UNIVERSIDADE DE SÃO PAULO FACULDADE DE ZOOTECNIA E ENGENHARIA DE ALIMENTOS

Tamanho: px
Começar a partir da página:

Download "UNIVERSIDADE DE SÃO PAULO FACULDADE DE ZOOTECNIA E ENGENHARIA DE ALIMENTOS"

Transcrição

1 UNIVERSIDADE DE SÃO PAULO FACULDADE DE ZOOTECNIA E ENGENHARIA DE ALIMENTOS Desenvolvimento de Marcadores Moleculares para Determinação da Origem Sexual e Racial de Produtos Cárneos Relatório final apresentado ao PIBIC CNPq. Orientada: Aline Silva Mello Cesar Orientador: Flávio Vieira Meirelles Pirassununga SP Agosto de 2005

2 RESUMO Com o aparecimento de doenças como a encefalite espongiforme bovina ( vaca louca ) e outros problemas sanitários, os países da comunidade européia e outras regiões do mundo passaram a exigir a rastreabilidade dos produtos de origem animal. Nesse sistema, várias características são importantes, como o sexo, a idade, a raça e/ou a composição racial dos animais, além de dados da cadeia produtiva. Em geral, a empresa cerftificadora dispõe das informações do animal que está sendo abatido, porém não tem condições de garantir se houve erro entre abate, desossa, processamento e a distribuição dos produtos. Existe diferenciação no custo e na qualidade dos produtos cárneos, especialmente no mercado internacional, em virtude do sexo e composição racial dos animais, no entanto, após o abate torna-se difícil e complexo determinar estas características. Pretende-se neste projeto utilizar marcadores moleculares que permitam aferir parâmetros rastreados pelo programa de certificação da carne bovina como: o sexo e a composição racial dos animais abatidos, visando a correta identificação e valorização do produto final para o consumidor. Palavras-chave: rastreabilidade, marcador molecular, carne bovina, raça e sexo. ABSTRACT Lately, beef cattle and other species have been presenting several diseases as BSE (bovine encephalopathy spongiform), among others, which have caused concern on consumers mind about food security. So, in order to guarantee food safety, consumers are demanding traceability for all food products. Several characteristics are important in a traceability system, such as, age at slaughter, breed and or racial composition, besides information on the productive chain. In general, the certification agent keeps information about the animals and the system which it came from, although cannot guarantee that the process including slaughter, processing and distribution of the products can be fool proof. Besides, there is a price differential, at least at the international

3 market, based on sex and breed composition of the animals. These characteristics are very complex and difficult for controlling. The objective of this work was the utilization of molecular markers which allow the checking up of characteristics controlled in the beef cattle traceability program, as sex and breed composition, in order to correctly identify and appraise the final product for the consumer. Key words: traceability, molecular markers, beef, breed and sex.

4 SUMÁRIO Lista de Figuras...5 Lista de Abreviaturas...6 Introdução...7 Objetivo...12 Material e Métodos...12 Resultados e Discussão...15 Conclusões...22 Referências...24

5 5 LISTA DE FIGURAS Figura 1: Esquema da rastreabilidade...7 Figura 2: (A) Gado Zebu e (B) Gado europeu...8 Figura 3: Reação em cadeia da polimerase...9 Figura 4: Esquema de extração de DNA a partir de amostras de carne...13 Figura 5: Foto representativa de padrões para fêmeas e machos...16 Figura 6: Freqüência de carne de fêmeas e machos do mercado da cidade de Pirassununga...16 Figura 7: Representação mtdna Bos indicus e Bos taurus...17 Figura 8: Freqüência de mtdna das amostras obtidas na cidade de Pirassununga...18 Figura 9: Representação stdna, padrões A,B e AB...19 Figura 10: Freqüência de stdna das amostras obtidas na cidade de Pirassununga...19 Figura 11: Representação dos padrões de genótipo do marcador LHR...20 Figura 12: Freqüência dos genótipos das amostras obtidas na cidade de Pirassununga segundo o marcador do gene LHR...21 Figura 13: Associação dos resultados dos marcadores moleculares...22

6 6 LISTA DE ABREVIATURAS DNA Ácido Desoxiribonucléico EDTA Àcido Etileno Diamino Tetra Acético LHR Receptor do Hormônio Luteinizante mtdna DNA mitocondrial PCR Reaction Chain Polymerase (Reação em Cadeia da Polimerase) RFLP Restriction Fragment Lenght Polymorphism (Polimorfismo no Comprimento do Fragmento de Restrição) RNA Ácido ribonucléicotaq DNA DNA polimerase isolada da bactéria Thermus aquaticus stdna DNA satélite SSCP Polimorfismo Conformacional de Fita Simples TBE Tris Borato EDTA

7 7 Introdução Com o aparecimento de doenças como a encefalopatia espongiforme bovina (vaca louca) e outros problemas sanitários, os países da comunidade européia e outras regiões do mundo passaram a exigir a rastreabilidade dos produtos de origem animal. A rastreabilidade é entendida como a capacidade de permitir, rapidamente e com confiança, o resgate do histórico de um produto e de seu processo de produção, atuando como o mecanismo fundamental na segurança alimentar da população (Figura 1). RASTREABILIDADE Campo Processamento Transporte Preparo Venda Armazenamento Figura 1: Esquema da rastreabilidade. Para o Brasil, detentor do maior rebanho bovino comercial do mundo, com mais de 180 milhões de cabeças, e índices crescentes de produtividade, é fundamental garantir a sustentabilidade do segmento. Assim, a rastreabilidade torna-se a chave para que possa alcançar e manter a competitividade nesse mercado quantitativo, altamente exigente e concorrido (VICTORELLI NETO, 2004).

8 8 Nesse sistema de rastreamento, várias características são importantes, como o sexo, a idade, a raça e/ou a composição racial dos animais, além de dados da cadeia produtiva. Em geral, a empresa certificadora dispõe das informações do animal que está sendo abatido, todavia, não tem condições de garantir que não houve erros entre o abate, desossa e a distribuição dos produtos. Neste sentido tenta-se desenvolver metodologias e técnicas que auxiliem a rastreabilidade e que certifique as características dos produtos, assim, este trabalho abrange as características de subespécie (Bos taurus e Bos indicus) e do sexo do animal originário do produto cárneo. O Brasil é um dos mais importantes centros de criação e seleção de raças zebuínas, acreditando-se possuir um rebanho com 80% de composição genética de zebuínos (RIPAMONTE, 2002). O país comercializa sua carne bovina no mercado internacional a preços significativamente mais baixos quando comparados com outros países grandes exportadores como USA, Austrália e Argentina. Uma das razões é o fato de sua carne ser na sua quase totalidade oriunda de gado zebuíno. A própria Austrália no seu sistema de classificação de carcaças penaliza aqueles com mais de 25% de sangue zebu. As raças de bovinos domésticos podem ser classificadas em dois grupos, o europeu (Bos taurus) e o zebuíno (Bos indicus). Embora a nomenclatura clássica de Lineu considere esses grupos como espécies distintas, diversos autores têm sugerido que são subespécies (MANWELL; BAKER, 1980) (Figura 2). A B Figura 2: (A) Gado Zebu e (B) Gado europeu.

9 9 Com os avanços no campo da biologia molecular e o desenvolvimento da Reação em Cadeia da Polimerase (PCR) no início dos anos 80, que consiste em ser uma técnica in vitro que reproduz a característica natural de replicação do DNA, e a descoberta de marcadores moleculares, têm sido possível a identificação mais precisa entre esses grupos. PCR se constitui hoje no método de rotina para isolar rapidamente seqüências específicas a partir de uma mistura complexa de seqüências genômicas ou de cdnas (Figura 3), com o desenvolvimento da técnica de PCR novos procedimentos surgiram como RFLP (do inglês, Restriction Fragment Lenght Polymorphism). Polimorfismos de comprimento de fragmentos de restrição ou RFLP são resultados da presença de variações nas seqüências de DNA que criam ou eliminam sítios de reconhecimento para endonucleases de restrição. A principal vantagem da análise de polimosfirmos de restrição utilizando PCR-RFLP é a possível identificação de indivíduos homozigotos e heterozigotos. E ainda RFLP permite a identificação de diferenças entre indivíduos quanto ao número e posição dos sítios de restrição em uma determinada molécula de DNA. Endonucleases de restrição são enzimas que cortam a molécula de DNA de uma maneira dependente de seqüência segundo a Empresa Brasileira de Pesquisa Agropecuária (Embrapa), (2001). Figura 3: Reação em cadeia da polimerase.

10 10 Virtualmente, qualquer seqüência alvo de DNA pode ser amplificada por PCR. A localização da seqüência alvo é feita pelos iniciadores (primers). Oligonucleotídeos com 20 pares de bases são usualmente seletivos o suficiente para localizar um sítio único em um genoma de alta complexidade, tal como o genoma humano.o pareamento dos primers com a seqüência alvo na amostra se faz pelo estabelecimento de pontes de hidrogênio, obedecendo o pareamento convencional: A T C G Já foram identificados polimorfismos na seqüência do DNA mitocondrial (mtdna) entre as raças B. taurus e B. indicus, assim como em regiões menos variáveis, como RNAs transportadores (PEGORARO et al., 1995). A herança dos genes contidos na mitocôndria é exclusivamente materna nos mamíferos (GILES et al., 1980). Meirelles et al. (1999) conduziram um trabalho com a hipótese de que genes citoplasmáticos portem polimorfismos entre animais. Os resultados obtidos confirmaram que uma grande proporção do zebu americano é originado do cruzamento de fêmeas de origem taurina, portadoras de DNAmt europeu, com machos de origem do sub-continente indiano portadores de DNAmt do B. indicus. Portanto, faz-se necessária a utilização de marcadores nucleares na identificação da origem do animal. Desde a descoberta de regiões repetitivas do DNA (MIESFELD et al., 1981), loci altamente polimórficos vem sendo descritos em diversas espécies (FRIES et al., 1990). Mais recentemente, foi observado uma variação em um satélite da região centromérica que introduz um sítio de restrição em parte das seqüências de animais B. indicus (RIPAMONTE, 2001; NIJMAN et al. 1999). Atualmente diversos outros marcadores são reconhecidamente polimórficos entre animais Bos taurus e Bos indicus. O gene do receptor do hormônio lueinizante (LHR) contém um destes polimorfismos. Obtido pó SSCP (Polimorfismo conformacional de fita simples) este gene encontra-se no cromossomo 11 e o seu sequenciamento revelou uma mutação pontual na

11 11 posição 1328, traduzida por uma troca de bases nucleotídicas citosina (C) por timina (T), que foi posteriormente confirmada por digestão com a enzima de restrição HhaI ( MARSON, 2005). Com a utilização desta foram observados três genótipos TT, CT e CC, que em Nelore especificamente foi observada uma predominância do alelo T (0,755 para o T contra 0,245 para o C) (MILAZZOTTO, 2001). Outra característica avaliada num produto cárneo é o sexo do animal que o originou. No Brasil observa-se diferença quanto ao valor pago ao produtor da arroba de carne de fêmea e de macho (R$ para machos e R$ para fêmeas, média dos últimos 10 anos segundo Anual Pec, 2004). O Brasil abateu em % do seu rebanho total sendo 45% de fêmeas, aproximadamente 19 milhões de fêmeas (Anual Pec, 2004).) Estudos de sexagem por DNA são corriqueiros em trabalhos envolvendo embriologia e cultivo de células. Assim, por meio da utilização de marcadores genéticos do cromossomo Y e marcadores aleatórios em cromossomos não sexuais é possível determinar o sexo do animal através do produto. A amelogenina constitui a mais abundante classe de proteínas responsáveis pela formação do esmalte dos dentes. O gene da amelogenina está localizado, exclusivamente para bovinos e humanos, nos cromossomos X e Y (GIBSON et al., 1991). Existem duas classes distintas de cdna classe I e classe II que são produtos dos genes localizados no cromossomo X e Y, respectivamente (GIBSON et al.,1991,1992). Quando se amplifica uma seqüência do gene da amelogenina é possível diferenciar machos e fêmeas, ou seja, o cromossomo X e Y, ao mesmo tempo, utilizando-se apenas um par de oligonucleotídeos. Durante uma amplificação desta seqüência por PCR observa-se duas bandas bem diferenciadas, uma proveniente da amplificação do gene de classe I e outra do gene de classe II. Diferencia-se o produto da amplificação do gene da classe I (cromossomo X) e classe II (cromossomo Y) devido uma deleção de 67 pares de base (pb) no gene amelogenina classe II (RAMALHO, 2003).

12 12 A partir desta particularidade do gene da amelogenina é possível caracterizar a origem de um produto cárneo quer seja de origem de um animal macho ou fêmea, a partir do DNA extraído deste produto. Objetivos 1. Identificar a subespécie e o sexo nas amostras de carne bovina por marcadores moleculares PCR-RFLP. 2. Testar a freqüência destes marcadores em amostras de produtos cárneos obtidos no mercado da cidade de Pirassununga - SP. Material e Métodos Amostras. Foram coletadas na cidade de Pirassununga 27 amostras de músculo bovino, entre eles: (Longissimus dorsi), Lagarto (Semitendinosus) e Coxão-duro (Biceps femoris) de diferentes pontos comerciais (10 pontos de venda), e solicitada a informação quanto ao sexo destas amostras das quais o DNA foi extraído. Extração do DNA. Cerca de 0,2 g de músculo foram pesados e macerados em almofariz de 80 ml com a utilização de Nitrogênio líquido. Às amostras foram adicionados 800 µl de solução tampão proteinase K (Tris HCl (ph 8.0), EDTA, NaCl e água ultrafiltrada) e incubadas com proteinase K por 3 horas à 55ºC, seguido por precipitação de proteínas com solução de NaCl 5M. O sobrenadante foi precipitado com adição de 2 volumes de acetato de amônio 3 M e 3 volumes de etanol absoluto, e lavado com etanol 70%.Ao pellet foi adicionado 50µL de água ultrafiltrada e diluídoà 37ºC por 2 horas (Figura 4) de acordo com o protocolo descrito por Biase et al. (2002).

13 13 Digestão com Proteinase K Precipitação com NaCl 2 Adição Etanol Absoluto Amostra de DNA Figura 4: Esquema de extração de DNA a partir de amostras de carne. Quantificação do DNA. A concentração de DNA de cada amostra foi medida por espectrofotometria utilizando-se uma diluição de 5 µl de amostra : 45 µl de água ultrafiltrada. A leitura da absorbância foi realizada a 260 e 280 nm e verificada a relação de proteína/dna. Avaliação do sexo. PCR multiplex com dois pares de oligonucleotídeos, um que amplifica uma seqüência de 210 pb (primer 1), específica do cromossomo Y bovino (Bondioli et al.,1989), e outro que amplifica uma seqüência de 280 pb (primer 2), de um cromossomo autossômico (Ellis & Harpold, 1986, 1988; Ellis et al., 1988). Foram utilizados 100 ng de DNA para uma reação de 25 µl contendo 0,2 mm de cada dntp, 1,25 U de Taq DNA polimerase e 0,2 µm de cada oligonucleotídeo iniciador. A PCR foi realizada no Termociclador PTC 100 M.J.Research, (Inc. Waltham, M.A. USA) em 40 ciclos de desnaturação a 94 C por 60 segundos, anelamento a 58 C por 30 segundos e extensão a 72 C por 60 segundos. A eletroforese dos fragmentos foi realizada em gel de agarose 2,5% contendo brometo de etídeo em TBE 1X e os fragmentos amplificados foram visualizados utilizando o scanner laser Fuji FLA 3000G. As amostras foram analisadas de acordo com a presença ou ausência da banda de 210 pb característica do cromossomo Y específico. Primer 1 5 CCT CCC CTT GTT CAA ACG CCC GGA ATC ATT 3 5 TGC TTG ACT GCA GGG ACC GAG AGG TTT GGG 3

14 14 Primer 2 5 AGG TCG CGA GAT TGG TCG CTA GGT CAT GCA 3 5 AAG ACC TCG AGA GAC CCT CTT CAA CAC GT 3 Avaliação do DNA Mitocondrial (mtdna) PCR-RFLP (Reação em Cadeia da Polimerase-Polimorfismo baseado no tamanho do fragmento de restrição). Foi realizada a amplificação por PCR do mtdna utilizando-se os primers BosmtF1 5 - CCC AAC GAG GAA AAT ATA CC 3 e Bosmt R1 5 AAC CGC AAA CAA CCT CTT CC 3 que flanqueiam uma região do gene ND5 do genoma mitocondrial dos nucleotídeos ao de acordo com Anderson et al. (1982). Para reação de PCR utilizou-se 100 ng de DNA para uma reação de 25 µl, 0,2 µm de cada dntp, 1,25 U de Taq DNA polimerase e 0,2 mm de cada oligonucleotídeo iniciador (primer) em 35 ciclos de 30 segundos à 94 o C, 45 segundos à 58 o C e 45 segundos à 72 o C. O fragmento de mtdna amplificado foi digerido com a enzima de restrição Hind III e submetido a eletroforese em gel de agarose 1,5% contendo brometo de etídeo em TBE 1X. As amostras foram analisadas de acordo com a presença ou ausência do sítio de restrição da enzima Hind III, os indivíduos foram classificados como portadores de mtdna de B.taurus ou portadores de mtdna B. indicus. Avaliação da subespécie DNA satélite (stdna) por PCR-RFLP. No intuito de identificar a presença de alelos B. taurus em um animal, foi amplificada uma região satélite (stdna) denominada 1711b, localizada na porção centromérica e equivalente a 7.1% do genoma bovino (Streeck, 1981). Para reação de PCR foram utilizados 100 ng de DNA para uma reação de 25 µl, 0,2 mm de cada dntp, 1,25 U de Taq DNA polimerase e 0,2 µm de cada oligonucleotídeo iniciador (primer) em 35 ciclos de 15 segundos à 94 o C, 45 segundos à 62 o C e 60 segundos à 72 o C. Foram empregados os seguintes primers: F: 5 ATGAGGAAGGAGGCTCGGCA 3 e R: 5 TGATCCAGGGTATTCGAAGGA 3 para amplificação da 1711b. Os fragmentos resultantes foram digeridos com a enzima de restrição Msp I, que cliva em somente um sítio parte dos satélites de origem B. indicus. Após a digestão dos produtos de PCR, os fragmentos do DNA foram corados com brometo de etídeo

15 15 (0,5 µg/ml) e separados em gel de agarose 2,5% em TBE 1X e visualizado em scanner laser Fuji FLA 3000G. Avaliação da subespécie utilizando o marcador LHR por PCR-RFLP. É um marcador localizado na região codificadora do receptor do hormônio luteinizante (LHR) (SOUMANO et al., 1998) que possui alelos Bos indicus ou Bos taurus específicos. A amplificação do gene LHR foi realizada utilizando-se os primers F 5 CAAACTGACAGTCCCCCGCTTT 3 e R 5 CTCCGAGCATGACTGGAATGGC 3. Para a reação de PCR foi utilizado aproximadamente 120 ng de DNA para uma reação de 25 µl, contendo 0,2 µm de cada dntp, 0,5 U de Taq DNA polimerase e 0,2 mm de cada oligonucleotídeo iniciador em 32 ciclos de 1 minuto à 94º C, 30 segundos à 58º C e 1 minuto à 72º C. O fragmento amplificado foi digerido com a enzima de restrição HhaI e submetido a eletroforese em gel de agarose 1,5% corado com brometo de etídeo em TBE 1X e avaliado utilizando o scanner de fluorescência Fuji FLA 3000G (Fuji Film). Resultados e Discussão Amostras, extração e quantificação do DNA A partir do protocolo para extração de DNA de músculo bovino obteve-se bons resultados de extração, os quais foram verificados pela leitura em espectrofotômetro a 260 nm. E ainda avaliou-se a relação DNA/proteína que resultou em média 1,65. Avaliação do sexo A partir da pesquisa realizada com os vendedores em cada ponto de venda da cidade de Pirassununga quanto ao provável sexo das amostras, verificou-se pelas informações prestadas que 100% da carne era oriunda de animais machos.

16 16 A avaliação do resultado da PCR em gel de agarose 2,5% após visualização em scanner, permitiu observar dois padrões. Um padrão representado por fêmeas onde não se observa a banda de 210 pb específico do cromossomo Y e outro padrão onde observa-se duas bandas um de um cromossomo autossômico bovino (280 pb) e outra específica do cromossomo Y (210 pb), como observa-se na figura 5. M F 280 pb 210 pb Figura 5: Foto representativa de padrões para fêmeas e machos. Diferentemente do resultado da pesquisa, as análises moleculares do DNA extraído mostraram que 41% das amostras eram proveniente de fêmeas e 59% de machos (Figura 6). Frequência de machos e fêmeas (%) Fêmea sexo Macho Figura 6: Freqüência de carne de fêmeas e machos do mercado da cidade de Pirassununga SP.

17 17 Avaliação do mtdna Os resultados foram avaliados quanto aos padrões de bandas representados em gel de agarose visualizado em scanner. Aquele que apresentou duas bandas (possui sítio de restrição para enzima Hind III), foi considerado animal com mtdna B. taurus e aquele representou apenas uma banda foi considerado com mtdna B. indicus (Figura 7). Obteve-se como resultado uma freqüência de 100% das amostras apresentando sítio de restrição da enzima Hind III, caracterizando mtdna B. taurus (Figura 8), apesar da grande maioria do rebanho brasileiro ser originário de gado zebu esperava-se encontrar grande parte das amostras de animais com mtdna B. taurus. Podendo ser explicado pelo fato de que durante a formação das raças zebuínas brasileiras, as linhas maternas de B. taurus tiveram grande participação, sendo demonstrado pela contribuição majoritária do genoma mitocondrial desta subespécie (MEIRELLES et al, 1999). φx B. indicus B. taurus Figura 7: Representação mtdna Bos indicus e Bos taurus.

18 18 Frequência de mtdna B.taurus e B. indicus (%) B. taurus B. indicus Subespécie Figura 8: Freqüência de mtdna das amostras obtidas na cidade de Pirassununga. Avaliação do stdna A amplificação do stdna das amostras apresentou 3 padrões de digestão distintos (A caracterizando animais Bos indicus, B - caracterizando animais Bos indicus e/ou Bos taurus e AB - caracterizando animais Bos indicus ou mestiços). Para animais possivelmente B. indicus, verificou-se a presença de um sítio de restrição da enzima Msp I homogeneamente distribuído em todos os fragmentos satélites, dois sítios de restrição homogeneamente distribuído em todos os fragmentos satélites ou os dois padrões de restrição heterogeneamente distribuídos (RIPAMONTE, 2002) (Figura 9). A partir das amostras avaliadas verificou-se que a maioria (55,5%) destas eram oriundas de animais com stdna padrão B (Bos indicus e/ou Bos taurus ou mestiços) (Figura 10). Porém para que se possa confirmar a origem do animal individualmente é preciso a utilização de outros marcadores moleculares. Foi observado um aumento de 20% da freqüência de alelos B na população quando comparado a Ripamonte (2002) que trabalhou com animais Bos indicus. Este aumento na freqüência é indicativo da presença de carne originada de animais Bos taurus ou mestiços.

19 19 φx ND A B AB a Figura 9: Representação stdna, padrões A,B e AB. Frequência do stdna (%) A B AB Padrões de stdna Figura 10: Freqüência de stdna das amostras obtidas na cidade de Pirassununga. Avaliação do LHR A amplificação do gene LHR das amostras e sua digestão com a enzima de restrição HhaI (reconhece o sítio de restrição GCGC, presente no alelo C, mas ausente no alelo T) apresentou 3 padrões de genótipos: TT homozigoto, que não foi digerido pela enzima, apresentando um fragmento de 303 pb; CT heterozigoto, digerido pela enzima, apresentando dois fragmentos, um de 303 pb

20 20 e outro de 155/148 pb; e CC homozigoto, que apresenta um fragmento de 155/148 pb, demonstrado na Figura pb TT CT CC Figura 11: Representação dos padrões de genótipo do marcador LHR. 50 pb marcador de peso molecular; TT (303 pb); CC (155/148 pb) e CT (303 pb e 155/148 pb). As amostras analisadas neste trabalho apresentaram maior freqüência do alelo T (0,54) em relação ao alelo C (0,46), o mesmo observado por Milazzotto (2001), porém com freqüências encontradas em animais da raça Nelore pura de 0,755 para o alelo T e 0,245 para o alelo C. A mesma autora, assume que genótipo TT é característico de animais Bos indicus, uma vez que o genótipo CC foi identificado em fêmeas de Limousin na freqüência de 100% (n=10) e por estar presente na seqüência depositada no Genbank. Diante disto, é possível dizer que as amostras de carne analisadas são em sua maioria provenientes de animais mestiços onde se encontrou maior número de indivíduos heterozigotos (CT) (Figura 12).

21 21 Frequência do gene LHR TT CT CC Padrões de genótipo segundo gene do LHR Figura 12: Freqüência dos genótipos das amostras obtidas na cidade de Pirassununga segundo o marcador do gene LHR. Associando-se o resultado do gene do LHR ao resultado da sexagem observamos que existe uma maior freqüência do alelo C em fêmeas (0,55), caracterizando animais com composição racial maior de Bos taurus em relação aos machos (0,41), sendo uma característica de vacas leiteiras. Os resultados envolveram análise pela estimação das freqüências alélicas e genotípicas, respectivamente, por contagem dos diferentes genótipos para cada loco estudado (WEIR, 1996). Considera-se uma população em equilíbrio de Hardy-Weinberg quando as freqüências alélicas (p e q) e genotípicas (p 2, 2pq e p 2 ) permanecem constantes de uma geração a outra em acasalamentos ao acaso. A probabilidade de equilíbrio de Hardy-Weinberg (HW) associada às freqüências genotípicas observadas foi obtida pelo teste exato de probabilidade, o Qui-Quadrado, para cada composição racial estudada. Considerando-se como hipótese H 0 que a população encontra-se em equilíbrio HW, com probabilidade de 5%, verificou-se que a população analisada a partir das amostras de carne coletadas na cidade de Pirassununga encontra-se em equilíbrio de HW.

22 22 No. Amostra mtdna stdna Sexo LHR 1554 B.taurus AB M TT 1555 B.taurus B F CC 1556 B.taurus B F CC 1557 B.taurus B F CT 1558 B.taurus A M CT 1559 B.taurus B M TT 1560 B.taurus A + B F TT 1561 B.taurus AB + M CC 1562 B.taurus B M CT 1563 B.taurus AB + M CT 1564 B.taurus B M CC 1565 B.taurus B M TT 1566 B.taurus B F TT 1567 B.taurus AB + F CC 1568 B.taurus B F CT 1569 B.taurus B M CT 1570 B.taurus A + B M CT 1571 B.taurus A + B M TT 1572 B.taurus A + B M TT 1573 B.taurus B M CT 1574 B.taurus B F CT 1575 B.taurus B F CT 1576 B.taurus A + B M CT 1577 B.taurus A + B M CT 1578 B.taurus B M CT 1579 B.taurus B M CT 1580 B.taurus B M CT Figura 13: Associação dos resultados dos marcadores moleculares. Na figura 13 foram descritos todos os resultados dos marcadores utilizados, verificando serem bastante complementares. Conclusão Com os resultados obtidos até o momento foi verificado a viabilidade da metodologia desenvolvida, podendo esta ser considerada como um recurso auxiliar para a rastreabilidade da carne bovina.

23 23 Foi também estimado que grande parte dos produtos comercializados na região da cidade de Pirassununga, é oriundo de fêmeas e de um grupo de animais com representantes das categorias mestiços ou Bos taurus. Para maiores afirmações quanto à composição racial dos animais é preciso a associação de um maior número de marcadores moleculares ou até mesmo a utilização de técnicas como PCR em tempo real que possibilitará obter a freqüência dos alelos analisados.

24 24 REFERÊNCIAS EMPRESA BRASILEIRA DE PESQUISA AGROPECUÁRIA. Embrapa Pecuária Sudeste. Biologia molecular aplicada à produção animal. Editores técnicos: Luciana Correia de Almeida Regitano, Luiz Lehmanm Coutinho. Brasília: Embrapa Informação Tecnológia, p. ISBN: BIASE, F.H.; FRANCO, M.M.; GOULART, L.R.; ANTUNES, R.C. Protocol for extraction of genomic DNA from swine tissues. Genetics and Molecular Biology, Ribeirão Preto, v.25, 3, p , FRIES, R.; EGGEN, A.; STRNZINGER, G. The bovine genome contains polymorphic microsatellites. Genomics, Orlando, v. 8, p , GEORGES, M.; MASSEY, J.M.. Polymorphic DNA markers in Bovidae. Patent WO 92/13102, GIBSON, C. et al. Structure and expression of the bovine amelogenin gene. Biochemistry, Washington, v. 30, p ,1991. GIBSON, C. et al. Bovine amelogenin message heterogeneity: alternative splicing and Y-chromossomal gene transcription. Biochemistry, Washington, v. 31, p , GILES, R. E., BLANC, H. et al. Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad. Sci. USA 77: , MANWELL, C.; BAKER, C.M.A. Chemical classification of cattle: 2. Phylogenetic tree and specific status of the Zebu. Animal and Blood Groups. Biochemical Genetics, Nova York, v. 11, p , MARSON, E.P. Caracterização da freqüência de heterozigose em genes ligados à precocidade sexual em novilhas de corte compostas p. 87. Tese (Doutorado) Faculdade de Zootecnia e Engenharia de Alimentos, Pirassununga,2005. MEIRELLES, F.V, GARCIA, J.M. et al. The American Zebu is really Bos indicus?.genetics and Molecular Biology, Ribeirão Preto, v. 22 (4), p , 1999.

25 25 MIESFELD, R.; KRYSTAL, M; ARNHEIM, N.. A member of new repeated sequence family which is conserved throughout eucaryotic evolution is found between the human δ- and β-globulin genes. Nucleic Acids Research, Londres, v. 9, p. 5931, MILAZZOTTO, M.P. Mutações no gene do receptor do hormônio luteinizante (LHR) bovino e associação com precocidade sexual em fêmeas Bos primigenius indicus (Nelore), f. Dissertação (Mestrado) Instituto de Biociências, Universidade Estadual Paulista, Botucatu, NIJMAN, I. J., BRADLEY, D. G. et al.. Satellite DNA polymorphisms and AFLP correlate with Bos indicus-taurus hybridization. Animals Genetics, v. 30, p , PEGORARO L., YANG Z. et al. Sequence comparison of mitochondrial trna genes and origin of light strand replication in Bos taurus and Nellore (Bos indicus) breeds. Animal Genetics, p. 27: 91-94, RAMALHO, M.F.P.D. Proporção de espermatozóides X e Y em DNA extraído de sêmen pela PCR no gene da amelogenina f. Tese (Doutorado) Faculdade de Ciências Agrárias e Veterinárias, Universidade Estadual Paulista, Jaboticabal, RIPAMONTE, P. Estimativa da participação do genoma de Bos taurus no rebanho nelore p. 57. Dissertação (Mestrado) Faculdade de Zootecnia. E Engenharia de Alimentos, Universidade de São Paulo, Pirassununga, VICTORELLI NETO, H.. Rastreabilidade e certificação, a nova realidade da pecuária. ANUALPEC: anuário da pecuária brasileira, São Paulo, p , WEIR, B.S. Genetic data analysis: methods for discrete population genetic data. 2 ed. Massachusetts: Sinauer Associates, 1996.

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

NOTA CIENTÍFICA. CARACTERIZAÇÃO DE UM REBANHO GIR LEITEIRO QUANTO À ORIGEM DO DNA MITOCONDRIAL (mtdna) 1

NOTA CIENTÍFICA. CARACTERIZAÇÃO DE UM REBANHO GIR LEITEIRO QUANTO À ORIGEM DO DNA MITOCONDRIAL (mtdna) 1 NOTA CIENTÍFICA CARACTERIZAÇÃO DE UM REBANHO GIR LEITEIRO QUANTO À ORIGEM DO DNA MITOCONDRIAL (mtdna) 1 ANIBAL EUGÊNIO VERCESI FILHO 2, ANDRÉ LIMA DIAS 3, VERA LÚCIA CARDOSO 4, LENIRA EL FARO 4, GIOVANA

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Estudo do polimorfismo do gene do hormônio de crescimento em rebanhos da raça Nelore do estado da Bahia. 1 2

Estudo do polimorfismo do gene do hormônio de crescimento em rebanhos da raça Nelore do estado da Bahia. 1 2 Estudo do polimorfismo do gene do hormônio de crescimento em rebanhos da raça Nelore do estado da Bahia. 1 2 Study of the polymorphism of the gene of the hormone of growth in a Nelore breed of the state

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

CARACTERIZAÇÃO DO HAPLÓTIPO MITOCONDRIAL DE UMA AMOSTRA DE TOUROS DA RAÇA NELORE, REPRESENTATIVA DAS PRINCIPAIS LINHAGENS COMERCIALIZADAS NO BRASIL

CARACTERIZAÇÃO DO HAPLÓTIPO MITOCONDRIAL DE UMA AMOSTRA DE TOUROS DA RAÇA NELORE, REPRESENTATIVA DAS PRINCIPAIS LINHAGENS COMERCIALIZADAS NO BRASIL Ciência Animal 21(1): 25-29, 2011 CARACTERIZAÇÃO DO HAPLÓTIPO MITOCONDRIAL DE UMA AMOSTRA DE TOUROS DA RAÇA NELORE, REPRESENTATIVA DAS PRINCIPAIS LINHAGENS COMERCIALIZADAS NO BRASIL (Mitochondrial haplotype

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010 MARCADORES SSR PARA A CARACTERIZAÇÃO E IDENTIFICAÇÃO DE CULTIVARES DE MILHETO (Pennisetum glaucum (L.) R. Br.) ADRIANO ALVES DA SILVA 1, ÉDILA VILELA RESENDE VON PINHO 2 ; BRUNA LINE CARVALHO 3, VIVIAN

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado

Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado Especificidade e Sensibilidade da Técnica de PCR para Detecção de Milho Geneticamente Modificado Vivian E. Nascimento 1, Édila V.R. V. Pinho 1, Renzo G.V. Pinho 1, Bruno C. dos Santos 1, Elise de M. Pereira

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

POLIMORFISMOS NO GENE CAST EM DIFERENTES RAÇAS DE OVINOS DO MATO GROSSO DO SUL, BRASIL

POLIMORFISMOS NO GENE CAST EM DIFERENTES RAÇAS DE OVINOS DO MATO GROSSO DO SUL, BRASIL POLIMORFISMOS NO GENE CAST EM DIFERENTES RAÇAS DE OVINOS DO MATO GROSSO DO SUL, BRASIL Jessica Cristina Gonçalves dos Santos ¹ ;Bruno do Amaral Crispim 2 ;Leonardo de Oliveira Seno 3 ; Fernando Miranda

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

POLIMORFISMOS DOS GENES CALPAÍNA E CALPASTATINA EM BOVINOS

POLIMORFISMOS DOS GENES CALPAÍNA E CALPASTATINA EM BOVINOS POLIMORFISMOS DOS GENES CALPAÍNA E CALPASTATINA EM BOVINOS Pereira N.I. 1,2,3, Soares W.V.B. 1, Lara M.A.C. 1* 1 Instituto de Zootecnia. Agência Paulista de Tecnologia dos Agronegócios - APTA. Nova Odessa,

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

UNIVERSIDADE DO ESTADO DE SANTA CATARINA-UDESC CENTRO DE EDUCAÇÃO SUPERIOR DO OESTE-CEO DEPARTAMENTO DE ZOOTECNIA JOÃO COSTA FILHO

UNIVERSIDADE DO ESTADO DE SANTA CATARINA-UDESC CENTRO DE EDUCAÇÃO SUPERIOR DO OESTE-CEO DEPARTAMENTO DE ZOOTECNIA JOÃO COSTA FILHO UNIVERSIDADE DO ESTADO DE SANTA CATARINA-UDESC CENTRO DE EDUCAÇÃO SUPERIOR DO OESTE-CEO DEPARTAMENTO DE ZOOTECNIA JOÃO COSTA FILHO RELATÓRIO DE ESTÁGIO SUPERVISIONADO DE CONCLUSÃO DE CURSO: IDENTIFICAÇÃO

Leia mais

RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM)

RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM) RETROCRUZAMENTOS AUXILIADOS POR MARCADORES MOLECULARES PARA CONVERSÃO DE LINHAGENS NORMAIS EM MILHO DE ALTA QUALIDADE PROTÉICA (QPM) DUARTE J.M., PACHECO C.A.P., CARNEIRO N.P., GUIMARÃES C.T., GUIMARÃES

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE Jeany Camelo Santos 1, Rafael Lucas Leonídeo 2, Flávio Monteiro Ayres 3,4 1 Bolsista PBIC/UEG. 2 Aluno de iniciação científica PVIC.

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA O O uso uso deste deste material material é é autorizado autorizado desde desde que que sejam sejam atribuídos atribuídos os os direitos direitos

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

PRÁTICA 8 MARCADORES MOLECULARES E ANÁLISE DA DIVERSIDADE GENÉTICA PCR-ESPECÍFICO DE GENES DE CLOROPLASTO E MITOCÔNDRIA E MICROSSATÉLITES

PRÁTICA 8 MARCADORES MOLECULARES E ANÁLISE DA DIVERSIDADE GENÉTICA PCR-ESPECÍFICO DE GENES DE CLOROPLASTO E MITOCÔNDRIA E MICROSSATÉLITES PRÁTICA 8 MARCADORES MOLECULARES E ANÁLISE DA DIVERSIDADE GENÉTICA PCR-ESPECÍFICO DE GENES DE CLOROPLASTO E MITOCÔNDRIA E MICROSSATÉLITES Análise de diversidade genética: De modo geral, os marcadores moleculares

Leia mais

O uso de Marcadores Moleculares na Caracterização Citoplasmática em Cebola Como Auxílio no Melhoramento de Cultivares Híbridas.

O uso de Marcadores Moleculares na Caracterização Citoplasmática em Cebola Como Auxílio no Melhoramento de Cultivares Híbridas. O uso de Marcadores Moleculares na Caracterização Citoplasmática em Cebola Como Auxílio no Melhoramento de Cultivares Híbridas. Daniela L. Leite 1 ; Denilson Anthonisen 1 1 Embrapa Clima Temperado, BR

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia da polimerase

Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia da polimerase Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia Empresa Brasileira de Pesquisa Agropecuária Embrapa Pecuária Sudeste Ministério da

Leia mais

ANÁLISE CITOGENÉTICA E COMPARAÇÃO DAS CARACTERÍSTICAS DA CARCAÇA E DA CARNE EM SUS SCROFA SCROFA (JAVALI EUROPEU)

ANÁLISE CITOGENÉTICA E COMPARAÇÃO DAS CARACTERÍSTICAS DA CARCAÇA E DA CARNE EM SUS SCROFA SCROFA (JAVALI EUROPEU) REVISTA CIENTÍFICA ELETRÔNICA DE MEDICINA VETERINÁRIA PERIODICIDADE SEMESTRAL EDIÇÃO NÚMERO 5 JULHO DE 2005 ISSN 1679-7353 ANÁLISE CITOGENÉTICA E COMPARAÇÃO DAS CARACTERÍSTICAS DA CARCAÇA E DA CARNE EM

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL Luciana Oliveira Barateli; Regina Melo Sartori Coelho; Abmael Monteiro

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

ANÁLISE DO GENE DA A-FABP (PROTEÍNA DE LIGAÇÃO DE ÁCIDOS GRAXOS DOS ADIPÓCITOS) EM SUÍNOS¹

ANÁLISE DO GENE DA A-FABP (PROTEÍNA DE LIGAÇÃO DE ÁCIDOS GRAXOS DOS ADIPÓCITOS) EM SUÍNOS¹ ANÁLISE DO GENE DA A-FABP (PROTEÍNA DE LIGAÇÃO DE ÁCIDOS GRAXOS DOS ADIPÓCITOS) EM SUÍNOS¹ SEQUENCE ANALYSIS OF PIG ADIPOCYTE FATTY ACID-BIDING PROTEIN (A-FABP) GENE KLEIBE DE MORAES SILVA 2, SIMONE E.

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

A utilização da vaca F1: visão da EMATER-MG INTRODUÇÃO

A utilização da vaca F1: visão da EMATER-MG INTRODUÇÃO A utilização da vaca F1: visão da EMATER-MG 1Elmer Ferreira Luiz de Almeida; 2José Alberto de Àvila Pires 1 Coordenador Técnico Bovinocultura de Leite da EMATER-MG 2Coordenador Técnico Bovinocultura de

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

Sexagem fetal de Bovinos através do DNA extraído de plasma materno

Sexagem fetal de Bovinos através do DNA extraído de plasma materno 1 Sexagem fetal de Bovinos através do DNA extraído de plasma materno Alex Silva da CRUZ 1,2 *, Aparecido Divino da CRUZ 1,2 ; Emília Oliveira Alves COSTA 2 1 Programa de Pós-Graduação em Biologia Molecular

Leia mais

ESTUDOS DE DIVERSIDADE GENÉTICA EM CAMARÕES UTILIZANDO MARCADORES MOLECULARES

ESTUDOS DE DIVERSIDADE GENÉTICA EM CAMARÕES UTILIZANDO MARCADORES MOLECULARES ESTUDOS DE DIVERSIDADE GENÉTICA EM CAMARÕES UTILIZANDO MARCADORES MOLECULARES Manual Prático Patrícia Domingues de Freitas São Carlos, São Paulo, abril de 2005 1 Prefácio O objetivo deste guia é fornecer

Leia mais

Associação de Criadores de Bovinos da Raça Preta

Associação de Criadores de Bovinos da Raça Preta Associação de Criadores de Bovinos da Raça Preta Benavente, 18 de Abril de 2013 1 - Resultados produtivos e reprodutivos 1.1 - Indicadores da evolução do efetivo 1.2 - Indicadores de produtividade 2 -

Leia mais

ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006

ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006 ANEXO ÚNICO DO DECRETO Nº 28.397, DE 21/09/2006 PREÂMBULO Termo de Participação, via meio eletrônico, para a seleção da melhor proposta para aquisição por dispensa de licitação, nos termos do Decreto Estadual

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais

Aula DNA Forense. Arthur Estivalet Svidzinski

Aula DNA Forense. Arthur Estivalet Svidzinski Aula DNA Forense Arthur Estivalet Svidzinski Odontologia. 1. Perícia odonto-legal, peritos, documentos médicos, laudos periciais, modelos e interpretação, ética odontológica. 2. Perícia odontológica nos

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers :

Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3. São necessários dois primers : Primers para PCR: Primers : oligonucleotídeos com 18 a 28 bases (fita única) escritos sempre na direção 5 3 São necessários dois primers : Um complementar a um trecho da fita anti-sense» Primer sense (forward)

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

BOVINOS RAÇAS SINTÉTICAS

BOVINOS RAÇAS SINTÉTICAS UNIVERSIDADE FEDERAL DO CEARÁ CENTRO DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE ZOOTECNIA LABORATÓRIO DE FISIOLOGIA DA REPRODUÇÃO BOVINOS RAÇAS SINTÉTICAS Disciplina: Exterior e raças Prof. Mauricio van Tilburg

Leia mais

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Genética de Populações Genética Básica - Bio 240 Profa. Karla Yotoko Capítulo 1 Introdução à Genética de Populações Equilíbrio de Hardy-Weinberg

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA Biotecnologia O que é isso??? É qualquer técnica que utilize organismos vivos ou suas partes, para fazer ou modificar produtos, melhorar plantas ou animais

Leia mais

Material e Métodos Resultados e Discussão

Material e Métodos Resultados e Discussão Área: Melhoramento Genético Vegetal TRANSFERIBILIDADE DE PRIMERS MICROSSATÉLITES DE Phaseolus vulgaris PARA Vigna unguiculata Matheus Felipe Nogueira da Silva 1, Leidiane Bezerra Albuquerque 2, Rafaela

Leia mais

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Vanessa Diniz Barcelos Vasconcelos 2, Newton Portilho Carneiro 3 1 Trabalho financiado pelo CNPq/Fapemig

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz)

POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz) POLIMORFISMO DA TÉCNICA TARGET REGION AMPLIFICATION POLYMORPHISM (TRAP) PARA ESTUDOS MOLECULARES EM MANDIOCA (Manihot esculenta Crantz) Catia Dias do Carmo 1, Dalma Brito Santos 2, Vandeson Rodrigues de

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis Natália Sanches Xavier (PIBIC/CNPq-FA-UEM), Rosilene Fressatti Cardoso

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO Cynthia Germoglio Farias de Melo cynthia_fariasm@hotmail.com Rayner Anderson Ferreira do Nascimento raynerbiomedicina@gmail.com

Leia mais

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA. Gene Boorola. Edgard G. Malaguez Rafael Assunção

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA. Gene Boorola. Edgard G. Malaguez Rafael Assunção MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA Gene Boorola Edgard G. Malaguez Rafael Assunção Ovelha Booroola? É uma mutação genética que tem na característica

Leia mais