Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Tamanho: px
Começar a partir da página:

Download "Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br"

Transcrição

1 Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

2 Conteúdo 1 Bioinformática 2 Seres Vivos 3 Proteínas 4 Ácidos Nucleicos 5 Genética Molecular Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

3 Motivação Crescente aumento no volume de dados biológicos GenBank: Banco de dados de sequências biológicas bases sequências UniProt: Banco de dados de proteínas Mais de 50 milhões de moléculas proteicas Apenas 500 mil completamente analisadas Atualmente, a PubMed base de dados de artigos biomédicos possui mais de 25 milhões de artigos indexados Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

4 Crescimento do GenBank Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

5 O que é Bioinformática Possível Definição Bioinformática é uma área interdisciplinar que lida com o estudo dos métodos para armazenar, recuperar e analisar informação biológica, como ácidos nucleicos, sequências proteicas, estrutura, função e interações genéticas e entre proteínas. Objetivos O principal objetivo da Bioinformática é a compreensão dos processos biológicos utilizando métodos computacionais sobre sequências. biológicas Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

6 Seres Vivos O que diferencia um ser vivo de algo inanimado? De um modo geral, seres vivos interagem ativamente com o ambiente Essa interação se dá devido a um complexo conjunto de reações químicas Nunca cessam Os produtos (saída) de uma reação podem ser reagentes (entrada) de outras Há uma constante troca de matéria com o ambiente Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

7 Seres Vivos Tantos seres vivos complexos (plantas, animais) quanto os mais simples (bactérias, vírus) têm um conjunto similar de moléculas químicas As principais moléculas são as proteínas e os ácidos nucleicos A Bilogia Molecular se dedica, basicamente, a compreender estruturas e funções dessas moléculas Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

8 Proteínas Definição: Proteínas são grandes biomoléculas (ou macromoléculas) compostas por uma ou mais cadeias de resíduos de aminoácidos. Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

9 Funções Proteicas Proteínas realizam uma grande variedade de funções nos organismos vivos, incluindo: Catálise de reações metabólicas Replicação de DNA Resposta a estímulos Transporte de moléculas Entre outras... Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

10 Aminoácidos Aminoácidos são moléculas orgânicas compostas por moléculas de carbono, oxigênio, hidrogênio e nitrogênio Cada aminoácido possui um átomo central de carbono, chamado carbono-α (C α ) Esse átomo de carbono se liga a: Um grupo amino (NH 2 ) Um grupo carboxila (COOH) Um átomo de hidrogênio (H) Um grupo R (radical ou cadeia lateral) que especifica o tipo do aminoácido Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

11 Estrutura de um Aminoácido Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

12 Exemplos de Aminoácidos Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

13 Aminoácidos Aminoácido Abreviação Símbolo Alanina Ala A Cisteína Cys C Ácido Aspártico Asp D Ácido Glutâmico Glu E Fenilalanina Phe F Glicina Gly G Histidina His H Isoleucina Ile I Lisina Lys K Leucina Leu L Metionina Met M Asparagina Asn N Prolina Pro P Glutamina Gln Q Arginina Arg R Serina Ser S Treonina Thr T Valina Val V Triptofano Trp W Tirosina Tyr Y Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

14 Aminoácidos A sequência de aminoácidos forma um encadeamento chamado cadeia principal Corresponde a uma ligação de carbono com nitrogênio A ligação N C α C é chamada ligação peptídica Ao final dessa ligação, ocorre a eliminação de uma molécula de água H 2 O Por essa razão, dizemos que as proteínas são formadas por resíduos de aminoácidos, uma vez que a estrutura desses foi alterada Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

15 Ligação Peptídica Amino acid (1) Amino acid (2) N-terminus C-terminus Peptide bond Dipeptide Water Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

16 Estruturas de Proteínas As proteínas podem se dobrar em uma estrutura tridimensional única A forma em que uma proteína se dobra é conhecida como estrutura nativa (ou conformação nativa) Existem 4 níveis de dobramento Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

17 Estruturas de Proteínas Estrutura primária: consiste na sequência de aminoácidos, sem dobramento (planar) Estrutura secundária: consiste em um dobramento local, em uma estrutura regular Os motivos mais comuns de estrutura secundária são a α-hélice, a folha-β pregueada e a volta Estrutura terciária: consiste em um dobramento global, ligando estruturas secundárias entre si Aceita-se que a estrutura terciária é única para cada proteína e é diretamente responsável pela sua função Estrutura quaternária: formada, usualmente, por aglomerados de proteínas Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

18 Dobramento Proteico Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

19 Exemplo de Proteína Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

20 Síntese de Proteínas Proteínas são responsáveis pela manutenção da vida Essas moléculas são produzidas por uma estrutura celular chamada ribossomo Nos ribossomos, os aminoácidos são combinados entre si, um por um A maneira como esses aminoácidos se ligam é determinada pelos ácidos nucleicos Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

21 Ácidos Nucleicos Definição Ácidos nucleicos são macromoléculas compostas por nucleotídeos. Correspondem às moléculas de ácido desoxirribonucleico (DNA) e de ácido ribonucleico (RNA) Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

22 Ácidos Nucleicos Cytosine Nucleobases Cytosine Guanine Guanine Adenine Base pair Adenine Uracil Thymine helix of sugar-phosphates Nucleobases of RNA RNA Ribonucleic acid DNA Deoxyribonucleic acid Nucleobases of DNA Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

23 Ácidos Nucleicos Ácidos nucleicos são responsáveis por codificar, transmitir e expressar informações genéticas Tais informações são necessárias para codificar proteínas Em outras palavras, ácidos nucleicos carregam instruções que codificam moléculas biológicas Diversas pesquisas têm sido desenvolvidas de modo a determinar as sequências de nucleotídeos de DNA e RNA Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

24 DNA O DNA possui como função a codificação de informações genéticas É composto por duas sequências de moléculas Cada molécula é uma bases nitrogenadas ou nucleotídeo Cada sequência corresponde a uma fita de DNA Existem 4 bases nitrogenadas: 1 Adenina (A) 2 Citosina (C) 3 Guanina (G) 4 Timina (T) Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

25 DNA As duas fitas de DNA se ligam de modo a formar uma dupla hélice Assim, as bases nitrogenadas se ligam em pares A T C G Seres humanos possuem mais de 3 bilhões de pares de base Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

26 RNA Diferente do DNA, o RNA é composto por uma única fita Possui uracila (U) em sua composição, em vez de timina Diferente do DNA, o RNA possui diferentes funções nas células: Transmissão de informação Decodificação de informação Transporte de aminoácidos Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

27 Cromossomos e Genoma Cada célula viva possui um conjunto de moléculas de DNA Tais moléculas estão espiraladas, formando os cromossomos O conjunto de todos os cromossomos de uma célula é chamado genoma Cada espécie possui um número característico de cromossomos em seu genoma: Escherichia coli: 1 cromossomo; 4.6 milhões de pares de bases Drosophila melanogaster: 8 cromossomos; milhões de pares de bases Homo sapiens: 46 cromossomos; milhões de pares de bases Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

28 Cromossomo Cell DNA Nucleus Chromosome Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

29 Cromossomo Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

30 Genoma Humano Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

31 Genoma Humano Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

32 Genes Em geral (mas não sempre) informações sobre codificação de uma proteínas são armazenadas em um fragmento contínuo do DNA Cada proteína corresponde a um, e somente um, fragmento de DNA Cada fragmento é chamado gene Observação: Na verdade, é o RNA o responsável pela síntese proteica... Assim, podemos dizer que cada gene contém informações necessárias para construir uma molécula de RNA específica para cada proteína. Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

33 Código Genético Para construir uma proteína, devemos ligar cada um de seus aminoácidos Para isso, o DNA utiliza triplas de nucleotídeos Cada tripla especifica um aminoácido Cada tripla é chamada códon A relação de cada códon e cada aminoácido que um organismo especifica é chamado código genético Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

34 Código Genético Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

35 Código Genético Observações: Existem 64 possíveis códons, porém apenas 20 aminoácidos Isso ocorre pois existe redundância no código genético Códigos de STOP servem para delimitar o fim de um gene O códon AUG além de codificar a metionina, também é responsável por definir o início de um gene Estudos recentes mapearam dois novos aminoácidos: selenocisteína (Sec ou U) e pyrrolysine (Pyl ou O) Novos estudos têm sido desenvolvidos de modo a mapear corretamente tais aminoácidos no código genético Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

36 Síntese de Proteínas Síntese de proteínas é o processo segundo o qual o código armazenado por uma molécula de DNA é traduzido em proteínas Ocorre, basicamente, em duas etapas: 1 Transcrição 2 Tradução Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

37 Transcrição Na transcrição, uma molécula de DNA dá origem a uma molécula de RNA As duas fitas de DNA são separadas por meio de uma enzima chamada helicase Em seguida, outra enzima RNA polimerase lê uma das fitas e cria uma molécula de RNA, utilizando a seguinte correspondência: A U C G G C T A Essa molécula de RNA é chamada de RNA mensageiro (mrna) Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

38 Tradução Após a transcrição, o mrna migra para o citoplasma (caso a célula tenha núcleo) Em seguida, o mrna é liga a um ribossomo e é utilizado como um template para construção de uma sequência de aminoácidos Ribossomos são organelas compostas por proteínas e um outro tipo de RNA, chamado RNA ribossômico (rrna) O RNA transportador (trna) presente no citoplasma liga-se a um aminoácido (de acordo com o código genético) e o transporta até o ribossomo Finalmente, dentro do ribossomo, os aminoácidos são ligados entre si, seguindo a sequência especificada pelo código genético Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

39 Síntese de Proteínas Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

40 Síntese de Proteínas Assista ao seguinte vídeo: Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

41 Em Resumo GTGCATCTGACTCCTGAGGAGAAG CACGTAGACTGAGGACTCCTCTTC GUGCAUCUGACUCCUGAGGAGAAG V H L T P E E K DNA (transcription) RNA (translation) protein Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

42 Dogma Central Todo esse processo (replicação de DNA, produção de RNA, síntese de proteínas) é conhecido como dogma central da biologia molecular Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

43 Dogma Central Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

44 Síntese de Proteínas Observação Em organismos eucariontes, determinadas sequências de DNA são transcritas no mrna mas, em seguida, são removidas Essas sequências são denominadas íntrons e fazem parte do chamado DNA não-codificante As sequências que são mantidas no mrna são chamadas de éxons pre-mrna 5 UTR Exon Intron Exon Intron Exon 3 UTR mrna Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

45 Leitura Recomendada Setubal & Meidanis. Introduction to Computational Molecular Biology, Capítulos 1 e 2, Hunter. Molecular Biology for Computer Scientists. Link no site. Hunter. Life and Its Molecules: A Brief Introduction. Link no site. Paulo H. R. Gabriel (FACOM/UFU) Bioinformática 24 de agosto de / 45

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Influência da Genética desempenho

Influência da Genética desempenho UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

UFABC Bacharelado em Ciência & Tecnologia

UFABC Bacharelado em Ciência & Tecnologia UFABC Bacharelado em Ciência & Tecnologia Transformações Bioquímicas (BC0308) Prof Luciano Puzer http://professor.ufabc.edu.br/~luciano.puzer/ Propriedades, funções e transformações de aminoácidos e proteínas

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA. Aminoácidos. Prof. Willame Bezerra

CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA. Aminoácidos. Prof. Willame Bezerra CURSO: ENFERMAGEM DISCIPLINA: BIOQUÍMICA HUMANA PROF. WILLAME BEZERRA Aminoácidos Prof. Willame Bezerra As proteínas são as biomoléculas mais abundantes nos seres vivos e exercem funções fundamentais em

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES

UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

James Watson, Francis Crick e o DNA

James Watson, Francis Crick e o DNA Pércio Augusto Mardini Farias Este documento tem nível de compartilhamento de acordo com a licença 2.5 do Creative Commons. http://creativecommons.org.br http://creativecommons.org/licenses/by/2.5/br/

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

BIOLOGIA Prof. André Fozzy

BIOLOGIA Prof. André Fozzy BIOLOI Prof. ndré Fozzy RN E SÍNTESE PROTEIC Biologia Prof. ndré Fozzy Regiões Codificadoras e Não-Codificadoras do DN O DN é formado por 2 regiões: Intergênicas ênicas Intergênicas ênicas Região ênica

Leia mais

Conceitos Básicos de Biologia Molecular

Conceitos Básicos de Biologia Molecular Conceitos Básicos de Biologia Molecular Marcílio C. P. de Souto DIMAp/UFRN Tópicos Introdução Célula e macro-moléculas Proteínas e Ácidos nucléicos Ácidos Nucléicos Componentes DNA x RNA Estabilidade do

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica INBEQMeDI Instituto Nacional de Biotecnologia Estrutural e Química Medicinal em Doenças Infecciosas Coordenadoria de Educação e Difusão de Ciências Telefone: (16) 3373-9159 Rua 9 de julho, 1205 - Centro

Leia mais

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Teste de avaliação Nome ----------------------------------------------------------------------- Numero -------------------------------

Leia mais

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

Profa Estela Rossetto

Profa Estela Rossetto Profa Estela Rossetto Síntese de Proteínas: Um trabalho em grupo dos RNA! ATP RNAt RNAm enzimas RNAr aminoácidos Ribossomo: Organela onde ocorre a síntese de proteínas. Organela não delimitada por membrana,

Leia mais

NÚCLEO e DIVISÃO CELULAR

NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

Soluções de Conjunto de Problemas 1

Soluções de Conjunto de Problemas 1 Soluções de 7.012 Conjunto de Problemas 1 Questão 1 a) Quais são os quatro tipos principais de moléculas biológicas discutidos na aula? Cite uma função importante de cada tipo de molécula biológica na

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

ESTRUTURA DAS PROTEÍNAS

ESTRUTURA DAS PROTEÍNAS ESTRUTURA DAS PROTEÍNAS Aminoácidos ligam-se por ligações peptídicas = reação de condensação entre: OH do grupo carboxila de um aminoácido H do grupo amina do outro aminoácido ( liberação de uma molécula

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Proteínas. Enzima que Colagénio Insulina degrada a insulina (hormona)

Proteínas. Enzima que Colagénio Insulina degrada a insulina (hormona) Proteínas O seu nome deriva da palavra Grega proteios, que significa de principal importância. As proteínas desempenham um papel fundamental nos sistemas biológicos, estando associadas a todas as formas

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila

Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila Aminoácidos e Peptídios 1 Aminoácidos Aminoácido: um composto que contém tanto um grupo amino como um grupo carboxila aaminoácido: têm um grupo carboxila e um grupo amino ligados ao mesmo átomo de carbono

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO.

Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO. Bases Macromoleculares das Células Composição química das células

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Netxplica http://netxplica.com

Netxplica http://netxplica.com Teste de Avaliação de Biologia e Geologia 11.º Ano de Escolaridade Crescimento e Renovação Celular Duração do Teste: 90 minutos VERSÃO 1 Na folha de respostas, indica de forma legível a versão do Teste.

Leia mais

TURMA DE REVISÃO - EMESCAM 1º SEMESTRE 2012 - QUÍMICA

TURMA DE REVISÃO - EMESCAM 1º SEMESTRE 2012 - QUÍMICA TURMA DE REVISÃO - EMESCAM 1º SEMESTRE 2012 - QUÍMICA Prof. Borges EXERCÍCIOS DE AMINOÁCIDOS 1. (Fuvest) A hidrólise de um peptídeo rompe a ligação peptídica, originando aminoácidos. Quantos aminoácidos

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito RNA aspectos funcionais e estruturais 5 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do RNA. Pré-requisito Para acompanhar mais facilmente esta

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais