 01. (VUNESP 03) CÉLULAS Considere o diagrama, que resume as principais etapas da síntese protéica que ocorre

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

BIOLOGIA. Questão 01. fenilalanina. cisteína ácido glutâmico

BIOLOGIA. Questão 01. fenilalanina. cisteína ácido glutâmico BIOLOGIA Questão 01 Proteínas são moléculas responsáveis pela maior parte dos processos celulares. Seu funcionamento é dependente da constituição de aminoácidos que, por sua vez, é determinada, principalmente,

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA. Unidade 1 Genética Molecular

CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA. Unidade 1 Genética Molecular CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA 1. Introdução Unidade 1 Ao se analisar um indivíduo, seja uma planta, seja um animal, o que se vê é o

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

A função da água e sais minerais dentro da célula

A função da água e sais minerais dentro da célula A QUÍMICA DA VIDA A função da água e sais minerais dentro da célula Eles tem a ver com o metabolismo das mitocôndrias na qual a principal função seria de não parar a que sustenta, vejamos isso entre água

Leia mais

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec

Guia mangá. Biologia Molecular. Masaharu Takemura Sakura Becom Co., Ltd. novatec Guia mangá Biologia Molecular Masaharu Takemura Sakura Becom Co., Ltd. novatec Original Japanese-language edition Manga de Wakaru Bunshi Seibutsugaku ISBN 978-4-274-06702-0 2008 by Masaharu Takemura and

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

Faculdade Anhanguera Curso de Graduação em Educação Física

Faculdade Anhanguera Curso de Graduação em Educação Física Faculdade Anhanguera Curso de Graduação em Educação Física Profa. Dra. Amabile Vessoni Arias E-mail: Amabile.arias@anhanguera.com 2016-2 Mês de agosto Conteúdo 9 Unidade 1 16 Unidade 1 23 Unidade 1 30

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Professora Leonilda Brandão da Silva

Professora Leonilda Brandão da Silva COLÉGIO ESTADUAL HELENA KOLODY E.M.P. TERRA BOA - PARANÁ Professora Leonilda Brandão da Silva E-mail: leonildabrandaosilva@gmail.com http://professoraleonilda.wordpress.com/ ACIDOS NUCLEICOS Capítulo 13

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais