Genética e Melhoramento de Plantas. Universidade de Évora 2005

Tamanho: px
Começar a partir da página:

Download "Genética e Melhoramento de Plantas. Universidade de Évora 2005"

Transcrição

1 Genética e Melhoramento de Plantas Universidade de Évora 2005

2 Estrutura dos ácidos nucleicos Ácido Desoxirribonucleico (DNA) Ácido Ribonucleico (RNA) Dos genes às proteínas (eucariotas): transcrição e tradução Engenharia Genética de Plantas Identificação de genes de interesse Extracção de RNA total e purificação de mrna Isolamento e clonagem de genes de interesse Desenho de primers degenerados Desenho de primers específicos para isolamento das extremidades (5 e 3 de um gene) Construção de Vectores de Clonagem Avaliação de colónias recombinantes com enzimas de restrição

3 DNA: Ácido DesoxirriboNucleico Constituído por uma sequência de apenas quatro nucleótidos. Os diferentes nucleótidos apresentam uma estrutura comum: Um grupo fosfato ligado por uma ligação fosfoester a uma pentose (desoxirribose), a qual se liga a uma base azotada resultando num desoxirribonucleótido. As bases azotadas podem ser purinas (adenina e guanina) ou pirimidinas (citosina e timina). Os desoxirrinucleótidos ligam-se entre si por ligações fosfodiester originando uma cadeia simples.

4 Duas cadeias simples ligam-se entre si devido à complementaridade das suas bases azotadas (A=T, G=C), através de ligações por pontes de hidrogénio, originando uma cadeia dupla. James Watson and Francis Crick (1953): Estrutura em dupla hélice com orientação das duas cadeias antiparalela.

5 RNA: Ácido RiboNucleico Constituído por uma sequência de apenas quatro nucleótidos. Os diferentes nucleótidos apresentam uma estrutura comum: Um grupo fosfato ligado por uma ligação fosfoester a uma pentose (ribose), a qual se liga a uma base azotada resultando num desoxirribonucleótido. As bases azotadas podem ser purinas (adenina e guanina) ou pirimidinas (citosina e uracilo). Apresenta uma estrutura em cadeia simples. Os ribonucleótidos ligam-se entre si por ligações fosfodiester originando uma cadeia simples.

6 Estrutura de um gene: Promotor: Região do DNA à qual se liga a enzima RNA polymerase antes de iniciar a transcrição do DNA em RNA. Determina: região de início da transcrição; a cadeia de DNA que servirá como template; número de transcritos; frequência da transcrição. Gene: Segmento de DNA constituído por um conjunto de intrões e exões que será transcrito em mrna, codificando os exões a síntese proteica. Terminador: Região terminal que bloqueia a enzima RNA polimerase e induz a sua dissociação. 5 Promoter UTR Exon1 Intron1 Exon2 UTR Terminator 3 GENE Transcription Poly A

7 Transcrição (decorre no núcleo): síntese de uma cadeia de RNA mensageiro (mrna) pela enzima RNA polimerase que decorre de 5 para 3 tendo como modelo apenas uma das cadeias de DNA. A nova cadeia resultante será complementar à cadeia de DNA que lhe serviu de molde apresentando uracilo em vez de timina:

8 Modificações pós-transcrição: 5 capping: ligação de uma molécula de 7-metilguanilato à extremidade 5 do mrna durante a transcrição, tendo como objectivo a protecção da nova cadeia.

9 Clivagem da extremidade 3 e adição de uma cauda Poly (A) Ainda no núcleo o mrna transcrito primário sofre a clivagem da extremidade 3 e posterior adição de uma cauda poly(a). A dimensão da cauda poly(a) varia entre 100 a 250 adeninas. No citoplasma a dimensão da cauda diminui. A funçãon da cauda poly(a) não é ainda bem conhecida.

10 Splicing: clivagem dos intrões no inteior da cadeia de mrna e simultânea ligação dos exões, correspondendo à última fase do processamento das moléculas de mrna no núcleo.

11 Genoma Total conjunto de genes de um organismo Transcritoma Conjunto de sequências transcritas (mrna) Proteoma Conjunto de proteinas codificado pelo genoma

12 Código genético: envolve o reconhecimento de tripletos (conjunto de três nucleótidos) do mrna denominados codões pelos complementares anticodões do trna. Codão de iniciação: AUG (Met) Codões stop: UAA; UAG; UGA O código genético é universal e degenerado (61 codões codificam para a síntese de apenas 20 aa): vários codões = 1 aa 1 codão vários aa

13 Início da tradução: ão reconhecimento do codão de iniciação (mrna) AUG pelo anticodão (trna) UAC transportando o aminoácido inicial Meteonina. O ribossoma (rrna+proteina) movendo-se ao longo da cadeia de mrna (de três em três nucleotidos) cataliza a síntese proteica. Final da tradução: ão reconhecimento do codão de terminação (mrna) UAG pelo anticodão (trna) AUC com a consequente separação das duas subunidades que constituem o ribossoma.

14 Melhoramento genético: Consiste na adição ou subtracção de um ou mais genes de um organismo, introduzindo ou silenciado uma determinada característica. Vantagem: Ultrapassar a barreira da espécie: um gene que codifica uma característica numa determinada espécie pode ser introduzido numa outra espécie mesmo que filogenéticamente muito afastada recorrendo a técnicas de biologia molecular. Interesse: Criar plantas tolerantes ou resistentes a determinadas condições de stress biótico e/ou abiótico.

15 Exemplo: Introdução de Resistência ao Fungo Uncinula necator (Oídio) em Videira (Vitis vinifera) O fungo em questão possui parede de quitina pelo que as proteínas com capacidade de a hidrolizar quitinases podem conferir à planta potencialidade para resistir a esse stress biótico.

16 1º PASSO: Pesquisar na bibliografia a existência de espécies vegetais resistentes a este fungo. Ex.: Vitis rupestris 2º PASSO: Pesquisar na base de dados se o gene está descrito para a espécie classificada como resistente. Caso não esteja, será objectivo isolar este gene na espécie resistente para introduzir na espécie sensível (http://www.ncbi.nlm.nih.gov/).

17 3º PASSO: Isolamento de RNA total do organismo do qual se pretende isolar o gene (espécie resistente V. rupestris) e purificação de mrna. 4º PASSO: Transcrição Reversa 5º PASSO: Desenho de primers degenerados permitindo-nos amplificar uma sequência correspondente ao gene que se pretende isolar. Para tal seleccionam-se na base de dados as sequências ORF (Open Reading Frame) de várias espécies, ou seja, a região estritamente necessária para a codificação da síntese da proteína. A ORF inicia-se com a sequência Kozak (CCGCCATGGG) e finaliza com um dos codões stop, correspondendo sempre à maior sequência encontrada; 6º PASSO: Alinhamento das diferentes sequencias de um mesmo gene codificando a mesma proteína em diferentes espécies e desenho de um primer degenerado (sequencia de 20 a 30 oligonucleótidos) forward (extremidade 5 ) e outro reverse (extremidade 3 ); 7º PASSO: Amplificação de uma sequência de cdna por PCR utilizando os primers degenerados.

18 Extracção de RNA total (Protocolo do Hot Borate ) A integridade do RNA é avaliada em gel de agarose onde devem ser visíveis duas bandas mais fortes correspondentes ao RNA ribossomal (28S e 18S); Pode ocorrer contaminação com DNA; O trabalho com RNA requer mais cuidados, uma vez que este é mais instável que o DNA; A grande desvantagem de trabalhar com o RNA será a de não existir forma de o amplificar. 28S 18S DNA mrna Purificação do mrna Permite isolar genes que se estejam a expressar (constitutivos ou de expressão diferencial, que só se expressem sob uma determinada condição de stress); A incapacidade de o amplificar levou ao desenvolvimento de técnicas (Transcrição Reversa) que permitiram converter este novamente em DNA (DNA complementar ou cdna).

19 Transcrição Reversa Enzimas denominadas Transcriptases Reversas, descobertas por Temin e Baltimore (1960) em retrovírus, catalizam a síntese de cdna a partir de RNA.O cdna é mais estável e apresenta a vantagem de poder ser amplificado por técnica de PCR.

20 Transcrição Reversa mrna template AAAAAAA ( ) Poly(A) VTTTTTTTTTTTTTTTTCAGCTGTAGCTATGCGCACCAG (V=A,C ou G) VIAL 8 AAAAAAA ( ) Poly(A) VTTTTTTTTTTTTTTTTCAGCTGTAGCTATGCGCACCAG (V=A,C ou G) Degradação da cadeia de mrna com RNase AAAAAAA ( ) Poly(A) VTTTTTTTTTTTTTTTTCAGCTGTAGCTATGCGCACCAG (V=A,C ou G) Amplificação por PCR VTTTTTTTTTTTTTTTTCAGCTGTAGCTATGCGCACCAG (V=A,C ou G) GTCGACATCGATACGCGTGGTC VIAL 9 Pefw PeRev VTTTTTTTTTTTTTTTTCAGCTGTAGCTATGCGCACCAG (V=A,C ou G) AAAAAAAAAAAAAAAGTCGACATCGATACGCGTGGTC A transcrição (reversa) do cdna tem a vantagem de permitir posterior amplificação de um gene de interesse limpo de intrões. O conhecimento da sequência das extremidades do cdna permite a posterior amplificação das extremidades de um gene. Para tal deverá utilizar-se um primer específico que emparelhe com uma das extremidades e um outro primer que emparelhe com uma zona específica da nossa sequência.

21 Primer: Sequência de oligonucleótidos (16-24 nucleótidos) complementar a uma região do DNA que ao emparelhar permite o funcionamento da enzima Taq polimerase e consequente formação de uma nova cadeia de DNA complementar à existente. Forward (5 ) Reverse (3 )

22 AGGCTA( ) GGCAAT( ) 5 3 AGGCTA( ) Fw CCGTTA( ) Rv 5 AGGCTA( ) 5 ( )ATTGCC Reverse complement Os primers devem ser desenhados tendo em conta os seguintes pontos: a) primer Forward próximo da extremidade 5 com a sequência igual àda cadeia modelo; Reverse próximo da extremidade 3 com a sequência complementar à da cadeia modelo, sendo a sua sequência colocada em reverse devido a efeitos de encomenda; b) cada primer não deverá exceder os 25 nucleótidos; c) o número de nucleótidos de um primer depende da sua temperatura de emparelhamento, determinada da seguinte forma: [2x(A+T)]+[4x(G+C)]; d) a extremidade 3 de cada primer deverá ser mais rica em G e/ou C.

23 Polymerase chain reaction (PCR) Amplificação exponencial de uma sequência específica de DNA, determinada pelo emparelhamento dos primers. Condições necessárias para a reacção: a) sequência de DNA que servirá de template b) um par de primers (forward e reverse) c) DNA polimerase (Taq DNA polimerase: Thermus aquaticus) d) dntps (C, T, G, A) c) tampão de PCR com MgCl 2 Programa de PCR: Programa de PCR: 1º: Desnaturação: temperatura de C 2º: Emparelhamento: temperatura varia com primers 3º: Temperatura de síntese: temperatura C

24 Mix de PCR: 1. cdna.. 1µl 2. PCR Buffer (10x)... 5µl 3. MgCl (50mM).. 2µl 4. dntps (10mM)... 1µl 5. Primer forward (10mM).. 1µl 6. Primer reverse (10mM) 1µl 7. H 2 O Milli-Q estéril. 38.5µl 8. Taq DNA polimerase.. 0.5µl 50µl Programa de PCR: 35 ciclos

25 330 pb 800 pb Fw 3 5 Rv 5 ± 1000 pb 1500pb 600pb 500pb 100pb MM PCR ± 500 pb A utilização de primers degenerados permitenos amplificar fragmentos específicos da espécie em estudo (± 500pb); Por vezes ocorre a amplificação de outros fragmentos denominados inespecíficos dado o emparelhamento inespecífico do primer (se existir uma pequena sequência na extremidade 3 do primer, sobretudo G ou C, que emparelhem com alguma zona complementar no templete, ocorrerá igualmente síntese de DNA).

26 Sequenciação do fragmento amplificado Na reacção de sequenciação (PCR com apenas 1 primer) o fragmento vai ser amplificado com nucleótidos marcados que o sequenciador vai reconhecer, sendo o resultado da leitura dado por uma cor diferente para cada nucleótido; A leitura do fragmento de DNA amplificado permite determinar se este corresponde de facto a um fragmento do gene que se pretende isolar.

27 Isolamento das extremidades 5 e 3 do gene Desenho de primers específicos 5 (330pb)GGGATACTGCTACCTCAGGGAACAAGGCAGCCCCGGAGCTTACTGTGTTCCCAGCCCCGGAGCTTACTGTGTTCC TAGTGCACAGTGGCCTTGTGCCGCTGGTAGGAAATACTATGGCCGAGGCCCCATACAGATTTCCTACAACTACAACT ATGGGCAAGCTGGGAAAGCCATAGGGGTAGACCTGGTAAACAACCCTGATCTAGTAGCAACAGATGCAGTCATATC ATTCAAGACAGCCTTCTGGTTCTGGATGACACCCCAGTCACCCAAGCCTTCCTGCCATAATGTCATCACAGGAGG ATGGACCCCATCAGGTGCAGATAGGTCAGCAGGGCGGCTTCCCGGTTTTGGTGTTATCACAAACATCATCAATGGAG GTGTTGAATGTGGGAAAGGGGTAGTTCCTCAGGTCCAGGACCGCATAGGTTTCTATAAGAGGTACTGTGATATACTT AGGGTTAGCTATGGCAATAACCTGGACTGCAACAACCAAAGGCCTTTCGGGTCTGGCC(800pb)...3 Ta=(4x15)+(2x9)-10=78 10=78-10= 68 Ta=(4x17)+(2x8)-10=84 10=84-10= 74 cdna ± 500pb 5 AAAAAA GGG 3 5 PCR primer Fw Rv Poly(A) Poly(T) 3 CCC 5 ± 700pb

28 Clonagem do Gene Completo A enzima Taq DNA polimerase possui a capacidade adicional de terminal transferase (para além de DNA polimerase), ou seja, adiciona ao final da cadeia amplificada uma base de adenina (A). Esta capacidade permite a ligação do fragmento amplificado a um vector de clonagem linearizado possuindo extremidades de timina (T). 5 AATGGGGTTGTGGGCATTGGTAGCTTTCTGTCTGTTGTCATTAATACTGGTTGGCTCAGCAGAGCAATGTGGAGGGCAAGCTGG GGGTAGAGTTTGCCCAGGGGGGGCATGCTGCAGCAAGTTTGGTTGGTGTGGCAACACTGCTGATTACTGTGGCAGTGGCTGCCA AAGCCAGTGCAGTTCCACTGGTGACATTGGCCAGCTTATTACCAGGTCCATGTTCAATGATATGCTTAAGCATAGAAATGAGGGG AGTTGCCCTGGCAAGGGCTTCTACACCTATGACGCTTTCATAGCTGCTGCTAAGGCCTTTCCTGGCTTTGGAACAACTGGTGATAC CACTACTCGTAAAAGGGAAATCGCAGCCTTCTTGGCTCAAACTTCTCATGAAACCACTGGGGGGTGGGCTAGTGCACCTGATGGC CCATACGCTTGGGGATACTGCTACCTCAGGGAACAAGGCAGCCCCGGAGCTTACTGTGTTCCTAGTGCACAGTGGCCTTGTGCCG CTGGTAGGAAATACTATGGCCGAGGCCCCATACAGATTTCCTACAACTACAACTATGGGCAAGCTGGGAAAGCCATAGGGGTAG ACCTGGTAAACAACCCTGATCTAGTAGCAACAGATGCAGTCATATCATTCAAGACAGCCTTCTGGTTCTGGATGACACCCCAGTC ACCCAAGCCTTCCTGCCATAATGTCATCACAGGAGGATGGACCCCATCAGGTGCAGATAGGTCAGCAGGGCGGCTTCCCGGTTTT GGTGTTATCACAAACATCATCAATGGAGGTGTTGAATGTGGGAAAGGGGTAGTTCCTCAGGTCCAGGACCGCATAGGTTTCTATA AGAGGTACTGTGATATACTTAGGGTTAGCTATGGCAATAACCTGGACTGCAACAACCAAAGGCCTTTCGGGTCTGGCCTCCTGCT GGACACCATCTAAA3

29 Vector de Clonagem Ampicilina Permite a selecção de bactérias transformadas. Apenas as bactérias transformadas, ou seja, que possuam o vector plasmídico no seu interior apresentam resistência a este antibiótico. Origem de replicação Responsável pela iniciação da síntese proteica. MCS Gene LacZ Responsável pela síntese do fragmento ω da enzima β- galactosidase que por complementação com o fragmento α sintetizado pelo cromossoma bacteriano produz actividade da enzima. No meio da sequência deste gene é conhecida uma zona com vários locais de restrição identificados (Multiple Cloning Site). Qual a importância desta região?

30 Vector de Clonagem: Qual a importância da MCS? Os locais de restrição identificados nesta região são únicos no vector, o que significa que as enzimas de restrição específicas deste locais apenas cortarão o vector uma única vez. As extremidades que se geram no vector após digestão com uma determinada enzima de restrição são compatíveis com as extremidades geradas num fragmento digerido com a mesma enzima, permitindo assim a integração desse fragmento no vector. Estando a região MCS inserida no meio da sequência do gene LacZ (responsável pela síntese da enzima β-galactosidase e consequente expressão azul das colónias bacterianas) a interrupção do gene por inserção de um fragmento, leva à inibição da expressão do gene. As bactérias que possuam plasmídio com um fragmento inserido na região MCS (transformadas recombinantes) possuem coloração branca.

31 Transformação de bactérias Introdução de um vector plasmídico, integrando o gene de interesse, em bactérias desprovidas de qualquer DNA desta natureza (bactérias competentes). O objectivo desta técnica consiste obter milhares de cópias do vector introduzido na bactéria e assim do gene inserido neste.

32 Screening de bactérias recombinantes com enzimas de restrição O screening de bactérias recombinantes portadoras do fragmento de interesse pode ser efectuados de duas formas: 1. Por PCR utilizando os primers específicos do gene ou do vector; 2. Por digestão com enzimas de restrição que flanqueiem o local de inserção do gene. Neste caso é necessário a incubação prévia das colónias seleccionadas em LB líquido para posterior extracção do DNA plasmídico (protocolo da aula). Somente após esta extracção é que se poderá efectuar a digestão do DNA utilizando enzimas de restrição específicas da zona MCS (podendo ser apenas uma enzima com dois locais de restrição, um na zona 5 do fragmento e outro na zona 3 ou duas enzimas diferentes). Mix Digestão: 1. DNA plasmídico extraido. 10µl 2. Buffer (10x).. 2µl 3. Enzima µl 4. Enzima µl 5. H 2 O Milli-Q estéril.. 7.4µl 20µl Incubar 2-3h a xºc (a temperatura óptima varia com as enzimas, sendo na maior parte dos caso 37ºC)

33 Screening de bactérias recombinantes com enzimas de restrição 1. A reacção de digestão não foi completa, pois observam-se no gel bandas correspondentes a formas circulares e superenroladas; 2. Apenas as colónias 2 e 4 apresentam o fragmento de interesse (1000 pb); 3. A colónia 1 apresenta um fragmento clonado de peso inferior ao desejado; 1500 pb 600 pb MM cl.1 cl.2 cl.3 cl.4 Polissacáridos DNA circular com nicks DNA linear DNA circular superenrolado Fragmento linear digerido 4. A colónia 3 apesar de apresentar uma banda correspondente a um fragmento de 1000 pb, apresenta uma outra banda correspondente a um fragmento de peso inferior a 100 pb. Como o vector não possui mais locais de restrição para as enzimas utilizadas, as duas bandas corresponderão a um fragmento de peso total de 1050pb que possui um local de restrição para uma das enzimas utilizadas a 50 pb de uma extremidade. 100 pb SacI 5 (0pb) KpnI 3 (1000pb)

34 Alguns Mecanismos de Transferência de genes de interesse Construção de Vectores de Expressão Agrobacterium Bombardeamento de Partículas Mecanismos de selecção de transgénicos Melhoramento Clássico vs. Biotecnologia Melhoramento genético: potencialidades, benefícios e riscos

35 Construção de Vector de Expressão Um vector de expressão corresponde a um vector plasmídico integrando uma sequência denominada cassete de expressão - sequência de DNA linear que inclui para além dos genes, um promotor e um terminador que controlam a expressão de cada gene em particular. Na cassete de expressão podem existir: a) apenas o gene de interesse (ex.: chitinase), não existindo forma de selecção; b) o gene de interesse e o gene de selecção (resistência a antibiótico ou herbicida); c) o gene de interesse, o gene de selecção e um gene repórter: - β-glucuronidase (GUS); - Green Fluorescent Proteins (GFP). CHITINASE Vitis rupestris GUS phktl1 ( Kb)

36 Agrobacterium tumefaciens É uma bactéria que existe naturalmente no solo infectando um grande número de dicotiledóneas. Penetra nas raízes através de feridas provocando uma reacção no tecido que se traduz numa multiplicação anormal das células dando origem a tumores. Os tumores resultam da transferência, integração e expressão nas células da planta de um segmento específico do DNA bacteriano designado de T-DNA (DNA transferido). Esta capacidade faz da bactéria A. tumefaciens um instrumento natural de engenharia genética.

37 O T-DNA constitui parte do plasmídio Ti (tumour inducing) que ocorre naturalmente nas células de A. tumefaciens e é responsável pela capacidade infecciosa da bactéria. A forma de explorar a capacidade do A. tumefaciens consiste em: alterar a zona de DNA que é transferida (T-DNA), eliminando os genes tumorais e o gene para a opina (aminoácido modificado utilizado como fonte de carbono e azoto pela bactéria), substituindo-os pelo gene ou genes que se pretendem introduzir; as sequências dos limites são os únicos elementos que é necessário manter (LE e LD) permitindo a transferência da sequência do T-DNA para as células do hospedeiro. Mapa genético do plasmídio Ti.

38 Devido às grandes dificuldades em manipular grandes moléculas de DNA como o plasmídeo Ti, foram desenvolvidos vectores em que toda a manipulação é feita recorrendo à Escherichia coli. Esquema do plasmídeo Ti utilizado para transformação de células vegetais mediada por A. tumefaciens.

39 Etapas da Transformação Genética mediada por Agrobacterium: 1. O vector plasmídico Ti retirado da bactéria e manipulado por alteração a região T-DNA. Esta manipulação envolve enzimas de restrição específicas que permitem a digestão do vector em zonas conhecidas; 2. A digestão do vector permite a inserção nessas zonas dos genes de interesse (flanqueados por um promotor e um terminador): vector recombinante; Agrobacterium Ti plasmid Genomic DNA Restriction enzyme A Empty plasmid + Genomic DNA (carries the gene of interest) Vitis Vitis rupestris Plant rupestris cells cells c Restriction enzyme A Gene of interest : chitinase 3. Transformação da estirpe de bactéria Agrobacterium com o vector Ti recombinante, originando bactérias recombinantes; Ti plasmid with the gene of interest

40 4. Infecção (co-cultura que decorre em média 2 dias) do hospedeiro com transferência do vector Ti para as células desse (o material vegetal utilizado depende do sistema de regeneração seguido); 5. Transferência da região T-DNA (suporta os genes de interesse) do vector Ti da bactéria para o genoma do hospedeiro; 6. Integração do T-DNA no genoma da planta: células transformadas; 7. Multiplicação da região T-DNA integrada no genoma da planta originando uma nova planta integrando esse(s) gene(s): planta transgénica. Agrobacterium tumefaciens Ti plasmid with the new gene Agrobacterium cell s + DNA Transformation Plant cell The new gene 8. Expressão dos genes introduzidos no hospedeiro quando sob a condição de stress que se tentou combater. Transgenic plant Cell division

41 Selecção de Plantas Transgénicas nicas Calli embriogénicos transformados A regeneração de plantas (embriogénese somática) a partir de zonas integrando o genes GUS origina plantas transformadas. A análise histoquímica realizada em plantas permite detectar por expressão da coloração azul as plantas que integram este gene repórter. A análise histoquímica com X-Gluc permite verificar a eficiência da transformação. A área azul corresponde a zonas onde ocorreu a integração do gene GUS e sua expressão com síntese da proteina β-glucoronidase.

42 Limitações da TécnicaT Apesar de ser utilizado com sucesso na transformação de muitas dicotiledóneas, apresenta como grande limitação: a reduzida capacidade na transformação de monocotiledóneas. Na tentativa de incrementar esta capacidade de transformação testaram-se diferentes estirpes de Agrobacterium, condições fisiológicas da bactéria e hospedeiro, bem como técnicas de co-cultura (Godwin et al., 1992), não se conseguindo ainda assim resultados favoráveis. A transformação de monocotiledóneas requer um sistema alternativo de transformação genética, como por exemplo o bombardemanto de particulas ou a fusão de protoplastos. A integração de genes pelo Agrobacterium dá-se unicamente ao nível do DNA genómico do hospedeiro. Caso se pretenda introduzir informação noutro qualquer organelo celular, terá de se recorrer a outras técnicas, como por exemplo o bombardeamento de partículas.

43 Bombardeamento de Partículas, Gen Gun ou Biolística Métodologia que permite transformar geneticamente plantas de espécies que o Agrobacterium não infecta (como por exemplo o arroz, o milho, a cevada, etc.). A técnica t basea-se em: projectar a uma pressão elevada (variando esta com o material vegetal em causa, para calli de videira é utilizada uma pressão entre 1100 e 1550 psi) partículas de ouro ou tungsténio de diâmetro variável (1.00µm) com o DNA (vector plasmídico com a cassete de expressão ou apenas a cassete de expressão) agregado. A força mecânica gerada por uma velocidade elevada permite que sejam quebradas barreiras biológicas, podendo ocorrer integração do DNA estranho no genoma das células bombardeadas (DNA nuclear). Para além deste, esta técnica possibilita a integração ao nível do genoma dos cloroplastos (Ye et al., 1990; Daniell, 1993) e das mitocondrias. A aplicação desta técnica requer: - uma preparação prévia muito cuidada; - DNA circular ou linear de boa qualidade; - existência de um protocolo de regeneração optimizado.

44 O aparelho utilizado: Câmara de Bombardeamento

45 Suporte do disco de ruptura (1) Estrutura onde se colocam os macrocarriers, respectivos suportes e stopping screen (2) Suporte do material Vegetal (3)

46 O disco de ruptura determina a pressão à qual serão projectadas as partículas com o DNA agregado. Existem diferentes discos de acordo com a pressão que suportam: um disco de 1550psi significa que suporta pressões inferiores a esta e que ao atingir este valor rompe, permitindo que as partículas sejam projectadas sob o material vegetal. (1) Disco de ruptura Suporte do disco de ruptura

47 Suportes do Macrocarrier (2) Tampa Macrocarrier Stopping Screen

48 (3) O material vegetal utilizado no bombardeamento de partículas depende do sistema de regeneração utilizado para a espécie vegetal que se pretende transformar, podendo ser calli, embriões, discos foliares, etc.

49 Análise histoquímica 2 dias após o bombardeamento permite determinar o sucesso da transformação. O número de pontos azuis corresponde aos pontos em que ocorreu integração do gene GUS e sua expressão. As primeiras células do material vegetal a serem bombardeadas são normalmente destruídas, no entanto, junto a essas existe uma área de células envolvente em que as partículas penetraram sem as destruir. Algumas destas células vão sobreviver à agressão provocada pela ferida das partículas e incorporar no genoma o DNA transportado. Após a incorporação do(s) gene(s) no genoma da planta, as células podem expressá-lo com a consequente produção da proteína por ele codificada.

50 Vantagens relativamente ao Agrobacterium: Possível utilização em dicotiledóneas e monocotiledóneas; Inexistência de falsos positivos, correspondentes a plantas não transformadas mas que possuindo a bactéria utilizada como vector da transformação, manifestam a presença do gene; Necessidade de apenas um antibiótico para selecção das plantas transformadas. A utilização de A. tumefaciens requer a utilização de dois antibióticos, um para eliminar a bactéria e um outro para a selecção das plantas transformadas.

51 Limitações da técnica: t Elevada destruição celular: as camadas celulares mais externas são denominadas de zona de morte por serem destruídas devido ao impacto ou fragmentação das partículas ou à rajada de ar produzida (Birch and Franks, 1991); Baixa estabilidade dos transformante: apesar de ocorrer integração de um gene no genoma de uma célula que poderá regenerar uma planta, esta integração não é estável, apenas 1-5% das células expressam integração estável (Finer and McMullen, 1990); Limitado na dimensão das construções genéticas: quanto maior o vector de expressão menor a possibilidade de sucesso; Permite repetições: existe a possibilidade de integrar várias vezes o mesmo gene no genoma da célula vegetal, dando origem a repetições e consequente expressão diferencial do mesmo gene; Desconhecimento do efeito que a velocidade das partículas pode causar, bem como da composição das mesmas, partículas de tungsténio podem oxidar resultando tóxicas para as células.

52 Selecção de tecidos geneticamente transformados Após transformação, mediada por Agrobacterium ou Bombardeamento de Partículas, o material vegetal será transferido para meio de cultura suplementado com antibiótico ou herbicida (depende do marcador de selecção utilizado. Ex.: se na cassete de expressão se integrou o gene que confere resistência ao antibiótico higromicina, o agente de selecção adicionado ao meio de cultura será este antibiótico). Apenas as células expressando o gene de selecção conseguem sobreviver ao agente utilizado originando plantas resistentes a esse. Assume-se que estas plantas, por possuírem o gene de selecção possuem também o gene de interesse (ambos os genes foram integrados na cassete de expressão utilizada).

53 A integração dos genes no genoma das plantas requer a extracção de DNA cromossomal das plantas putativamente transgénicas e sua análise por PCR. Na reacção de amplificação são utilizados primers específicos que permitem amplificar um fragmento do gene de interesse, ou qualquer zona presente na cassete de expressão (zona dos promotores, terminadores, gene de selecção, repórter ou de interesse). O resultado do PCR é observado por electroforese, onde a separação dos fragmentos de DNA ocorre de acordo com o seu peso molecular, através de uma corrente eléctrica, migrando do pólo negativo para o positivo. Hygromycin (HPTII) β-glucuronidase (GUS)

54 A obtenção de resistência a determinadas condições de stress biótico ou abiótico é possível utilizando métodos tradicionais ou convencionais. cruzamento entre espécies sensíveis (Vitis vinifera) e espécies resistentes a esse stress (V. rupestris) originando híbridos, alguns dos quais possuindo a característica desejada. No entanto, este método é muito moroso e não está isento de forte controvérsia, já que os híbridos assim obtidos podem colocar em causa a tipicidade do produto final. A biotecnologia, através dos seus métodos de propagação e transformação genética, apresenta grande potencial para o melhoramento de diversas espécies vegetais. Esta metodologia apresenta, relativamente aos métodos de melhoramento convencionais, as seguintes vantagens: - melhoramento de grande precisão, em que apenas o gene pretendido é introduzido no genoma da planta; - redução do tempo de obtenção da nova variedade; - inexistência de barreiras quanto à proveniência do gene responsável pela característica que se pretende introduzir, podendo ter origem em qualquer outra planta.

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Agrobiotecnologia: ponto de vista técnico-científico

Agrobiotecnologia: ponto de vista técnico-científico Agrobiotecnologia: ponto de vista técnicocientífico Como se produz uma planta transgénica? Sofia Duque Introdução ao DNA: DNA DNA- Ácido desoxirribonucleico ( deoxyribonucleic acid ) Esta molécula armazena

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Aplicações da Biotecnologia na Agricultura

Aplicações da Biotecnologia na Agricultura Aplicações da Biotecnologia na Agricultura Cultura de Células e Tecidos Anticorpos Monoclonais e Sondas de Ácidos Nucléicos para diagnóstico Engenharia genética de plantas para a introdução de novas características

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Capítulo 3 Clonagem de plantas proliferação de meristemas e organogénese... 75 3.1. Introdução... 75 3.2. Tipos de meristemas... 76 3.2.1.

Capítulo 3 Clonagem de plantas proliferação de meristemas e organogénese... 75 3.1. Introdução... 75 3.2. Tipos de meristemas... 76 3.2.1. Sumário 7 Apresentação... 13 Lista de abreviaturas... 16 Capítulo 1 Introdução Geral... 19 1.1. O problema da alimentação à escala planetária... 19 1.2. O conceito de Biotecnologia... 27 1.3. A utilização

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide.

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide. Resumo de Biologia Crescimento e renovação celular As células são unidades estruturais e funcionais dos organismos. Utilizando o seu programa genético, produzem moléculas específicos que permitem o crescimento

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

MAPA DO CROMOSSOMA DE E.coli

MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Teste de avaliação Nome ----------------------------------------------------------------------- Numero -------------------------------

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

DNA, RNA e PROTEÍNAS

DNA, RNA e PROTEÍNAS DNA, RNA e PROTEÍNAS DNA PROTEÍNA Carla Costa Faculdade de Medicina da Universidade do Porto Serviço e Laboratório de Biologia Celular e Molecular OBSERVAÇÃO A descoberta do DNA foi crucial para o entendimento

Leia mais

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014 Biologia Molecular Caderno de relatórios Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva Docentes: Dr. Cláudio Sunkel, Prof. Mariana Osswald 1 Extração de DNA genómico de Drosophila Melanogaster

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Transformação genética e suas aplicações em pesquisa e biotecnologia

Transformação genética e suas aplicações em pesquisa e biotecnologia GaTE Lab Genomics and Transposable Elements Transformação genética e suas aplicações em pesquisa e biotecnologia Profa. Dra. Magdalena Rossi Que é um organismo geneticamente modificado (OGM)? São aqueles

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA 1- As acetabularias (fotografia à esquerda) são algas verdes marinhas, com 2 a 3 cm de altura, constituídas por uma base ou pé, onde está o núcleo, e um caulículo, na extremidade do qual se diferencia

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

OLIMPÍADAS DE BIOTECNOLOGIA

OLIMPÍADAS DE BIOTECNOLOGIA OLIMPÍADAS DE BIOTECNOLOGIA Duração da prova: 2 horas Teste Modelo Nas folhas de respostas preencha o cabeçalho com os seus dados e os da escola que representa. O teste tem a duração de 2 horas no total,

Leia mais