Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática

Tamanho: px
Começar a partir da página:

Download "Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática"

Transcrição

1 Explorando bancos de dados genômicos e introdução à bioinformática Guilherme Targino Valente Marcos Tadeu Geraldo 22/07/2011 Bioinformática É a aplicação de estatística e ciência da computação no campo da Biologia Molecular O termo foi cunhado por Paulien Hogeweg e Ben Hesper em 1978 no estudo de processos de informática em sistemas bióticos Paulien Hogeweg 1

2 Objetivo da Bioinformática Aumentar o entendimento dos processos biológicos Bioinformática atualmente Criação e avanços em: banco de dados algoritmos técnicas computacionais estatísticas Finalidade: solucionar problemas teóricos e práticos oriundos da manipulação e análise de dados biológicos 2

3 Sequências Estrutura molecular Genomas BIOINFORMÁTICA Modelagem biológica Evolução Regulação e expressão gênica 3

4 Importância da Análise de Sequências Comparação de sequências para analisar suas semelhanças e diferenças Análise da estrutura de genes: matrizes de leitura, distribuição de introns e exons e elementos regulatórios Busca por pontos de mutação, a fim utilizá-los como marcadores genéticos Informações sobre evolução e diversidade genética entre organismos Análise da funcionalidade de genes Como recuperar sequências dentro de um banco de dados 4

5 FASTA Programa de alinhamento e análise de sequências criado por W.R. Pearson e D.J. Lipman em 1988 Formato da sequência: > nome_da_sequência Linha de definição ARCGTCRGCKINTANDRGCKINTANDCKINTAN DARCGTCRGCKINTANDRGCKINTAND Sequência 5

6 6

7 7

8 8

9 9

10 10

11 Como obter sequências experimentalmente? Gene ou sequência de interesse Restrição Enzimática Reação em cadeia da polimerase (PCR) 11

12 12

13 13

14 Conseguimos as sequências......e AGORA? Próximo passo, 14

15 Alinhamento de sequências O que é? = um alinhamento de sequências é uma forma de organizar sequências primárias de DNA, RNA ou proteínas Por que alinhar? = identificar regiões similares que possam ser consequência de relações funcionais, estruturais ou evolucionárias entre elas Homologia x Similaridade Valor Qualitativo Valor Quantitativo Homólogo Não-homólogo Valor de inferência 15

16 SE, 2 sequências de um alinhamento Compartilham ancestral comum Discordâncias entre as sequências (mismatches) Espaços (gaps) Mutações pontuais Inserções ou deleções (indels) Alinhamento: Global x Local 16

17 Alinhamento: Par a par (pairwise alignment) Múltiplo (multiple alignment) 17

18 Algoritmos de alinhamento ClustalW MUSCLE T-COFFEE COBALT MAFFT PRRN E muitos outros... 18

19 CLUSTALW (http://www.ebi.ac.uk/tools/msa/clustalw2/) MUSCLE (http://www.ebi.ac.uk/tools/msa/muscle/) 19

20 COBALT (http://www.ncbi.nlm.nih.gov/tools/cobalt/) 20

21 21

22 22

23 BLAST Basic Local Alignment Search Tool O que é? = é um algoritmo para acessar um banco de dados e buscar sequências de aminoácidos ou nucleotídeos que sejam similares a uma sequência-alvo específica Qual o objetivo do BLAST? = comparar informações de sequências biológicas primárias Tipos de BLAST Tipos de BLAST Query (sequênciaalvo) Hits (sequências retornadas) blastn Nucleotídeos Nucleotídeos blastp Aminoácidos Aminoácidos blastx tblastn tblastx Nucleotídeos (Seis matrizes de leitura) Nucleotídeos (Seis matrizes de leitura) Aminoácidos Aminoácidos Nucleotídeos (Seis matrizes de leitura) Nucleotídeos (Seis matrizes de leitura) 23

24 chance do acaso VALOR DE CONFIANÇA Valor de E Confiança Query AGTTTAGAGATTCCGCCTGGCGCTGGAAGAGATCAGG 24

25 Query AGTTTAGAGATTCCGCCTGGCGCTGGAAGAGATCAGG Hit 1 CCGCCTGG Query AGTTTAGAGATTCCGCCTGGCGCTGGAAGAGATCAGG Hit 1 CCGCCTGG Hit 2 GAGATTCCACCTGGCCATGGAAGAGA 25

26 26

27 27

28 28

29 29

30 OUTRAS FERRAMENTAS PARA ANALISAR SEQUÊNCIAS ORF Finder ORF = Open Reading Frame 30

31 ATGCCATGCGATGTTTGAGCATCTA... RF 1 ATG CCA TGC GAT GTT TGA RF 2 RF 3 A TGC CAT GCG ATG TTT GAG CAT... AT GCC ATG CGA TGT TTG AGC ATC... ATGCCATGCGATGTTTGAGCATCTA... RF 1 ATG CCA TGC GAT GTT TGA RF 2 RF 3 A TGC CAT GCG ATG TTT GAG CAT... AT GCC ATG CGA TGT TTG AGC ATC... 31

32 ATGCCATGCGATGTTTGAGCATCTA... RF 1 ATG CCA TGC GAT GTT TGA RF 2 RF 3 A TGC CAT GCG ATG TTT GAG CAT... AT GCC ATG CGA TGT TTG AGC ATC... ATGCCATGCGATGTTTGAGCATCTA... RF 1 ATG CCA TGC GAT GTT TGA RF 2 RF 3 A TGC CAT GCG ATG TTT GAG CAT... AT GCC ATG CGA TGT TTG AGC ATC... 32

33 33

34 34

35 35

36 36

37 Transeq Traduz em aminoácidos uma sequência de nucleotídeos 37

38 Busca por Motifs Motif (ou domínio): é um padrão de sequência de nucleotídeo ou aminoácido, normalmente associada a alguma significância biológica GENE SEQUÊNCIA DE NUCLEOTÍDEOS OU AMINOÁCIDOS MOTIF 38

39 pfam Banco de dados de famílias de proteínas Busca e alinhamento de motifs característicos de cada família 39

40 40

41 (http://hits.isb-sib.ch/cgi-bin/pfscan) 41

42 (http://www.genome.jp/tools/motif/) 42

43 43

44 Bibliografia em Bioinformática Bibliografia em Bioinformática 44

45 Bibliografia em Bioinformática Bibliografia em Bioinformática 45

46 For Dummies Collection 46

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

Bioinformática. João Varela jvarela@ualg.pt. Aula T4 CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA

Bioinformática. João Varela jvarela@ualg.pt. Aula T4 CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA Bioinformática CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA João Varela jvarela@ualg.pt Aula T4 Esquema de anotação Annothaton 1. Determinar a localização das

Leia mais

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Dezembro - 2006 Bioinformática e Anotação Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Hoje 1. Introdução à Genômica 2. Introdução à Bioinformática 3. Introdução à Anotação

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela jvarela@ualg.pt Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos Bioinformática Alinhamento de Sequências Prof. Msc. Rommel Ramos 2013 Sumário 1. Comparação de Sequências 2. O que é alinhamento? 3. Tipos de Alinhamento 4. Algoritmos 5. Métodos de Alinhamento Comparação

Leia mais

Introdução à Bioinformática

Introdução à Bioinformática Introdução à Bioinformática Sónia Andrade setembro/2012 ESALq - USP 1 O que é bioinformática... é a pesquisa, desenvolvimento e aplicação de ferramentas e abordagens computacionais que permitem o uso de

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle Introdução ao SRS Sequence Retrieval System Marcelo Falsarella Carazzolle Resumo Motivação Introdução Bancos de Dados Ferramentas de bioinformática SRS Exemplos Motivação Existem muitos bancos de dados

Leia mais

UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS

UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS 2 BIOINFORMÁTICA ESTRUTURAL Área da bioinformática que se aplica ao estudo da estrutura das moléculas Desafio

Leia mais

Tutorial Introdução a anotação e comparação de genomas Tiago Mendes Doutorando em Bionformática

Tutorial Introdução a anotação e comparação de genomas Tiago Mendes Doutorando em Bionformática Tutorial Introdução a anotação e comparação de genomas Tiago Mendes Doutorando em Bionformática Hoje iremos trabalhar com dois programas free desenvolvidos pelo Sanger institute: Artemis e ACT. Artemis

Leia mais

O que são domínios protéicos

O que são domínios protéicos Domínios protéicos O que são domínios protéicos Domínios protéicos é uma parte da cadeia polipeptídica que pode de enovelar independentemente para formar uma estrutura compacta e estável A existência de

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Acerca da bioinformática em geral, julgue os itens subsequentes. 41 A bioinformática pode ser definida como uma área multidisciplinar que envolve principalmente a Biologia, a Ciência da Computação, a Matemática

Leia mais

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!!

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!! Miguel Rocha Dep. Informática - Universidade do Minho BIOINFORMÁTICA: passado, presente e futuro!! Bragança, 11 de Maio de 2006 Porquê a Bioinformática?! Novas tecnologias experimentais da Biologia Molecular

Leia mais

COMPARAÇÃO DE SEQÜÊNCIAS DE DNA

COMPARAÇÃO DE SEQÜÊNCIAS DE DNA 144 COMPARAÇÃO DE SEQÜÊNCIAS DE DNA PUCCI NETO, João 1 Resumo: A comparação de seqüências é uma operação básica muito importante na área de biologia computacional. Neste trabalho, é implementado um algoritmo

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Desenvolvimento de uma Ferramenta. Cromatogramas

Desenvolvimento de uma Ferramenta. Cromatogramas Desenvolvimento de uma Ferramenta Web para análise automática tica de Cromatogramas Faculdade de Filosofia Ciências e Letras de Ribeirão Preto - USP Faculdade de Medicina de Ribeirão Preto USP Lariza Laura

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

Alinhamento local- Utilização do BLAST

Alinhamento local- Utilização do BLAST Alinhamento local- Utilização do BLAST BLAST Tipos de BLAST (blastn) Compara nucleotídeos (blastp) Compara proteínas Utiliza nucleotídeo como query, este é traduzido nos seus 6 quadros de leitura e é comparado

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Programa Interunidades de Pós-Graduação em Bioinformática - Universidade de São Paulo

Programa Interunidades de Pós-Graduação em Bioinformática - Universidade de São Paulo *Tópicos e Bibliografia da Prova de Seleção em Bioinformática Área: Biológicas 1 Estrutura e Função de ácidos nucleicos 1.1 Fluxo da Informação genética 1.2 Blocos estruturais do DNA e RNA 1.3 Níveis de

Leia mais

Métodos de alinhamento de sequências biológicas. Marcelo Falsarella Carazzolle

Métodos de alinhamento de sequências biológicas. Marcelo Falsarella Carazzolle Métodos de alinhamento de sequências biológicas Marcelo Falsarella Carazzolle Resumo - Introdução - Alinhamentos ótimos - Global - Local (Smith-Waterman) - Semi global - Matrizes de alinhamento (BLOSUM)

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Analise filogenética baseada em alinhamento de domínios

Analise filogenética baseada em alinhamento de domínios Analise filogenética baseada em alinhamento de domínios Moléculas biológicas e evolução Como já foi comentado anteriormente sabemos que o DNA de qualquer espécie de ser vivo sofre mutações ao longo do

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Material e Métodos Resultados e Discussão

Material e Métodos Resultados e Discussão Área: Melhoramento Genético Vegetal TRANSFERIBILIDADE DE PRIMERS MICROSSATÉLITES DE Phaseolus vulgaris PARA Vigna unguiculata Matheus Felipe Nogueira da Silva 1, Leidiane Bezerra Albuquerque 2, Rafaela

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2012-B Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas Seleção de Mestrado 2012-B INSTRUÇÕES (LEIA ATENTAMENTE ANTES DE PREENCHER A PROVA): a. Identifique sua prova unicamente com

Leia mais

Alinhamento de sequências

Alinhamento de sequências Pontifícia Universidade Católica de Goiás Departamento de Biologia Alinhamento de sequências Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Definição O alinhamento de sequências consiste no

Leia mais

Ferramentas de Bioinformática para Sequenciamento e Anotação

Ferramentas de Bioinformática para Sequenciamento e Anotação Ferramentas de Bioinformática para Sequenciamento e Anotação ------- Universidade Fed. do Rio Grande do Sul Instituto de Informática {bazzan@inf.ufrgs.br} Roteiro Bioinformática e Biologia Computacional

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado Bioinformática Trabalho prático enunciado complementar Neste texto, enunciam- se algumas considerações adicionais ao 1º enunciado e uma lista de possíveis tarefas que complementam o enunciado original

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Genômica Comparativa

Genômica Comparativa Encontro França-Brasil de Bioinformática Universidade Estadual de Santa Cruz (UESC) Ilhéus-BA - Brasil Genômica Comparativa Maria Emília M. T. Walter Departamento de Ciência da Computação Marcelo M. Brígido

Leia mais

O surgimento da Bioinformática Banco de Dados Biológicos

O surgimento da Bioinformática Banco de Dados Biológicos Rede de Biodiversidade e Biotecnologia da Amazônia Legal Programa de Pós-Graduação da Bionorte FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DEPARTAMENTO DE MEDICINA PROGRAMA DE PÓS-GRADUAÇÃO

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

A plataforma PDTIS de bioinformática: da seqüência à função

A plataforma PDTIS de bioinformática: da seqüência à função [www.reciis.cict.fiocruz.br] ISSN 1981-6278 SUPLEMENTO BIOINFORMÁTICA E SAÚDE Artigos originais A plataforma PDTIS de bioinformática: da seqüência à função DOI: 10.3395/reciis.v1i2.Sup.98pt Thomas Dan

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Bancos de dados de biomacromoléculas e recuperação de informação

Bancos de dados de biomacromoléculas e recuperação de informação Bancos de dados de biomacromoléculas e recuperação de informação O fluxo da informação genética cirauqui@pharma.ufrj.br Bancos de dados Bancos de dados Ferramenta de extração de informação 1 Bancos de

Leia mais

ANDRÉ DE SOUZA GOMES

ANDRÉ DE SOUZA GOMES ANDRÉ DE SOUZA GOMES UMA METODOLOGIA PARA IDENTIFICAÇÃO DE MÓDULOS FORMADORES DE SEQUÊNCIAS DE PROTEÍNAS MOSAICAS DO Trypanosoma cruzi A PARTIR DO PROTEOMA DO PARASITO UTILIZANDO A FERRAMENTA BLAST Monografia

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers :

Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers : Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3 São necessários dois primers : Um complementar a um trecho da fita anti-sense» Primer sense (forward)

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Análise de Dados de Expressão Gênica

Análise de Dados de Expressão Gênica Análise de Dados de Expressão Gênica Ivan G. Costa Filho igcf@cin.ufpe.br Centro de Informática Universidade Federal de Pernambuco Tópicos O que e expressão gênica? Como medir expressão gênica? Aspectos

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Evolução no repertório de proteínas. Marbella da Fonsêca Doutoranda Genética, UFRJ

Evolução no repertório de proteínas. Marbella da Fonsêca Doutoranda Genética, UFRJ Evolução no repertório de proteínas Marbella da Fonsêca Doutoranda Genética, UFRJ Proteínas Estrutura primária ordem dos aminoácidos ao longo da seqüência Alfa hélices e cadeias beta Forma final da molécula

Leia mais

Epigenética e Memória Celular

Epigenética e Memória Celular Epigenética e Memória Celular Por Marcelo Fantappié Fonte www.revistacarbono.com A epigenética é definida como modificações do genoma que são herdadas pelas próximas gerações, mas que não alteram a sequência

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

A caracterização estrutural e funcional de biomoléculas e as ferramentas de bioinformática

A caracterização estrutural e funcional de biomoléculas e as ferramentas de bioinformática A caracterização estrutural e funcional de biomoléculas e as ferramentas de bioinformática Jane Eyre Gabriel 1 Danielle Duarte Lima Germano de Figueiredo 2 Rodrigo Pessôa de Farias 2 Resumo - A bioinformática

Leia mais

Capítulo 9. Versão 0.6. Domínios, motivos proteicos e evolução por rearranjo de éxons. 1.- Domínios proteicos

Capítulo 9. Versão 0.6. Domínios, motivos proteicos e evolução por rearranjo de éxons. 1.- Domínios proteicos Capítulo 9 Versão 0.6 Domínios, motivos proteicos e evolução por rearranjo de éxons 1.- Domínios proteicos Domínios de proteínas são unidades estruturais, funcionais e evolutivas das proteínas. Um domínio

Leia mais

KT6384. Tecnologista em Saúde Pública. Prova Objetiva e Discursiva. Genômica e Sequenciamento de DNA

KT6384. Tecnologista em Saúde Pública. Prova Objetiva e Discursiva. Genômica e Sequenciamento de DNA Genômica e Sequenciamento de DNA Tecnologista em Saúde Pública Prova Objetiva e Discursiva 01. Durante o processo de replicação do DNA, a enzima requerida para a ligação entre as extremidades dos fragmentos

Leia mais

PAULO CESAR NAOUM AC&T- 2013

PAULO CESAR NAOUM AC&T- 2013 PAULO CESAR NAOUM AC&T- 2013 HEMOGLOBINAS NORMAIS MOLÉCULA DA HEMOGLOBINA HUMANA NORMAL Hb A AS HEMOGLOBINAS HUMANAS SÀO COMPOSTAS POR QUATRO CADEIAS DE AMINOÁCIDOS CONHECIDAS POR GLOBINAS E INSERIDO EM

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

Fundamentos da Evolução

Fundamentos da Evolução Fundamentos da Evolução UNIDADE VIII EVOLUÇÃO CAPÍTULO 24 Aula 02 Teorias evolucionistas Teoria Sintética Fatores evolutivos TEORIA SINTÉTICA DA EVOLUÇÃO Neodarwinismo Século XX Combina seleção natural

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

PROGRAMA DE DISCIPLINA: BIOQUÍMICA

PROGRAMA DE DISCIPLINA: BIOQUÍMICA PROGRAMA DE DISCIPLINA: BIOQUÍMICA Departamento de Ciências Fisiológicas Carga horária total: 188h Ano letivo: 2012 - Série: 1º ano - Curso de Medicina Coordenador: Professor Doutor Wagner Ricardo Montor

Leia mais

Alinhamentos de sequências e Busca de Similaridade

Alinhamentos de sequências e Busca de Similaridade Alinhamentos de sequências e Busca de Similaridade Ariane Machado Lima ariane.machado@usp.br Escola de Artes, Ciências e Humanidades - USP Contexto http://www.ekac.org/gene.html http://www.fuzzco.com/news/wp-content/uploads/27//genome.jpg

Leia mais

UMA EXTENSÃO DA ESTRUTURA DE INDEXAÇÃO MRS PARA USO EM MEMÓRIA SECUNDÁRIA

UMA EXTENSÃO DA ESTRUTURA DE INDEXAÇÃO MRS PARA USO EM MEMÓRIA SECUNDÁRIA FABIO YANAGA UMA EXTENSÃO DA ESTRUTURA DE INDEXAÇÃO MRS PARA USO EM MEMÓRIA SECUNDÁRIA MARINGÁ 2006 FABIO YANAGA UMA EXTENSÃO DA ESTRUTURA DE INDEXAÇÃO MRS PARA USO EM MEMÓRIA SECUNDÁRIA Dissertação apresentada

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

IGC - Dia Aberto 2010 Unidade de Bioinformática e Biologia Computacional

IGC - Dia Aberto 2010 Unidade de Bioinformática e Biologia Computacional 2 I Como é que o DNA codifica para proteínas? Sabia que: O DNA é constituído por fiadas de quatro nucleótidos diferentes, representados pelas letras A G T C, em que A é adenina, G guanina, T timina e C

Leia mais

Curso de Verão 2012 - Bioinformática

Curso de Verão 2012 - Bioinformática Curso de Verão 2012 - Bioinformática Bancos de Dados Biológicos Márcio K. Oikawa - UFABC marcio.oikawa@ufabc.edu.br Agenda Introdução: O que são bancos de dados? Por que são importantes? Bancos de dados

Leia mais

MARCO TÚLIO NOGUEIRA SILVA

MARCO TÚLIO NOGUEIRA SILVA MARCO TÚLIO NOGUEIRA SILVA ALINHAMENTO MÚLTIPLO GLOBAL DE SEQÜÊNCIAS PELA REPRESENTAÇÃO DE PROFILE E CLUSTERIZAÇÃO: COMPARAÇÃO COM OS RESULTADOS DO CLUSTALW (EMBL-EBI) Monografia de graduação apresentada

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

IBM1029 Introdução à Bioinformática. O Início da Bioinformática 27/03/2017. Aula 2. O Início. Bioionformática: definição

IBM1029 Introdução à Bioinformática. O Início da Bioinformática 27/03/2017. Aula 2. O Início. Bioionformática: definição IBM1029 Introdução à Bioinformática Profa Dra Silvana Giuliatti Departamento de Genética FMRP silvana@fmrp.usp.br O Início da Bioinformática Aula 2 O Início Trabalho de Margaret Dayhoff e colaboradores:

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2013-A

Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas. Seleção de Mestrado 2013-A 1 Programa de Pós-Graduação Stricto Sensu em Biologia Computacional e Sistemas Seleção de Mestrado 2013-A INSTRUÇÕES (LEIA ATENTAMENTE ANTES DE PREENCHER A PROVA): a. Identifique sua prova unicamente com

Leia mais

Alinhamentos e Busca de Similaridade. Ariane Machado Lima

Alinhamentos e Busca de Similaridade. Ariane Machado Lima Alinhamentos e Busca de Similaridade Ariane Machado Lima Busca de identidade Identificar o que é determinada seqüência Ex.acabou de seqüenciar, seria contaminante? Outras fases de um projeto de seqüenciamento

Leia mais

TIPOS DE MUTAÇÕES UNIDADE DE DOENÇAS METABÓLICAS- HOSPITAL SANT JOAN DE DÉU

TIPOS DE MUTAÇÕES UNIDADE DE DOENÇAS METABÓLICAS- HOSPITAL SANT JOAN DE DÉU TIPOS DE MUTAÇÕES Para uma melhor leitura e compreensão deste módulo, recomendamos a consulta de um artigo anterior, onde se explica como se formam as proteínas a partir do DNA. Muitas das terapias que

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Prospecção gênica e Bioinformática

Prospecção gênica e Bioinformática Secretaria de Educação Profissional e Tecnológica Prospecção gênica e Bioinformática Adilson Jayme de Oliveira/IFB-Planaltina, Doutorando PPGCA IFGoiano Rio Verde adilson.oliveira@ifb.edu.br Dra. Ana Maria

Leia mais

ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES. DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 ACTIVIDADES ESTRATÉGIAS

ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES. DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 ACTIVIDADES ESTRATÉGIAS ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES SECUNDÁRIO DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 COMPETÊNCIAS CONTEÚDOS PROGRAMÁTICOS ACTIVIDADES ESTRATÉGIAS AULAS PREVISTAS

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Balanceamento de Carga

Balanceamento de Carga 40 4. Balanceamento de Carga Pode-se entender por balanceamento de carga uma política a ser adotada para minimizar tanto a ociosidade de utilização de alguns equipamentos quanto a super utilização de outros,

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

MUTAÇÃO 22/5/2012. Mutação gênica ou mutação de ponto: Importância da Mutação. Fonte de variabilidade genética, matéria prima para a evolução

MUTAÇÃO 22/5/2012. Mutação gênica ou mutação de ponto: Importância da Mutação. Fonte de variabilidade genética, matéria prima para a evolução Importância da Mutação MUTAÇÃO Fonte de variabilidade genética, matéria prima para a evolução Sem a mutação não existiriam tantos alelos, e os organismos não seriam capazes de se adaptar às mudanças ambientais

Leia mais

Desenvolvimento de uma Ferramenta Web para análise automática de Cromatogramas

Desenvolvimento de uma Ferramenta Web para análise automática de Cromatogramas Desenvolvimento de uma Ferramenta Web para análise automática de Cromatogramas Lariza Laura de Oliveira, Gisele Helena Barboni Miranda, Kelly Christiane Ynoue, Vitor Soares Pereira, Fernando Sequeira Sousa,

Leia mais