Análise Genética da Cannabis sativa

Tamanho: px
Começar a partir da página:

Download "Análise Genética da Cannabis sativa"


1 Análise Genética da Cannabis sativa Rodrigo Soares de Moura-Neto Professor Associado Instituto de Biologia/UFRJ 02/09/2014


3 Perspectiva Histórica da Tipagem por DNA SNPs 2014 STR desenvolvidos 1985 FSS Quadruplex PCR desenvolvido RFLP Locais do CODIS definidos Primeiros STR multiplexes fluorescentes Eletroforese Capilar Primeiros STRs descritos Identifiler 5-dye kit e ABI PowerPlex 16 Y-STRs Tipagem de STR por CE mtdna Multiplex STRs





8 Inventor do PCR "I think I might have been stupid, in some respects, if it weren't for my psychedelic experiences. -Kary Mullis, Ph.D., Nobel Prize Laureate, Chemistry, 1993


10 Tecnologia Atual Capilar Cheio com Solução de Polímero Eletroforese Capilar Janela de Leitura m x 27 cm - + Rápida Separação do DNA Inlet (cathode) 5-20 kv Outlet (anode) Coleta de Dados e Análise

11 Sequenciamento de DNA

12 Desoxinucleotideo H

13 H Didesoxinucleotideo H



16 Mecanismo de Migração da Moléclua de DNA - DNA - DNA - DNA - DNA - DNA - + Separação de acordo com o tamanho e a forma de interação do DNA com o Polímero existente no interior do capilar

17 Janela de Leitura ABI 3100 Array Detection

18 ABI Prism 3100 Analizador Genético

19 Tipo de Analisador Genético (Sequenciador) AB Prism 3100 Genetic Analyzer

20 ABI Prism 3500 Analizador Genético



23 Mitocondria

24 Heavy (H) strand S2 L2 H ND5 ND4 ND4L R ND3 G Genoma Mitocondrial HV1 cyt b E ND6 COIII Control region (D-loop) T ATP6 P ATP8 O H 1/16,569 K COII F S1 HV Light (L) strand 16,569 bp 12S rrna O L D V Q A N C Y 16S rrna COI L1 ND1 I M ND2 W 9-bp deletion 22 trnas 2 rrnas 13 genes Coding Region




28 A B C D


30 B C A T T A A C T G 0 A G 2 A 0 A 0 C 0 G 0 A 0 = 2 B T G A A C T G 0 A C 1 A 0 G 1 C 0 T 2 G 1 = 5 C A T T A A C T G 0 A C 1 A 0 D G 1 C 0 T 2 G 1 = 5 D B A T T A A C T G 0 A C 1 A 0 C 2 C 0 T 2 A 0 = T G A A C T C A G C T G 0 A T T 0 G C 1 C 0 A 0 D A 0 C 2 C 1 C 0 C 0 T 2 T 0 A 0 = 5 C

31 Matriz de Informação Topologia A B C D A - B 2-1,5 1 1 A B C D ,5 1 1 C D

32 A B C D

33 A Jornada Humana Out of Africa


35 Sistema de STR para Cannabis sativa

36 Eletroferograma de 05 Locais de STR em Cannabis sativa

37 O Sistema de STR permite a análise filogenética de evolução rápida e, portanto, recente.

38 Variação Genética por AFLP de Cannabis sp, em diferentes cidades americanas

39 Sistemas de evolução lenta,como haplótipos do DNA mitocondrial e do cloroplasto, permitem um estudo global da distribuição da Cannabis sp.

40 Cloroplasto

41 Genoma do Cloroplasto

42 Haplótipo de mtdna de Cannabis sativa

43 Distribuição dos Haplótipos de mtdna de Cannabis sativa

44 Identificação e Caracterização Molecular da Cannabis sativa através do Perfil de DNA: Barcoding como Ferramenta de Inteligência Policial no Estado do Rio de Janeiro

45 Cannabis sativa é a droga ilícita mais consumida no mundo e há uma grande dificuldade em identificar e individualizar as amostras de Cannabis sp. Por isso, técnicas genéticas estão cada vez mais sendo adotadas para a sua identificação. DNA Barcoding é uma região curta e padronizada que contém suficiente variabilidade entre as espécies; é curta o suficiente para ser sequenciada em uma única reação; e contém regiões conservadas para o desenvolvimento de iniciadores universais.

46 Teste colorimétrico para detecção de canabinóides pelo método de Duquenois-Levine. (A) Passo1: Adição do reagente de Duquenois na amostra, (B) Passo 2: Adição de ácido clorídrico, (C) Passo 3: Adição de clorofórmio. Amostras com canabinóides tornam-se roxas com a adiição do reagente de do ácido clorídrico. Com o clorofórmio, o roxo passa para a camada orgânica, indicando a presença da substância (DEA - Lab Processes).

47 Cromatografia em camada delgada (TLC) para detecção de diferentes compostos, extratos vegetais, etc.

48 Objetivos Desenvolver e validar técnicas de identificação genética da Cannabis sativa; Testar o desempenho do gene de rbcl para identificação da espécie; Encontrar haplótipos em Cannabis sativa, apreendidas no Estado do Rio de Janeiro.

49 Material e Métodos Material genético extraído com o kit DNeasy Plant Mini (Qiagen); Iniciadores universais do gene de rbcl : ESrbcL628F e ESrbcL1361R; Amplificação de uma região de 733 pb;

50 Material e Métodos Sequenciamento por BigDye Terminator v 3.1 (Life Technologies); eletroforese no 3500HID, usando Data Collection e Sequencing Analysis (Applied Biosystems); Análise dos dados nos programas Geneious e Mega 5.1.

51 Regiões das apreensões das amostras de C. sativa

52 Amostras de C. sativa ICCE/PCERJ IPPGF/PCERJ DNA LabFor/UFRJ.

53 Amostras de maconha cedidas pela PCERJ

54 DNA Genômino DNA Amplificado M 1 2 trnl-trnf (cpdna)

55 Eletroforese em gel de agarose 1,5% de uma aliquota dos produtos da amplificação do gene rbcl

56 Iniciadores utilizados na reação de amplificação (PCR) Nome Sequência do Iniciador GenBank Tamanho ESrbcL628F F: CCATTYATGCGTTGGAGAGATCG Gene rbcl 733 pb ESrbcL1361R R:TCAGGACTCCACTTACTAGCTTCACG Iniciadores rbcl alinhados ao gene rbcl de Morus indica, indicados abaixo da figura: ESrbcL628F e ESrbcL1361R. O produto amplificado teria um tamanho de 732 pb, aproximadamente.

57 Parte do alinhamento das amostras do Rio de Janeiro, evidenciando a sequência consenso de 516pb.

58 Sequência Consenso das Amostras do Rio de Janeiro (Cannabis sativa RIO DE JANEIRO)

59 Posição dos SNPs na sequência. SNP#1 em destaque no alinhamento superior, e SNP#2 em destaque no alinhamento inferior.

60 Diferenças encontradas nas sequências do gene de rbcl de C. sativa, das amostras do Rio de Janeiro, Reino Unido, Estados Unidos e China. Amostra Posição no gene SNP# (G/A) SNP# (C/T) Rio de Janeiro G C Reino Unido G T Estados Unidos G T China A C

61 Diferenças encontradas na sequência de aminoácidos entre as amostras do Rio de Janeiro, Reino Unido, Estados Unidos e da China. Amostra Rio de Janeiro Reino Unido Estados Unidos China Posição na cadeia polipeptídica 19411(V/I) Valina Valina Valina Isoleucina

62 SNP#1 SNP#2

63 Árvore filogenética da família Cannabaceae (gene rbcl)

64 Parte da árvore mostrando o grupo monofilético de Cannabis sp. e de Humulus sp., com 1000 réplicas de bootstrap (números nos clados).

65 Árvore filogenética da família Cannabaceae (gene trnl-f)

66 Rede Filogenética de Cannabaceae (gene rbcl)

67 Rede Filogenética de Cannabaceae (gene trnl-f)

68 Discussão e Conclusão 1. As doze amostras de C. sativa, apreendidas no Rio de Janeiro, mostraram-se idênticas. Possivelmente ao fato de todas serem originárias de cultivares geneticamente próximos ou idênticos. 2. Em comparação com outras amostras do gene de rbcl de C. sativa, depositadas no GenBank, observamos três haplótipos distintos. Um diferenciando as amostras do Rio de Janeiro, outro da China e, um terceiro comum entre os Estados Unidos e Reino Unido.

69 Discussão e Conclusão 3. Essas diferenças encontradas levam a uma única mudança de aminoácido. A Valina foi encontrada na posição nas amostras do Rio de Janeiro, Estados Unidos e Reino Unido, enquanto que a Isoleucina foi encontrada na amostra da China. 4. Análise filogenética sugere que essa mutação tenha ocorrido após a expansão da Cannabis a partir da Ásia. 5. A ocorrência do SNPs encontrados no gene de rbcl, entre as amostras do Rio de Janeiro, Estados unidos, Reino Unido e China, pode ser usado como marcador biogeográfico, sugerindo que se trata de uma assinatura genética para análise forense.

70 Apresentação no IV Congresso de Genética Forense e publicação na Gene rbcl como barcode para identificação forense de Cannabis sativa. Ribeiro ASD 1,2 ; Dias VHG 1 ; Mello ICT 1 ; Silva R 3 ; Sabino BD 4 ; Garrido RG 5 ; Seldin L 6 ; Moura-Neto RS 1,2 1 Laboratório de Biologia Molecular Forense, Instituto de Biologia/UFRJ. 2 Instituto Nacional de Metrologia, Qualidade e Tecnologia, INMETRO. 3 Laboratório de Metabolismo Macromolecular Firmino Torres de Castro, Instituto de Biofísica Carlos Chagas Filho/UFRJ 4 Instituto de Criminalística Carlos Éboli /DGPTC/PCERJ. 5 Instituto de Pesquisas e Perícias em Genética Forense, /DGPTC/PCERJ. 6 Instituto de Microbiologia Prof. Paulo de Góes/UFRJ

71 Obrigado Fim

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais


SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais


GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais


PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D

Rachel Siqueira de Queiroz Simões, Ph.D Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Analise filogenética baseada em alinhamento de domínios

Analise filogenética baseada em alinhamento de domínios Analise filogenética baseada em alinhamento de domínios Moléculas biológicas e evolução Como já foi comentado anteriormente sabemos que o DNA de qualquer espécie de ser vivo sofre mutações ao longo do

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais


TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Quim. Nova, Vol. XY, No. 00, S1-S5, 200_ TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Pedro L. R. da Cruz a, Leila R. Giarola b, Suellen da Silva Moraes a, Déborah

Leia mais



Leia mais


CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais


PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais



Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

DNA profiling parte 2

DNA profiling parte 2 Faculdade Milton Campos Curso Lato Sensu em Medicina Legal Disciplina: Bioinformática e Investigação Criminal Professor: Eduardo Campos dos Santos DNA profiling parte 2 Belo Horizonte Outubro/Novembro

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais



Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais


SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas

O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas Centro de Gestão e Estudos Estratégicos Ciência, Tecnologia e Inovação O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas Ana Maria Lima de Azeredo 2 O Código de

Leia mais Sibele Borsuk Sibele Borsuk Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA Sibele Borsuk Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@; 2 Escola

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais



Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins ( Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais


APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais



Leia mais


UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses Instruções específicas Genotipagem de amostras A metodologia descrita corresponde à versão que foi optimizada no nosso

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais



Leia mais



Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais



Leia mais


USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais



Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Aula 11. Prof. Rafael Sousa

Aula 11. Prof. Rafael Sousa Analítica V: Aula 11 Eletroforese capilar Prof. Rafael Sousa Departamento de Química - ICE Notas de aula: EletroforeseCapilar(EC) TÉCNICA ELETROANALÍTICA HISTÓRICO

Leia mais

Desenvolvimento de uma Ferramenta. Cromatogramas

Desenvolvimento de uma Ferramenta. Cromatogramas Desenvolvimento de uma Ferramenta Web para análise automática tica de Cromatogramas Faculdade de Filosofia Ciências e Letras de Ribeirão Preto - USP Faculdade de Medicina de Ribeirão Preto USP Lariza Laura

Leia mais

Marcadores Moleculares aplicados a organismos de interesse epidemiológico

Marcadores Moleculares aplicados a organismos de interesse epidemiológico Marcadores Moleculares aplicados a organismos de interesse epidemiológico 17 a 22 de agosto de 2009 Local: SUCEN Superintendência de Controle de Endemias Rua Paula Souza, 166 - Luz - São Paulo - SP Realização

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

Abordagens moleculares no estudo da diversidade microbiana

Abordagens moleculares no estudo da diversidade microbiana A vida sem microrganismos não seria possível! Abordagens moleculares no estudo da diversidade microbiana Teresa Lino Neto Departamento de Biologia Universidade do Minho 1 Importantes

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

Bacteria Archaea Eukarya

Bacteria Archaea Eukarya PROVA PARA AVALIAÇÃO DE CAPACIDADE PARA FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS 2014/2015 Instituto Superior de Engenharia Licenciatura em Tecnologia e Segurança Alimentar Componente específica

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR:

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR: RTSD01-II Fator II G20210A Q PCR Alert Kit Rev. 04 Out/2013 Instruções de Uso USO PRETENDIDO O produto FATOR II Q-PCR Alert é um kit para teste de amplificação quantitativa de ácidos nucleicos para a determinação

Leia mais


CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais


BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes

2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes PELD Programa de Pesquisas Ecológicas de Longa Duração 119 2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes Alberto José Prioli Sônia Maria Alves Pinto Prioli Laudenir Maria Prioli Thatiana

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais



Leia mais

Assistência técnica em genética forense: esferas de atuação e o mercado de trabalho no Brasil

Assistência técnica em genética forense: esferas de atuação e o mercado de trabalho no Brasil Assistência técnica em genética forense: esferas de atuação e o mercado de trabalho no Brasil Maria Elizabeth Menezes,MSc,Ph.D MELMENEZES2001@YAHOO.COM A assistência técnica na área de genética forense

Leia mais

Genes extranucleares

Genes extranucleares Genes extranucleares Organização do Genoma Humano GENOMA HUMANO Coding DNA Genes and generelated sequences Nuclear genome 3000 Mb 30000 genes 30% 70% Unique or moderately repetitive 10% 90% Noncoding DNA

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Prova de Química e Biologia

Prova de Química e Biologia Provas Especialmente Adequadas Destinadas a Avaliar a Capacidade para a Frequência dos Cursos Superiores do IPVC dos Maiores de 23 Anos Prova de Química e Biologia Prova modelo Prova Específica de Química

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais



Leia mais

Universidade Estadual do Norte do Paraná UENP

Universidade Estadual do Norte do Paraná UENP 1 Universidade Estadual do Norte do Paraná UENP Formulário V do Edital Nº 004/2013 - PIBIC/UENP RELATÓRIO DE BOLSA DE INICIAÇÃO CIENTÍFICA RELATÓRIO PARCIAL ( ) RELATÓRIO FINAL ( x ) 1. IDENTIFICAÇÃO:

Leia mais


CONHECIMENTOS ESPECÍFICOS Acerca da bioinformática em geral, julgue os itens subsequentes. 41 A bioinformática pode ser definida como uma área multidisciplinar que envolve principalmente a Biologia, a Ciência da Computação, a Matemática

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais


ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Tudo começou em África

Tudo começou em África Tudo começou em África (Expresso: 25-04-1998) Análises do D A confirmam a origem africana da espécie humana, uma ideia já defendida no século passado por Charles Darwin e Thomas Henry. A nossa árvore genealógica

Leia mais