Análise Genética da Cannabis sativa

Tamanho: px
Começar a partir da página:

Download "Análise Genética da Cannabis sativa"

Transcrição

1 Análise Genética da Cannabis sativa Rodrigo Soares de Moura-Neto Professor Associado Instituto de Biologia/UFRJ 02/09/2014

2

3 Perspectiva Histórica da Tipagem por DNA SNPs 2014 STR desenvolvidos 1985 FSS Quadruplex PCR desenvolvido RFLP Locais do CODIS definidos Primeiros STR multiplexes fluorescentes Eletroforese Capilar Primeiros STRs descritos Identifiler 5-dye kit e ABI PowerPlex 16 Y-STRs Tipagem de STR por CE mtdna Multiplex STRs

4

5

6

7

8 Inventor do PCR "I think I might have been stupid, in some respects, if it weren't for my psychedelic experiences. -Kary Mullis, Ph.D., Nobel Prize Laureate, Chemistry, 1993

9

10 Tecnologia Atual Capilar Cheio com Solução de Polímero Eletroforese Capilar Janela de Leitura m x 27 cm - + Rápida Separação do DNA Inlet (cathode) 5-20 kv Outlet (anode) Coleta de Dados e Análise

11 Sequenciamento de DNA

12 Desoxinucleotideo H

13 H Didesoxinucleotideo H

14

15

16 Mecanismo de Migração da Moléclua de DNA - DNA - DNA - DNA - DNA - DNA - + Separação de acordo com o tamanho e a forma de interação do DNA com o Polímero existente no interior do capilar

17 Janela de Leitura ABI 3100 Array Detection

18 ABI Prism 3100 Analizador Genético

19 Tipo de Analisador Genético (Sequenciador) AB Prism 3100 Genetic Analyzer

20 ABI Prism 3500 Analizador Genético

21

22

23 Mitocondria

24 Heavy (H) strand S2 L2 H ND5 ND4 ND4L R ND3 G Genoma Mitocondrial HV1 cyt b E ND6 COIII Control region (D-loop) T ATP6 P ATP8 O H 1/16,569 K COII F S1 HV Light (L) strand 16,569 bp 12S rrna O L D V Q A N C Y 16S rrna COI L1 ND1 I M ND2 W 9-bp deletion 22 trnas 2 rrnas 13 genes Coding Region

25

26

27

28 A B C D

29

30 B C A T T A A C T G 0 A G 2 A 0 A 0 C 0 G 0 A 0 = 2 B T G A A C T G 0 A C 1 A 0 G 1 C 0 T 2 G 1 = 5 C A T T A A C T G 0 A C 1 A 0 D G 1 C 0 T 2 G 1 = 5 D B A T T A A C T G 0 A C 1 A 0 C 2 C 0 T 2 A 0 = T G A A C T C A G C T G 0 A T T 0 G C 1 C 0 A 0 D A 0 C 2 C 1 C 0 C 0 T 2 T 0 A 0 = 5 C

31 Matriz de Informação Topologia A B C D A - B 2-1,5 1 1 A B C D ,5 1 1 C D

32 A B C D

33 A Jornada Humana Out of Africa

34

35 Sistema de STR para Cannabis sativa

36 Eletroferograma de 05 Locais de STR em Cannabis sativa

37 O Sistema de STR permite a análise filogenética de evolução rápida e, portanto, recente.

38 Variação Genética por AFLP de Cannabis sp, em diferentes cidades americanas

39 Sistemas de evolução lenta,como haplótipos do DNA mitocondrial e do cloroplasto, permitem um estudo global da distribuição da Cannabis sp.

40 Cloroplasto

41 Genoma do Cloroplasto

42 Haplótipo de mtdna de Cannabis sativa

43 Distribuição dos Haplótipos de mtdna de Cannabis sativa

44 Identificação e Caracterização Molecular da Cannabis sativa através do Perfil de DNA: Barcoding como Ferramenta de Inteligência Policial no Estado do Rio de Janeiro

45 Cannabis sativa é a droga ilícita mais consumida no mundo e há uma grande dificuldade em identificar e individualizar as amostras de Cannabis sp. Por isso, técnicas genéticas estão cada vez mais sendo adotadas para a sua identificação. DNA Barcoding é uma região curta e padronizada que contém suficiente variabilidade entre as espécies; é curta o suficiente para ser sequenciada em uma única reação; e contém regiões conservadas para o desenvolvimento de iniciadores universais.

46 Teste colorimétrico para detecção de canabinóides pelo método de Duquenois-Levine. (A) Passo1: Adição do reagente de Duquenois na amostra, (B) Passo 2: Adição de ácido clorídrico, (C) Passo 3: Adição de clorofórmio. Amostras com canabinóides tornam-se roxas com a adiição do reagente de do ácido clorídrico. Com o clorofórmio, o roxo passa para a camada orgânica, indicando a presença da substância (DEA - Lab Processes).

47 Cromatografia em camada delgada (TLC) para detecção de diferentes compostos, extratos vegetais, etc.

48 Objetivos Desenvolver e validar técnicas de identificação genética da Cannabis sativa; Testar o desempenho do gene de rbcl para identificação da espécie; Encontrar haplótipos em Cannabis sativa, apreendidas no Estado do Rio de Janeiro.

49 Material e Métodos Material genético extraído com o kit DNeasy Plant Mini (Qiagen); Iniciadores universais do gene de rbcl : ESrbcL628F e ESrbcL1361R; Amplificação de uma região de 733 pb;

50 Material e Métodos Sequenciamento por BigDye Terminator v 3.1 (Life Technologies); eletroforese no 3500HID, usando Data Collection e Sequencing Analysis (Applied Biosystems); Análise dos dados nos programas Geneious e Mega 5.1.

51 Regiões das apreensões das amostras de C. sativa

52 Amostras de C. sativa ICCE/PCERJ IPPGF/PCERJ DNA LabFor/UFRJ.

53 Amostras de maconha cedidas pela PCERJ

54 DNA Genômino DNA Amplificado M 1 2 trnl-trnf (cpdna)

55 Eletroforese em gel de agarose 1,5% de uma aliquota dos produtos da amplificação do gene rbcl

56 Iniciadores utilizados na reação de amplificação (PCR) Nome Sequência do Iniciador GenBank Tamanho ESrbcL628F F: CCATTYATGCGTTGGAGAGATCG Gene rbcl 733 pb ESrbcL1361R R:TCAGGACTCCACTTACTAGCTTCACG Iniciadores rbcl alinhados ao gene rbcl de Morus indica, indicados abaixo da figura: ESrbcL628F e ESrbcL1361R. O produto amplificado teria um tamanho de 732 pb, aproximadamente.

57 Parte do alinhamento das amostras do Rio de Janeiro, evidenciando a sequência consenso de 516pb.

58 Sequência Consenso das Amostras do Rio de Janeiro (Cannabis sativa RIO DE JANEIRO)

59 Posição dos SNPs na sequência. SNP#1 em destaque no alinhamento superior, e SNP#2 em destaque no alinhamento inferior.

60 Diferenças encontradas nas sequências do gene de rbcl de C. sativa, das amostras do Rio de Janeiro, Reino Unido, Estados Unidos e China. Amostra Posição no gene SNP# (G/A) SNP# (C/T) Rio de Janeiro G C Reino Unido G T Estados Unidos G T China A C

61 Diferenças encontradas na sequência de aminoácidos entre as amostras do Rio de Janeiro, Reino Unido, Estados Unidos e da China. Amostra Rio de Janeiro Reino Unido Estados Unidos China Posição na cadeia polipeptídica 19411(V/I) Valina Valina Valina Isoleucina

62 SNP#1 SNP#2

63 Árvore filogenética da família Cannabaceae (gene rbcl)

64 Parte da árvore mostrando o grupo monofilético de Cannabis sp. e de Humulus sp., com 1000 réplicas de bootstrap (números nos clados).

65 Árvore filogenética da família Cannabaceae (gene trnl-f)

66 Rede Filogenética de Cannabaceae (gene rbcl)

67 Rede Filogenética de Cannabaceae (gene trnl-f)

68 Discussão e Conclusão 1. As doze amostras de C. sativa, apreendidas no Rio de Janeiro, mostraram-se idênticas. Possivelmente ao fato de todas serem originárias de cultivares geneticamente próximos ou idênticos. 2. Em comparação com outras amostras do gene de rbcl de C. sativa, depositadas no GenBank, observamos três haplótipos distintos. Um diferenciando as amostras do Rio de Janeiro, outro da China e, um terceiro comum entre os Estados Unidos e Reino Unido.

69 Discussão e Conclusão 3. Essas diferenças encontradas levam a uma única mudança de aminoácido. A Valina foi encontrada na posição nas amostras do Rio de Janeiro, Estados Unidos e Reino Unido, enquanto que a Isoleucina foi encontrada na amostra da China. 4. Análise filogenética sugere que essa mutação tenha ocorrido após a expansão da Cannabis a partir da Ásia. 5. A ocorrência do SNPs encontrados no gene de rbcl, entre as amostras do Rio de Janeiro, Estados unidos, Reino Unido e China, pode ser usado como marcador biogeográfico, sugerindo que se trata de uma assinatura genética para análise forense.

70 Apresentação no IV Congresso de Genética Forense e publicação na Gene rbcl como barcode para identificação forense de Cannabis sativa. Ribeiro ASD 1,2 ; Dias VHG 1 ; Mello ICT 1 ; Silva R 3 ; Sabino BD 4 ; Garrido RG 5 ; Seldin L 6 ; Moura-Neto RS 1,2 1 Laboratório de Biologia Molecular Forense, Instituto de Biologia/UFRJ. 2 Instituto Nacional de Metrologia, Qualidade e Tecnologia, INMETRO. 3 Laboratório de Metabolismo Macromolecular Firmino Torres de Castro, Instituto de Biofísica Carlos Chagas Filho/UFRJ 4 Instituto de Criminalística Carlos Éboli /DGPTC/PCERJ. 5 Instituto de Pesquisas e Perícias em Genética Forense, /DGPTC/PCERJ. 6 Instituto de Microbiologia Prof. Paulo de Góes/UFRJ

71 Obrigado Fim

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Analise filogenética baseada em alinhamento de domínios

Analise filogenética baseada em alinhamento de domínios Analise filogenética baseada em alinhamento de domínios Moléculas biológicas e evolução Como já foi comentado anteriormente sabemos que o DNA de qualquer espécie de ser vivo sofre mutações ao longo do

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

IDENTIFICAÇÃO MOLECULAR E FILOGENÉTICA DE ESPÉCIES DE PEIXES DE ÁGUA DOCE DO MATO GROSSO DO SUL

IDENTIFICAÇÃO MOLECULAR E FILOGENÉTICA DE ESPÉCIES DE PEIXES DE ÁGUA DOCE DO MATO GROSSO DO SUL IDENTIFICAÇÃO MOLECULAR E FILOGENÉTICA DE ESPÉCIES DE PEIXES DE ÁGUA DOCE DO MATO GROSSO DO SUL Allana Novais Aranda¹; Danielly Beraldo Dos Santos Silva²; Jussara Oliveira Vaini³; Alexéia Barufatti Grisolia

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Quim. Nova, Vol. XY, No. 00, S1-S5, 200_ TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Pedro L. R. da Cruz a, Leila R. Giarola b, Suellen da Silva Moraes a, Déborah

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 Gonçalves MG 1, Fukasawa LO 1, Alencar WK 2, Caterino-de-Araujo A 1 1 Instituto

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

DNA profiling parte 2

DNA profiling parte 2 Faculdade Milton Campos Curso Lato Sensu em Medicina Legal Disciplina: Bioinformática e Investigação Criminal Professor: Eduardo Campos dos Santos DNA profiling parte 2 Belo Horizonte Outubro/Novembro

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas

O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas Centro de Gestão e Estudos Estratégicos Ciência, Tecnologia e Inovação O Código de Barras da Vida baseado no DNA Barcoding of Life : Considerações e Perspectivas Ana Maria Lima de Azeredo 2 O Código de

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela jvarela@ualg.pt Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL Luciana Oliveira Barateli; Regina Melo Sartori Coelho; Abmael Monteiro

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

UM NOVO TESTE PARA TUBERCULOSE

UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Abordagens moleculares no estudo da diversidade microbiana

Abordagens moleculares no estudo da diversidade microbiana A vida sem microrganismos não seria possível! Abordagens moleculares no estudo da diversidade microbiana Teresa Lino Neto tlneto@bio.uminho.pt Departamento de Biologia Universidade do Minho 1 Importantes

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA RAZÃO DE PROBABILIDADE BAYESIANA COMO EVIDÊNCIA PARA TESTE DE VÍNCULO DE PATERNIDADE Curitiba 2012 I Dianna Lo Wai Yan Maurício Fernandes do Nascimento

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Aula 11. Prof. Rafael Sousa

Aula 11. Prof. Rafael Sousa Analítica V: Aula 11 Eletroforese capilar Prof. Rafael Sousa Departamento de Química - ICE rafael.arromba@ufjf.edu.br Notas de aula: www.ufjf.br/baccan EletroforeseCapilar(EC) TÉCNICA ELETROANALÍTICA HISTÓRICO

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO CUNHA, Marielton dos Passos 1 ; OLIVEIRA, Bruno Francesco Rodrigues de 1 ; RESENDE, Isa Murielly

Leia mais

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses Instruções específicas Genotipagem de amostras A metodologia descrita corresponde à versão que foi optimizada no nosso

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Desenvolvimento de uma Ferramenta. Cromatogramas

Desenvolvimento de uma Ferramenta. Cromatogramas Desenvolvimento de uma Ferramenta Web para análise automática tica de Cromatogramas Faculdade de Filosofia Ciências e Letras de Ribeirão Preto - USP Faculdade de Medicina de Ribeirão Preto USP Lariza Laura

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D e-mail:melmenezes@dnanalise.com.br DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

BIOTECNOLOGIA VEGETAL E SUAS APLICAÇÕES NO AGRONEGÓCIO

BIOTECNOLOGIA VEGETAL E SUAS APLICAÇÕES NO AGRONEGÓCIO BIOTECNOLOGIA VEGETAL E SUAS APLICAÇÕES NO AGRONEGÓCIO Dr. Paulo S. T. Brioso Laboratório Oficial de Diagnóstico Fitossanitário/ UFRRJ http://www.fito2009.com brioso@bighost.com.br AGRADECIMENTOS Comissão

Leia mais

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC PROPOSTA DE IMPLANTAÇAO DE COLETA DE MATERIAL GENÉTICO PARA ANÁLISE DE VÍNCULO DE PATERNIDADE PELO DNA, DURANTE

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR:

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR: RTSD01-II Fator II G20210A Q PCR Alert Kit Rev. 04 Out/2013 Instruções de Uso USO PRETENDIDO O produto FATOR II Q-PCR Alert é um kit para teste de amplificação quantitativa de ácidos nucleicos para a determinação

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes

2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes PELD Programa de Pesquisas Ecológicas de Longa Duração 119 2.9. Diversidade em seqüências D-loop do DNA mitocondrial de peixes Alberto José Prioli Sônia Maria Alves Pinto Prioli Laudenir Maria Prioli Thatiana

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz)

POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz) POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz) Catia Dias do Carmo 1, Dalma Brito Santos 2, Vandeson Rodrigues de

Leia mais

Genes extranucleares

Genes extranucleares Genes extranucleares Organização do Genoma Humano GENOMA HUMANO Coding DNA Genes and generelated sequences Nuclear genome 3000 Mb 30000 genes 30% 70% Unique or moderately repetitive 10% 90% Noncoding DNA

Leia mais

Marcadores Moleculares aplicados a organismos de interesse epidemiológico

Marcadores Moleculares aplicados a organismos de interesse epidemiológico Marcadores Moleculares aplicados a organismos de interesse epidemiológico 17 a 22 de agosto de 2009 Local: SUCEN Superintendência de Controle de Endemias Rua Paula Souza, 166 - Luz - São Paulo - SP Realização

Leia mais

APLICAÇÃO DE TÉCNICAS DE ENGENHARIA GENÉTICA RELACIONADAS À BIOCIÊNCIA FORENSE

APLICAÇÃO DE TÉCNICAS DE ENGENHARIA GENÉTICA RELACIONADAS À BIOCIÊNCIA FORENSE APLICAÇÃO DE TÉCNICAS DE ENGENHARIA GENÉTICA RELACIONADAS À BIOCIÊNCIA FORENSE Janine Machado Nóbrega 1 ; Izabel Cristina Rodrigues da Silva 2 (1) Autor: Bióloga. Faculdade da Terra de Brasília, FTB, Brasil.

Leia mais

Universidade Estadual do Norte do Paraná UENP

Universidade Estadual do Norte do Paraná UENP 1 Universidade Estadual do Norte do Paraná UENP Formulário V do Edital Nº 004/2013 - PIBIC/UENP RELATÓRIO DE BOLSA DE INICIAÇÃO CIENTÍFICA RELATÓRIO PARCIAL ( ) RELATÓRIO FINAL ( x ) 1. IDENTIFICAÇÃO:

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Acerca da bioinformática em geral, julgue os itens subsequentes. 41 A bioinformática pode ser definida como uma área multidisciplinar que envolve principalmente a Biologia, a Ciência da Computação, a Matemática

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010 Dia da Propriedade Industrial Patentes de Genes Vanessa Fatal Examinadora de Patentes Universidade de Évora 21.09.2010 Europa 1973 EPC define que processos essencialmente biológicos não são patenteáveis

Leia mais

IDENTIFICAÇÃO TAXONOMICA DE CUPINS COHABITANTES DE MONTÍCULOS DE SOLO NA REGIÃO DE CAMPINAS COM BASE EM SEQUENCIAS DE DNA

IDENTIFICAÇÃO TAXONOMICA DE CUPINS COHABITANTES DE MONTÍCULOS DE SOLO NA REGIÃO DE CAMPINAS COM BASE EM SEQUENCIAS DE DNA IDENTIFICAÇÃO TAXONOMICA DE CUPINS COHABITANTES DE MONTÍCULOS DE SOLO NA REGIÃO DE CAMPINAS COM BASE EM SEQUENCIAS DE DNA João H. P. Giudice Faculdade de Ciências Biológicas Centro de Ci6encias da Vida

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

UNIVERSIDADE ESTADUAL DO CEARÁ-UECE

UNIVERSIDADE ESTADUAL DO CEARÁ-UECE UNIVERSIDADE ESTADUAL DO CEARÁ-UECE LABORATÓRIO DE BIOQUÍMICA HUMANA Maria Izabel Florindo Guedes Grupo de Pesquisa: Grupo de Inovação Biotecnológica em Saúde Maria Izabel Florindo Guedes Desenvolvimento

Leia mais

V Congresso de Iniciação Científica do IAMSPE

V Congresso de Iniciação Científica do IAMSPE V Congresso de Iniciação Científica do IAMSPE São Paulo 17/11/2011 Estudo genético da síndrome de Birt- Hogg-Dubé (variante Hornstein- Knickenberg) Bolsista: Sergio Aparecido do Amaral Junior (Faculdade

Leia mais

XXIX CONGRESSO NACIONAL DE MILHO E SORGO - Águas de Lindóia - 26 a 30 de Agosto de 2012

XXIX CONGRESSO NACIONAL DE MILHO E SORGO - Águas de Lindóia - 26 a 30 de Agosto de 2012 XXIX CONGRESSO NACIONAL DE MILHO E SORGO - Águas de Lindóia - 26 a 30 de Agosto de 2012 Identificação de Marcadores Moleculares Microssatélites Associados à Restauração da Fertilidade em Sorgo Marcos de

Leia mais

Métodos Estatísticos para análise. de Y-STRs. em Genética Forense

Métodos Estatísticos para análise. de Y-STRs. em Genética Forense UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE ESTATÍSTICA E INVESTIGAÇÃO OPERACIONAL Métodos Estatísticos para análise de Y-STRs em Genética Forense Cláudia Isabel Vieira da Silva Mestrado

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais