EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

Tamanho: px
Começar a partir da página:

Download "EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007"

Transcrição

1 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/ (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos", quase ignorado de início, revolucionou para sempre todas as ciências da vida sejam elas do homem, rato, planta ou bactéria. James Watson e Francis Crick descobriram a estrutura do DNA, que permitiu posteriormente decifrar o código genético determinante para a síntese protéica. a) Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os "corrimãos" e os "degraus" dessa escada. b) Que relação existe entre DNA, RNA e síntese protéica? c) Como podemos diferenciar duas proteínas? 2. (Fuvest 96) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja seqüência normal está representada a seguir. Usando a tabela que relaciona alguns codons aos respectivos aminoácidos e considerando que a fita molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado dos indivíduos A, B e C? Por quê? Seqüência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG

2 3. (Ufg 2005) As globinas constituem um bom exemplo da importância da informação genética na estrutura primária e na função das proteínas. a) Considere o segmento de DNA, cuja seqüência de nucleotídeos é 5' - GTG - CAC - CTG - ACT - CCT - GAG - GAG - AAG - 3' e, utilizando-se da tabela do código genético apresentada a seguir, forneça o produto da síntese protéica (polipeptídio parte da cadeia beta prevista para a globina humana). b) Utilize um exemplo de alteração estrutural da globina humana (cadeia beta) para explicar como uma mutação pontual, do tipo substituição, pode afetar a saúde e a qualidade de vida do portador dessa mutação. 4. (Ufrj 97) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros constituídos por vários aminoácidos. Um gene é constituído por um número N de nucleotídeos que codifica uma proteína constituída por P aminoácidos. Por que sempre encontramos N > P? 5. (Ufrj 99) Com o auxílio da tabela do código genético representada a seguir, é sempre possível deduzir-se a seqüência de aminoácidos de uma proteína a partir da seqüência de nucleotídeos do seu gene, ou do RNA-m correspondentes. Entretanto, o oposto não é verdadeiro, isto é, a partir da seqüência de aminoácidos de uma proteína, não se pode deduzir a seqüência de nucleotídeos do gene. Explique por quê.

3 6. (Ufrn 2002) O DNA dos organismos do planeta Zbohrnya é constituído pelos mesmos 4 tipos de bases dos seres vivos terrestres. Já o código genético desses organismos é determinado por códons de 2 bases. a) As proteínas A, B e C, encontradas nos organismos da Terra, apresentam, respectivamente, 13, 16 e 19 tipos diferentes de aminoácidos. Explique a possibilidade da ocorrência dessas três proteínas nos seres de Zbohrnya. b) Sabendo que a vida em Zbohrnya e na Terra existe há 3,5 bilhões de anos, faça uma comparação entre a diversidade dos organismos encontrados nesses dois planetas. c) Se o gene de uma proteína respiratória de um organismo zbohrniano for introduzido numa bactéria terrestre, a proteína produzida pela expressão desse gene será idêntica à da espécie zbohrniana? Justifique sua resposta. 7. (Ufv 2000) Considere a tabela abaixo, contendo códigos de trincas de bases do DNA com os aminoácidos correspondentes, para resolver os itens seguintes: a) Determine a seqüência de bases do RNAm que foi utilizado para sintetizar o polipeptídeo esquematizado abaixo da tabela. b) Se ocorresse uma substituição, por uma purina, na 3 base do código correspondente ao 6Ž aminoácido do polipeptídeo, qual seria o aminoácido da tabela a ser incorporado? c) Qual é anticódon correspondente ao novo aminoácido incorporado?

4 8. (Ufv 2004) A tabela adiante representa uma versão fictícia do código genético. Entretanto, esse código segue o padrão do código genético universal, no qual três bases codificam um aminoácido. Analise a tabela e faça o que se pede: a) Cite o nome da enzima que catalisa a síntese de RNA mensageiro. b) Cite a seqüência do anticódon correspondente ao códon de iniciação. c) Qual a seqüência de aminoácidos que resultará da tradução da molécula de RNA mensageiro? Ver figura anterior. d) Qual a seqüência de aminoácidos que resultará da tradução da mesma molécula de mrna, após uma deleção do TERCEIRO nucleotídeo? 9. (G2) Os códons AGA, CUG, e ACU do RNA mensageiro codificam, respectivamente os aminoácidos arginina, leucina e treonina. Escreva esses aminoácidos na ordem correspondente à seqüência TGA - TCT - GAC de um segmento de DNA. 10. (Unifesp 2006) Uma fita de DNA tem a seguinte seqüência de bases 5'ATGCGT3'. a) Considerando que tenha ocorrido a ação da DNA-polimerase, qual será a seqüência de bases da fita complementar? b) Se a fita complementar for usada durante a transcrição, qual será a seqüência de bases do RNA resultante e que nome recebe esse RNA se ele traduzir para síntese de proteínas? 11. (Ufrj 2004) Após tratar culturas de bactérias com doses de um agente mutagênico capaz de induzir uma única mutação pontual (que afeta apenas um nucleotídeo por célula), analisou-se a seqüência de aminoácidos de uma determinada proteína em diversos mutantes gerados. Verificou-se que um desses mutantes produzia uma dada proteína que diferia da original pela ausência de 35 aminoácidos em uma das extremidades da cadeia peptídica. Explique como essa única mutação pontual pode fazer com que a síntese da proteína seja interrompida prematuramente. TEXTO PARA A PRÓXIMA QUESTÃO (Ufsm 2006) A história da maioria dos municípios gaúchos coincide com a chegada dos primeiros portugueses, alemães, italianos e de outros povos. No entanto, através dos vestígios materiais encontrados nas pesquisas arqueológicas, sabemos que outros povos, anteriores aos citados, protagonizaram a nossa história. Diante da relevância do contexto e da vontade de valorizar o nosso povo nativo, "o índio", foi selecionada a área temática CULTURA e as questões foram construídas com base na obra "Os Primeiros Habitantes do Rio Grande do Sul" (Custódio, L. A. B., organizador. Santa Cruz do Sul: EDUNISC; IPHAN, 2004). "Nossos ancestrais, uma mistura de índios, brancos e negros, deixaram-nos um legado que, muitas vezes, diferencia-nos. Nosso chimarrão nos identifica em qualquer parte do mundo. Ainda hoje, convivemos com grupos indígenas, como os Kaingáng; ainda hoje, as três raças se mesclam em nossos descendentes."

5 12. O DNA presente nas mitocôndrias tem composição e estrutura típicas desse tipo de ácido nucléico, portanto é formado por I. uma cadeia de nucleotídeos em que as bases nitrogenadas interagem, formando ligações fosfo-diéster. II. duas cadeias polinucleotídicas paralelas e complementares entre si, através dos pareamentos de aminoácidos. III. nucleotídeos que são compostos por uma base nitrogenada, uma pentose e um radical "fosfato". Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas II e III. 13. (Fuvest 2005) Quando afirmamos que o metabolismo da célula é controlado pelo núcleo celular, isso significa que a) todas as reações metabólicas são catalisadas por moléculas e componentes nucleares. b) o núcleo produz moléculas que, no citoplasma, promovem a síntese de enzimas catalisadoras das reações metabólicas. c) o núcleo produz e envia, para todas as partes da célula, moléculas que catalisam as reações metabólicas. d) dentro do núcleo, moléculas sintetizam enzimas catalisadoras das reações metabólicas. e) o conteúdo do núcleo passa para o citoplasma e atua diretamente nas funções celulares, catalisando as reações metabólicas. 14. (Pucmg 2006) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. Analise o esquema, reflita sobre esse assunto e assinale a afirmativa INCORRETA. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema.

6 15. (Fatec 2006) O metabolismo celular depende de uma série de reações químicas controladas por enzimas, isto é, proteínas que atuam como catalisadores e que podem sofrer mutações genéticas sendo modificadas ou eliminadas. Assinale a alternativa correta, levando em conta os ácidos nucléicos, a ocorrência de mutações e as conseqüentes mudanças do ciclo de vida da célula. a) O DNA é constituído por códons, que determinam a seqüência de bases do RNA mensageiro, necessária à formação dos anticódons, responsáveis pela produção das proteínas. b) No caso de uma mutação acarretar a transformação de um códon em outro relacionado ao mesmo aminoácido, não haverá alteração na molécula protéica formada, nem no metabolismo celular. c) A mutação altera a seqüência de aminoácidos do DNA, acarretando alterações na seqüência de bases do RNA mensageiro e, conseqüentemente, na produção das proteínas. d) As mutações atuam diretamente sobre as proteínas, provocando a desnaturação dessas moléculas e, conseqüentemente, a inativação delas. e) Quando algumas proteínas são alteradas por mutações, suas funções no metabolismo celular passam a ser realizadas pelos aminoácidos. 16. (Pucrs 2005) A seqüência de nucleotídeos ATGCACCT forma um segmento de DNA dupla hélice ao se ligar à fita complementar a) AUGCACCU. b) UACGUGGA. c) TACGTGGA. d) TCCACGTA. e) ATGCACCT. 17. (Pucsp 2006) O gato doméstico ('Felis domestica') apresenta 38 cromossomos em suas células somáticas. No núcleo do óvulo normal de uma gata são esperados: a) 19 cromossomos simples e 19 moléculas de DNA. b) 19 cromossomos duplicados e 38 moléculas de DNA. c) 38 cromossomos simples e 38 moléculas de DNA. d) 38 cromossomos simples e 19 moléculas de DNA. e) 19 cromossomos duplicados e 19 moléculas de DNA. 18. (Uerj 2004) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. (...) No homem, os planos do arquiteto montam 46 volumes. Nessa analogia, proposta por Richard Dawkins no livro "O gene egoísta", cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 19. (Unifesp 2004) Em abril de 2003, a finalização do Projeto Genoma Humano foi noticiada por vários meios de comunicação como sendo a "decifração do código genético humano". A informação, da maneira como foi veiculada, está a) correta, porque agora se sabe toda a seqüência de nucleotídeos dos cromossomos humanos. b) correta, porque agora se sabe toda a seqüência de genes dos cromossomos humanos. c) errada, porque o código genético diz respeito à correspondência entre os códons do DNA e os aminoácidos nas proteínas. d) errada, porque o Projeto decifrou os genes dos cromossomos humanos, não as proteínas que eles codificam. e) errada, porque não é possível decifrar todo o código genético, existem regiões cromossômicas com alta taxa de mutação.

7 20. (Cesgranrio 92) A tabela a seguir mostra alguns aminoácidos e as trincas de bases no DNA que os identificam: Se um RNA mensageiro apresenta a seqüência de bases AUU AGA UGU GUU UUA, a seqüência de aminoácidos no polipeptídeo correspondente será, de acordo com a tabela anterior: a) Cis - Val - Leu - Arg - Ile b) Leu - Val - Cis - Arg - Ile c) Arg - Ile - Val - Leu - Cis d) Ile - Arg - Cis - Val - Leu e) Val - Cis - Arg - Ile - Leu 21. (Fatec 95) A tabela a seguir relaciona trincas de bases do DNA aos aminoácidos correspondentes. Assinale a alternativa que apresenta a possível seqüência de códons para a formação do seguinte tetrapeptídeo: GLU - GLI - FEN - LEU a) GUU - GGU - UUU - CUC; b) GAA - GGC - TTT - CTC; c) CTT - CCG - AAA - AAC; d) GAA - GGA - UUU - CUC; e) GUU - GGC - UUU - UUG. 22. (Fuvest 94) Um gene de bactéria com 600 pares de bases nitrogenadas produzirá uma cadeia polipeptídica com número de aminoácidos aproximadamente igual a a) 200 b) 300 c) 600 d) 1200 e) 1800

8 23. (Fuvest 95) Considere a seguinte tabela que indica seqüências de bases do RNA mensageiro e os aminoácidos por elas codificados. Com base na tabela fornecida e considerando um segmento hipotético de DNA, cuja seqüência de bases é AAGTTTGGT, qual seria a seqüência de aminoácidos codificada? a) Aspargina, leucina, valina. b) Aspargina, lisina, prolina. c) Fenilalanina, lisina, prolina. d) Fenilalanina, valina, lisina. e) Valina, lisina, prolina. 24. (Mackenzie 99) Os códons UGC, UAU, GCC e AGC codificam, respectivamente os aminoácidos cisteína, tirosina, alanina e serina; o códon UAG é terminal, ou seja, indica a interrupção da tradução. Um fragmento de DNA, que codifica a seqüência serina - cisteína - tirosina - alanina, sofreu a perda da 9 base nitrogenada. Assinale a alternativa que descreve o que acontecerá com a seqüência de aminoácidos. a) O aminoácido tirosina será substituído por outro aminoácido. b) O aminoácido tirosina não será traduzido, resultando numa molécula com 3 aminoácidos. c) A seqüência não será traduzida, pois essa molécula de DNA alterada não é capaz de comandar esse processo. d) A tradução será interrompida no 2Ž aminoácido. e) A seqüência não sofrerá prejuízo, pois qualquer modificação na fita de DNA é imediatamente corrigida. 25. (Puc-rio 2000) Com relação ao código genético e à síntese de proteínas, assinale a afirmativa FALSA. a) Na molécula de DNA, encontramos sempre desoxirribose e cinco tipos de bases: adenina, guanina, citosina, timina e uracil. b) Os ácidos nucléicos podem aparecer livres na célula ou podem estar associados a proteínas, compondo os cromossomos e ribossomos na forma de moléculas complexas de nucleoproteínas. c) Duas grandes etapas estão envolvidas na síntese das proteínas: a transcrição, que compreende a passagem do código genético do DNA para o RNA, e a tradução, que compreende o trabalho do RNA de organização dos aminoácidos na seqüência determinada pelo código genético. d) A mutação constitui uma alteração na seqüência de bases nitrogenadas de um segmento de DNA e pode ser provocada por radiações, por raios cósmicos, por raios-x, ou mesmo por exposição aos raios ultravioleta do sol. e) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disso, encontramos células com formas e funções diferentes. Este processo chama-se diferenciação celular. 26. (Puc-rio 2001) Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e mapear o código genético humano. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula, determinando as características de um ser vivo. b) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disto, encontramos células com formas e funções diferentes. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas, nem as suas características. e) A Engenharia Genética, que é uma técnica de manipulação dos genes, pode corrigir defeitos no código

9 genético de um organismo. 27. (Uel 98) Considere os seguintes códons do RNA mensageiro e os aminoácidos por eles especificados: ACA = treonina GUU = valina Assinale a alternativa da tabela a seguir que indica corretamente os anticódons do RNAt e os códons do DNA relacionados com esses aminoácidos. 28. (Uerj 2005) A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns codons. Observe que: - o codon da metionina é também o do início da tradução; - os codons de término da tradução são UAA, UAG e UGA. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico

10 29. (Ufpi 2000) Se uma proteína possui 100 aminoácidos, quantos códons, que especificam esses aminoácidos, devem estar presentes no seu mrna? a) 100 b) 33 c) 99 d) 300 e) (Ufrn 2000) Observe as seqüências de nucleotídeos de um vírus de RNA: 5' GCA UCA CAC CUC AUU GCG UAG 3' Considerando que esse segmento de RNA codifica um determinado peptídeo, é correto afirmar: a) Os códons dessa seqüência sinalizam os mesmos aminoácidos em seres humanos. b) A inserção de um nucleotídeo entre a 4 e a 5 base não altera o código genético. c) Os códons GCA e GCG são degenerados porque codificam aminoácidos diferentes. d) Os anticódons do 1ª do 2ª códon dessa seqüência são, respectivamente, GCA e UGA. 31. (Unifesp 2007) Os códons AGA, CUG e ACU do RNA mensageiro codificam, respectivamente, os aminoácidos arginina, leucina e treonina. A seqüência desses aminoácidos na proteína correspondente ao segmento do DNA que apresenta a seqüência de nucleotídeos GAC TGA TCT será, respectivamente, a) treonina, arginina, leucina. b) arginina, leucina, treonina. c) leucina, arginina, treonina. d) treonina, leucina, arginina. e) leucina, treonina, arginina. 32. (G2) A seqüência de aminoácidos de uma proteína é determinada pela seqüência de a) pentoses da molécula de DNA. b) pentoses da molécula de RNA - mensageiro. c) bases da molécula de DNA. d) bases da molécula de RNA - transportador. e) bases da molécula de RNA - ribossômico 33. (Mackenzie 2001) Considerando o esquema acima, que representa um fragmento de ácido nucléico, cuja função é transportar aminoácidos, assinale a alternativa INCORRETA. a) A substância representada em I é obrigatoriamente ribose. b) Cada trinca de bases, representada em II, é denominada anticódon. c) Esse ácido nucléico é produzido no núcleo e se dirige ao citoplasma, unindo-se aos aminoácidos. d) II pode apresentar moléculas de adenina. e) Se a ação desse ácido for bloqueada, o processo de transcrição não ocorrerá.

11 34. (Puccamp 2002) Um mutante perdeu um segmento de DNA contendo todas as cópias dos genes que codificam RNA transportador. A função celular drasticamente afetada por essa mutação será a) a replicação do DNA. b) a síntese de RNA mensageiros. c) a síntese de proteínas. d) o transporte de proteínas. e) o transporte de RNA. 35. (Pucmg 99) O DNA apresenta importantes funções celulares. Uma delas é a síntese de proteína. Numa síntese de proteína com 185 ligações peptídicas, o filamento de DNA que proporcionou essa síntese deverá ter o seguinte número total de nucleotídeos: a) 62 b) 93 c) 186 d) 279 e) (Pucmg 2007) O esquema a seguir é um processo celular vital, que ocorre também em você. Nesse processo ocorre produção de, EXCETO: a) macromoléculas de reserva energética. b) enzimas usadas, por exemplo, no processo digestivo. c) moléculas de defesa do corpo. d) moléculas utilizadas nos processos de cicatrização. 37. (Ufal 99) Considere os seguintes códons: UAC - GAU - UGC - AUG Os anti-códons correspondentes são: a) AUG - CUA - ACG - UAC b) ATG - CTA - ACG - TAC c) TUG - CUT - TCG - UTC d) AGT - CGA - ACT - GAC e) GCA - UCG - GUA - CGU 38. (Ufc 99) Sobre os diferentes papéis dos ácidos nucléicos na síntese de proteínas podemos afirmar corretamente que: a) a seqüência de bases no DNA determina a seqüência de aminoácidos na cadeia polipeptídica. b) a posição dos aminoácidos na cadeia polipeptídica depende da seqüência de bases do trna. c) o transporte de aminoácido para o local da síntese é feito pelo mrna. d) a seqüência de bases do rrna é transcrita a partir do código do mrna. e) a extremidade livre dos diversos trna tem seqüências de bases diferentes.

12 39. (Ufrs 2005) O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA, morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica da biologia molecular, lançando, assim, as bases para a descoberta do código genético. Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma, a) o código genético é degenerado, pois um aminoácido pode ser codificado por mais de uma trinca. b) a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a proteína. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. d) cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de quatro tipos diferentes. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. 40. (Unirio 2003) Supondo que o peso molecular médio de um aminoácido é de 100 daltons, quantos nucleotídeos em média estão presentes em uma seqüência codificadora de ARN-m, responsável pelo sequenciamento dos aminoácidos em um peptídeo com peso molecular de daltons? a) 810 b) 300 c) 270 d) e) 2700

13 GABARITO 1. a) Os 'corrimãos' correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os 'degraus' são constituídos por pares de bases nitrogenadas, unidas por pontes de hidrogênio, onde adenina pareia com timina, e citosina com guanina. b) O DNA realiza a transcrição, isto é, produz o RNA mensageiro, que conduz os códons para a síntese da proteína nos ribossomos. c) As proteínas podem ser diferenciadas pelo número, tipos e seqüências de seus aminoácidos. 2. a) Proteína normal: Val - Leu - Tre - Pro - Tir - Val - Lis Indivíduo A: Val - Leu - Tre - Pro Indivíduo B: Val - Leu - Tre - Pro - Tir - Val - Lis Indivíduo C: Val - Met - Tre - Pro - Tir - Val - Lis b) A é afetado porque produz uma proteína menor. B é normal, apesar da substituição de uma base nitrogenada no seu DNA, porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína. 3. a) Produto da síntese protéica (polipeptídio): val - his - leu - thr - pro - glu - glu - lys b) Exemplo de mutação pontual no gene que codifica a cadeia da globina humana: substituição do nucleotídeo A por T no códon correspondente ao ácido glutâmico. Conseqüência: anemia falciforme - alteração estrutural do polipeptídio (substituição do ácido glutâmico pela valina); - alteração da função da proteína (globina); - redução da capacidade de transporte de oxigênio; - manifestação dos sintomas da anemia falciforme. 4. Com a descoberta do código genético sabe-se que um aminoácido é sempre codificado por três nucleotídeos. Logo, o gene que codifica uma proteína tem sempre maior número de nucleotídeos que de aminoácidos. Sabe-se ainda que existem vários nucleotídeos do gene que servem para a função de regulação e não são transcritos. 5. Porque o código genético é degenerado, isto é, para um mesmo aminoácido existem vários códons diferentes. 6. a) As proteínas produzidas pelos extraterrestres em questão, poderiam ter, no máximo, 16 tipos diferentes de aminoácidos. Seu código genético, formado por pares de bases, permite a formação de apenas 16 códons diferentes. Isso sem considerar a possibilidade da existência de um, ou mais, códons de finalização. Neste caso, não seria possível a produção das proteínas B e C com, respectivamente, 16 e 19 aminoácidos. b) A diversidade no planeta Terra seria maior, pois o código genético dos terráqueos é formado por 64 códons, sendo 3 códons de finalização. Assim o número de tipos distintos de aminoácidos presentes nos polipeptídeos seria, obviamente, maior. c) A proteína produzida pela bactéria terrestre "transgênica" não será idêntica ao polipeptídeo alienígena, uma vez que o equipamento ribossômico da bactéria que incorporou o gene, está capacitado para traduzir códons constituídos por 3 bases nitrogenadas consecutivas. 7. a) RNAm: UCC GUU AAU UCC GGC AAG b) O códon mutado, TTA, especificaria o terceiro aminoácido da tabela.

14 c) UUA 8. a) RNA-polimerase. b) UAC. c) W - A - T - S - O - N - E - C - R - I - C - K. d) A proteína não será formada, pois foi alterado o códon de iniciação. 9. Treonina - Arginina - Leucina 10. a) 3'TACGCA5'. b) 5'AUGCGU3'. O RNA que será utilizado na tradução é o RNAm (RNA mensageiro). 11. A mutação deve ter alterado um códon que codificava um aminoácido transformando-o em um códon de parada, que interrompe a leitura do ARNm pelo ribossoma. 12. [C] 13. [B] 14. [C] 15. [B] 16. [C] 17. [A] 18. [D] 19. [C] 20. [D] 21. [D] 22. [A] 23. [C] 24. [D] 25. [A] 26. [D] 27. [C] 28. [C] 29. [A] 30. [A] 31. [E] 32. [C] 33. [E] 34. [C] 35. [E] 36. [A] 37. [A] 38. [A] 39. [B] 40. [A]

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova!

EXAME Discursivo. Biologia. 2 A fase 01/12/2013. Boa prova! 2 A fase EXAME Discursivo 01/12/2013 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Bioquímica ENZIMAS ÁC. NUCLEICOS

Bioquímica ENZIMAS ÁC. NUCLEICOS Bioquímica ENZIMAS ÁC. NUCLEICOS As enzimas são substâncias orgânicas, geralmente proteínas, que catalisam reações biológicas pouco espontâneas e muito lentas. O poder catalítico de uma enzima relaciona

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio.

LIVRETE DE QUESTÕES E RASCUNHO. 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. PROVA DISCURSIVA LIVRETE DE QUESTÕES E RASCUNHO 1 O DIA VESTIBULAR 2015 INSTRUÇÕES 1) Confira seus dados e assine a capa deste Livrete de Questões e Rascunho somente no campo próprio. 2) Utilize-se dos

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

2016 Dr. Walter F. de Azevedo Jr.

2016 Dr. Walter F. de Azevedo Jr. 2016 Dr. Walter F. de Azevedo Jr. 000000000000000000000000000000000000000 000000000000000000000000000000000000000 000000000000111111111110001100000000000 000000000001111111111111111111000000001 000000000111111111111111111111111000000

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Substrato do Tripeptídeo

Substrato do Tripeptídeo Pergunta 1 Você está estudando uma enzima chamada quinase. Seu substrato é o tripeptídeo Ala-Lys-Thr, com uma molécula incomum em suas terminações C, a molécula GLOW. Quando essa molécula GLOW é segmentada

Leia mais

PAULO CESAR NAOUM AC&T- 2013

PAULO CESAR NAOUM AC&T- 2013 PAULO CESAR NAOUM AC&T- 2013 HEMOGLOBINAS NORMAIS MOLÉCULA DA HEMOGLOBINA HUMANA NORMAL Hb A AS HEMOGLOBINAS HUMANAS SÀO COMPOSTAS POR QUATRO CADEIAS DE AMINOÁCIDOS CONHECIDAS POR GLOBINAS E INSERIDO EM

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica INBEQMeDI Instituto Nacional de Biotecnologia Estrutural e Química Medicinal em Doenças Infecciosas Coordenadoria de Educação e Difusão de Ciências Telefone: (16) 3373-9159 Rua 9 de julho, 1205 - Centro

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

www.enemdescomplicado.com.br

www.enemdescomplicado.com.br Entre essas amostras, quais se referem a DNA? a) Apenas I e II. d) Apenas II e IV. b) Apenas I e III. e) Apenas II e V. c) Apenas II e III. 231. UFPE Nos últimos anos, a biologia molecular tem fornecido

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos.

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 9º Ano

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir)

Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Pergunta 1 Abaixo estão apresentadas as estruturas de três aminoácidos. Fenilalanina (Phe) Treonina (Thr) Tirosina (Tir) Usando os espaços em branco abaixo, classifique os três na ordem da hidrofobicidade

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir.

EXERCÍCIOS. 1. (UFG) Analise os gráficos a seguir. EXERCÍCIOS 1. (UFG) Analise os gráficos a seguir. e) na região Centro-Oeste, a oscilação da incidência de febre amarela está relacionada ao aumento crescente do desmatamento do Cerrado, às constantes alterações

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

James Watson, Francis Crick e o DNA

James Watson, Francis Crick e o DNA Pércio Augusto Mardini Farias Este documento tem nível de compartilhamento de acordo com a licença 2.5 do Creative Commons. http://creativecommons.org.br http://creativecommons.org/licenses/by/2.5/br/

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES

1 3AMINOپ0 9CIDOS PLASMپ0 9TICOS LIVRES پ0 9CIDOS AMINADOS PLASMپ0 9TICOS LIVRES 1 3AMIپ0 9CIDS PLASMپ0 9TICS LIVRES پ0 9CIDS AMIADS PLASMپ0 9TICS LIVRES CBPM 4.03.01.29-0 AMB 28.13.043-0 CBPM 4.03.01.67-2 AMB 28.04.099-6/92 Sinon ھmia: پ0 9cido asp rtico, پ0 9cido glutپ0 9mico, Alanina,

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Aula 8 Síntese de proteínas

Aula 8 Síntese de proteínas Aula 8 Síntese de proteínas As proteínas que podem ser enzimas, hormônios, pigmentos, anticorpos, realizam atividades específicas no metabolismo dos seres vivos. São produzidas sob o comando do DNA. Observe

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA Aluno: Módulo I Professor: Leandro Parussolo Unidade Curricular: Biologia Celular ATIVIDADE

Leia mais

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas Seleção de Mestrado 2012-B INSTRUÇÕES (LEIA ATENTAMENTE ANTES DE PREENCHER A PROVA): a. Identifique sua prova unicamente com

Leia mais