Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Save this PDF as:
Tamanho: px
Começar a partir da página:

Download "Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi"

Transcrição

1 Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi

2 Tradução em eukarya e prokarya Eventos pós-transcricionais

3 Processo de síntese de proteínas RNAm contém o código do gene RNAt é o adaptor que liga o mundo do ácido nucléico ao mundo das proteínas RNAr faz parte do ribossomo e contém a enzima que catalisa a ligação entre aminoácidos adjacentes

4 ~60-90bp trna é o adaptador de Crick

5 Transcrição e processamento do RNAt É transcrito de um gene presente no DNA... E então processado Contém o código do adaptador

6 O código genético Tradução in vitro de sequências de polinucleotídeos conhecidos Diferenças nas cadeias laterais dos aminoácidos Ribozimas X Enzimas

7 O código genético é redundante Gamow: 20 aminoácidos devem ser codificados por, pelo menos 3 bases UUA CCU AUU AAA CGG Leu Pro Ile Lis Arg CUG CCG AUA AAG CGA Códon: cada grupo de três nucleotídeos consecutivos

8 Open reading frame determinação da janela de leitura (ORF) Código não-sobreposto

9 As seis fases de leitura possíveis 5'3' Frame 1 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc E V W F A T G V S G R R G - G W L S V A 5'3' Frame 2 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc R S G L Q L G S L G G G V K G G C Q W 5'3' Frame 3 gaggtctggtttgcaactggggtctctgggaggaggggttaagggtggttgtcagtggcc G L V C N W G L W E E G L R V V V S G 3'5' Frame 1 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc G H - Q P P L T P P P R D P S C K P D L 3'5' Frame 2 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc A T D N H P - P L L P E T P V A N Q T 3'5' Frame 3 ggccactgacaaccacccttaacccctcctcccagagaccccagttgcaaaccagacctc P L T T T L N P S S Q R P Q L Q T R P

10 Pareamento códon-anticódon Pareamento de bases Watson-Crick nas duas primeiras bases do códon 3-5 to 5-3 (pareamento anti-paralelo)

11 Bases oscilantes (wooble) A base 3 do códon é oscilante O contato químico não é perfeito (3D)

12 Inosina, derivado de Adenina

13 trna contém bases modificadas Processamento do trna

14 Como o aminoácido correto é ligado Como o trna correto é ligado ao aminoácido? ao trna? Como o código genético funciona molecularmente

15 trna-aminoacil sintetases Ligam o trna e o aminoácido Reconhecem o anticódon e carregam o aminoácido correto

16 Aminoácidos ativados

17 Ativação do triptofano

18 Uma por aminoácido? Quantas trna-aminoacil Ou uma por códon? Uma única amino acil trna sintetase liga um aminoácido a todos os seus trnas transferases?

19 Classes de trna aminoacil transferases

20 Controle da tradução I Afinidade da enzima pelo trna disposto no código trna errado liga-se lentamente e desliga-se rapidamente A adição do aminoácido ao trna incorreto é muito lenta

21 Controle da tradução II O aminoácido deve se encaixar no sítio sintético da trna-aminoacil -sintetase... e não ao sítio de edição Mecanismo de peneira dupla

22 (des)controle da tradução III Não acontece verificação do aminoácido na tradução O controle, portanto, é feito apenas no momento da aminoacilação do trna

23 O congelamento do código genético Conservado em praticamente todos os organismos vivos Maquinaria altamente complexa e eficiente Surgiu uma única vez e todos os organismos vivos hoje são descendentes do organismo onde o código surgiu adaptação!

24 Ribossomos

25 Estrutura 2D e 3D do RNAr

26 Ribossomos de E. coli

27 Ribossomos eucarióticos O peso do ribossomo se deve mais ao componente de RNA do que ao componente protéico

28 Ribosomal components

29 Reciclagem ribossomal

30 Sítios ribossomais utilizados na tradução Quatro sítios: um para mrna e três (sítio A, P e E) para trna

31 Prokarya X Eukarya RNA policistrônico Operon RNA monocistrônico interação entre proteínas que se ligam a cauda polia e proteínas do Complexo de Iniciação

32 Iniciação da tradução Procariotos: Shine-delgarno (Ribosome Binding Site) Consenso de Kosak GCCRCCAUGG hipótese do scanning pelo ribossomo necessidade do 5 CAP

33 Start codon Normalmente codifica metionina

34 Iniciação da Tradução Fatores de iniciação da tradução IF-1 e IF-3 trna carregado formil-metionina

35 Seleção do trna correto Somente se pareia o anti-códon é que... Liga-se também ao rrna

36 Complexo de iniciação da tradução mrna liga à subunidade menor do ribossomo trna contendo metionina (formilada) liga-se ao complexo Fatores de iniciação da tradução ajudam Subunidade maior reunese ao complexo

37 Sítios peptidil e aminoacil

38 5 H H -OOC C N - COH R N-terminal H -OOC C - NH 2 R Ribossomo U A C A U G U U U C U U G A C C C C U G A G G C G U U 5 3 RNA mensageiro

39 U A C A U G U U U C U U G A C C C C U G A G G C G U U Formação da ligação peptídica

40 Translocação Requer GTP H -OOC C - NH 2 R A U G U U U C U U G A C C C C U G A G G C G U U

41 H -OOC C - NH 2 R A U G U U U C U U G A C C C C U G A G G C G U U

42 - - - H O H H H H -OOC C N C C N C- C N -COH R H R O R A U G U U U C U U G A C C C C U G A G G C C A G

43 Sítios peptidil e aminoacil O ribossomo possui 3 sítios onde cabem moléculas de trna O alongamento da tradução Proteínas são geradas do N ao C terminal

44 Ordem de ligação de aminoácidos

45 Ligação peptídica

46 Alongamento da tradução

47

48 Alongamento ainda... O alongamento continua até o aparecimento de um códon de parada (stop codon) UAA UAG UGA

49 Terminação da Tradução Fator de terminação ligase ao stop codon UAA, UGA, UAG Proteína é liberada Complexo é desfeito

50 Releasing factor

51 Tradução em procariotos Tradução em eucariotos

52 Tempo de execução do processo

53 Possíveis erros no processo Erro na tradução Proteína incorretamente produzida Dano metabólico

54 Frameshift Alteração da fase de leitura (frame) trnas específicos passam pelo stopcodon 4 bases lidas como 3 Ultrapassa um códon de terminação Produção de proteínas fundidas

55 Chaperonas I Complexo protéico que auxilia na montagem da estrutura 3D de uma proteína

56 Chaperonas II

57 Modificações pós-traducionais Formação de ligações dissulfeto/dobramento Clivagem da cadeia Fosforilação Glicosilação Metilação/Acetilação Adição de âncoras lipídicas Regulação da função protéica

58 Proteína Pronta! E agora? Destinos possíveis...

59 Endereçamento de proteínas I - Co-traducional (vias de secreção): ER Golgi Membrana plasmática Meio extracelular II- pos-traducional: núcleo mitocôndria cloroplasto Lisossomos/pero xissomos Sinais de endereçamento na Proteína: 1- Seqüência sinal (16-30 aminoácidos no N-terminal) 2- Sinal de endereçamento nuclear ( 4-8 aminoácidos com carga positiva, ex.: PKKKRLV) 3- Sinal de retenção no RE (KDEL)

60 Proteínas organelares Produzidas com sinal de exportação Sinal é clivado quando a proteína alcança seu destino celular

61 Proteínas transmembrana Domínios hidrofóbicos são capazes de invadir as regiões lipídicas (também hidrofóbicas) da membrana plasmática

62 Inibidores de síntese protéica Antibióticos inibem a síntese de proteínas bacteriana Tetraciclina Liga no RNA 16S (sub 30S) Inibe a ligação do aminoacyl trna no sítio A Cloranfenicol Liga na subunidade 50S

63 Conclusões Tradução é o processo de produção de proteínas A regulação ocorre principalmente na transcrição Modificações pós-traducionais são importantes para regular a função protéica Diferentes tipos de RNAs e proteínas atuam no processo A trna aminoacil sintetase é a protéina responsável pelo código genético A última molécula a se juntar ao complexo de iniciação é a subunidade maior do ribossomo As proteínas normalmente começam com o aminoácido metionina A tradução continua até que haja um stop codon As proteínas precisam ter uma conformação 3D correta pra funcionar (chaperonas ajudam na montagem) Muitas proteínas contêm sinais de sinalização celular

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais

26/04/2015. Tradução. José Francisco Diogo da Silva Junior Mestrando CMANS/UECE. Tradução em eucarióticos e procarióticos. Eventos pós transcricionais Tradução José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Tradução em eucarióticos e procarióticos Eventos pós transcricionais 1 Processo de síntese de proteínas mrna contém o código do gene trna

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

TRANSCRIÇÃO DO DNA: Tipos de RNA

TRANSCRIÇÃO DO DNA: Tipos de RNA TRANSCRIÇÃO DO DNA: Síntese do mrna Gene (Unidades transcricionais) Tipos de RNA Tipos de RNA polimerase Tipos de RNA polimerase DNA dependente Transcrição em Procariotos Transcrição em Eucariotos Mecanismos

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Estudo Dirigido. Organelas membranosas- Compartimentos intracelulares- endereçamento de proteínas

Estudo Dirigido. Organelas membranosas- Compartimentos intracelulares- endereçamento de proteínas UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR Estudo Dirigido Organelas membranosas- Compartimentos

Leia mais

Universidade Federal de Ouro Preto SÍNTESE PROTEICA

Universidade Federal de Ouro Preto SÍNTESE PROTEICA Universidade Federal de Ouro Preto SÍNTESE PROTEICA SÍNTESE DE MACROMOLÉCULAS Macromoléculas: Proteínas - aa Carboidratos - monossacarídeos Lipídeos ácidos graxos Macromoléculas celulares: em constante

Leia mais

Vias da Informação Genética: Metabolismo de proteína

Vias da Informação Genética: Metabolismo de proteína Universidade de São Paulo Escola de Engenharia de Lorena Departamento de Biotecnologia Curso Engenharia Química Disciplina Bioquimica Vias da Informação Genética: Metabolismo de proteína Prof: Tatiane

Leia mais

Tradução do RNA Prof. Dr. Sídio Werdes Machado

Tradução do RNA Prof. Dr. Sídio Werdes Machado Tradução do RNA Prof. Dr. Sídio Werdes Machado O QUE É TRADUÇÃO? Introdução Stryer: é a orientação da sequência dos aminoácidos em uma proteína a partir da sequência de nucleotídios do RNAm. Campbell:

Leia mais

Controle da expressão gênica

Controle da expressão gênica Programa de Biologia Celular V Curso de Verão Controle da expressão gênica Renata Ramalho Oliveira roliveira@inca.gov.br Desenvolvimento e fenótipos explicados pela modulação da expressão gênica Lehninger.

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO

Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO Biotecnologia Geral TRANSCRIÇÃO E TRADUÇÃO DNA Replicação DNA Trasncrição Reversa Transcrição RNA Tradução Proteína Transcrição É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon.

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon. FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Transcrição e tradução QBQ 204 Aula 4 (biomol)

Transcrição e tradução QBQ 204 Aula 4 (biomol) Transcrição e tradução QBQ 204 Aula 4 (biomol) Prof. João Carlos Setubal Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

BIOLOGIA. Moléculas, Células e Tecidos Transcrição e Tradução. Prof. Daniele Duó

BIOLOGIA. Moléculas, Células e Tecidos Transcrição e Tradução. Prof. Daniele Duó BIOLOGIA Moléculas, Células e Tecidos Prof. Daniele Duó O código genético É a relação entre a sequência de bases no DNA e a sequência correspondente de aminoácidos, na proteína; Guarda toda informação

Leia mais

Transcrição e tradução QBQ 102

Transcrição e tradução QBQ 102 Transcrição e tradução QBQ 102 Prof. João Carlos Setubal Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre no ribosomo Proteína

Leia mais

Código Genético. Bianca Zingales

Código Genético. Bianca Zingales Código Genético Bianca Zingales zingales@iq.usp.br Um gene - uma enzima Beadle & Tatum (1930 1940) Experimentos de genética com o fungo Neurospora. Mutações induzidas com raios X. Mutações em um único

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

BIOLOGIA. Moléculas, células e tecidos. Transcrição e tradução Parte 2. Professor: Alex Santos

BIOLOGIA. Moléculas, células e tecidos. Transcrição e tradução Parte 2. Professor: Alex Santos BIOLOGIA Moléculas, células e tecidos Professor: Alex Santos Parte 2: Síntese de proteínas Tópicos em abordagem : I Processamento do imrna em Eucariotos II Código genético III Tradução: Síntese de proteínas

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Código Genético. Bianca Zingales

Código Genético. Bianca Zingales Código Genético Bianca Zingales zingales@iq.usp.br O dogma central da Biologia Molecular Replicação Transcrição O DNA contém a informação genética Tradução As proteínas são a expressão da informação genética

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas Seleção de Mestrado 2012-B INSTRUÇÕES (LEIA ATENTAMENTE ANTES DE PREENCHER A PROVA): a. Identifique sua prova unicamente com

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito RNA aspectos funcionais e estruturais 5 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do RNA. Pré-requisito Para acompanhar mais facilmente esta

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA

MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA UNIVERSIDADE ESTADUAL DA BAHIA - UNEB DEPARTAMENTO DE CIÊNCIAS DA VIDA DCV MED049 - BIOLOGIA E BIOQUIMICA MECANISMOS GENÉTICOS BÁSICOS: DO DNA À PROTEINA Polyanna Carôzo 2016 Replicação Transcrição Tradução

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

TRADUZINDO O CÓDIGO GENÉTICO. Aula teórica 6. Maria Carolina Quecine Departamento de Genética LGN0114 Biologia Celular

TRADUZINDO O CÓDIGO GENÉTICO. Aula teórica 6. Maria Carolina Quecine Departamento de Genética LGN0114 Biologia Celular TRADUZINDO O CÓDIGO GENÉTICO Aula teórica 6 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br LEMBRANDO Um gene unidade da informação genética que controla a síntese

Leia mais

Síntese Proteica e Modificação Pós-Traducionais

Síntese Proteica e Modificação Pós-Traducionais Disciplina de Métodos Purif. e Anál. de Proteínas Curso de Ciências Biológicas Síntese Proteica e Modificação Pós-Traducionais Prof. Marcos Túlio de Oliveira mtoliveira@fcav.unesp.br www.fcav.unesp.br/mtoliveira

Leia mais

TRADUÇÃO SÍNTESE PROTEICA

TRADUÇÃO SÍNTESE PROTEICA TRADUÇÃO SÍNTESE PROTEICA Formação do Aminoacil-tRNA Durante a formação do aminoacil-trna, o aminoácido é primeiramente ativado, reagindo com o ATP. Após, é transferido do aminoacil-amp para a extremidade

Leia mais

DNA - ATGCCGAAATTTGCG. O segmento de RNAm formado na transcrição terá a sequência de bases: RNA - UACGGCUUUAAACGC

DNA - ATGCCGAAATTTGCG. O segmento de RNAm formado na transcrição terá a sequência de bases: RNA - UACGGCUUUAAACGC Transcrição da informação genética A síntese de RNA (mensageiro, por exemplo) se inicia com a separação das duas fitas de DNA. Apenas uma das fitas do DNA serve de molde para a produção da molécula de

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA Terceirão Biologia 1 Professor João CÓDIGO GENÉTICO E SÍNTESE PROTEICA 1. Síntese de proteínas pelos ribossomos a partir do RNAm. a) RNAm: molécula de RNA que contem a informação genética necessária para

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Genética de microrganismos Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Piracicaba, outubro 2014 Histórico 1868- Primeiro a estudar o núcleo

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

TRANSCRIÇÕES GÊNICAS. BIOLOGIA Keffn Arantes

TRANSCRIÇÕES GÊNICAS. BIOLOGIA Keffn Arantes TRANSCRIÇÕES GÊNICAS BIOLOGIA Keffn Arantes Tipos de RNA RNA mensageiro (RNAm) A formação do RNAm chama-se transcrição e é semelhante à replicação do DNA. Tipos de RNA RNA transportador (RNAt) Também chamado

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA Terceirão Biologia 1 Professor João CÓDIGO GENÉTICO E SÍNTESE PROTEICA Dogma central da Biologia Descreve o fluxo unidirecional de informações, do DNA à síntese de proteínas. Duplicação/Replicação Síntese

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

A descoberta da célula

A descoberta da célula A descoberta da célula O que são células? As células são a unidade fundamental da vida CITOLOGIA A área da Biologia que estuda a célula, no que diz respeito à sua estrutura e funcionamento. Kytos (célula)

Leia mais

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos.

TRADUÇÃO PROTEICA. Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. TRADUÇÃO PROTEICA Tradução é o processo de leitura da seqüência de mrna e sua conversão em uma seqüência de aminoácidos. A tradução ocorre no citoplasma e ocorre em organelas citoplasmáticas chamadas ribossomos.

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

DOGMA CENTRAL DA BIOLOGIA MOLECULAR

DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

Núcleo celular. Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares. Carioteca

Núcleo celular. Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares. Carioteca Núcleo celular Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares Carioteca Dupla camada de lipídios, contendo poros (passagem de grandes moléculas) Cariolinfa

Leia mais