Estatística Aplicada. Árvore de Decisão. Prof. Carlos Alberto Stechhahn PARTE II. Administração. p(a/b) = n(a B)/ n(b)

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Estatística Aplicada. Árvore de Decisão. Prof. Carlos Alberto Stechhahn PARTE II. Administração. p(a/b) = n(a B)/ n(b)"

Transcrição

1 Estatística Aplicada Administração p(a/b) = n(a B)/ n(b) PARTE II Árvore de Decisão Prof. Carlos Alberto Stechhahn 2014

2 1. Probabilidade Condicional - Aplicações Considere que desejamos calcular a probabilidade da ocorrência de um evento A, sabendose de antemão que ocorreu um certo evento B. Até o presente calculamos probabilidade em que o universo é o espaço amostral. Vamos supor uma empresa que compra diversos produtos (por exemplo, microcomputadores e conectores) para revenda e veremos como a PROBABILIDADE CONDICIONAL está presente em algumas atividades que nela ocorrem. Vamos supor que a empresa receba pelo correio uma caixa contendo 2 Microcomputadores e 3 Conectores, ou seja, 5 peças. M = microcomputador = micro C = conector 1) Quais são as chances (probabilidade) do operador tirar ao acaso um Micro? Resposta: 2 em 5, ou seja 2 Micros entre 5 peças. 2) Agora, supondo que um outro funcionário retirou um Conector desta caixa quais são as chances deste operador retirar um Micro?

3 Podemos observar que quando um funcionário retira um Conector, C, da caixa ele acaba alterando as chances (diminui o espaço amostral). 3) Vamos supor agora, que o funcionário retirou um Micro da caixa. Pergunta-se, quais são as chances deste operador retirar um Micro? Quando o funcionário retira um Micro, M, resulta numa condição para o operador de 1 Micro e 3 Conectores. Neste caso, teremos que as chances serão 1 em 4, ou seja, 1 Micro entre 4 peças. Podemos notar que as chances (probabilidades) se alteraram a cada retirada de peça. Este é um caso típico de EVENTOS DEPENDENTES, ou seja, a ocorrência de um evento pode afetar outros eventos.

4 4) Vamos supor agora, que o funcionário retirou um Conector da caixa e depois de usá-lo colocou novamente na caixa. Pergunta-se, quais são as chances deste operador retirar agorar um Micro? Podemos perceber que quando o funcionário retira um Conector, C, e, a seguir o devido uso, coloca de volta a peça na caixa, resulta numa situação que o evento da retirar pelo operador de 1 Micro não é afetado pelo evento anterior. Dessa forma, as chances permanecerão como sendo 2 em 5. Como se o operador fosse a primeira pessoa a retirar uma peça da caixa. Eventos como esse são chamados de EVENTOS INDEPENDENTES, ou seja, cada evento não é afetado por outros eventos. A retirada de uma peça (micro ou conector) e sua respectiva reposição NÃO AFETA A PROBABILIDADE da retirada da próxima peça. Em EVENTOS INDEPENDENTES a ocorrência de um evento não afeta a probabilidade de outros eventos.

5 2. Árvore de Probabilidade Podemos usar árvores de probabilidade para entender melhor o que acontece em cada um dos casos. O diagrama de árvore é uma boa maneira de entender o que está acontecendo. Inicialmente há uma chance de 2 em 5 de um funcionário retirar o Micro, M, e de 3 em 5 de um funcionário retirar um Conector, C. Vamos continuar analisando o que ocorre impondo que não há, neste caso, reposição de peças. Dessa forma, iremos estudar o que ocorre quando o operador retira uma 2ª. Peça da caixa. Observemos que se um funcionário retira um Micro primeiro haverá 1 em 4 a chance do operador retirar um Micro, M, e uma chance de 3 em 4 de retirar um Conector, C. No entanto, se um conector foi retirado primeiro, há uma chance de 2 em 4 para que um Micro seja retirado na 2ª. tentativa. E uma chance de 2 em 4 de retirar um segundo conector. 5) Vamos supor agora, que o operador irá precisa de 2 Micros. Sabendo-se que ele irá retirar as peças dessa nossa caixa já apresentada, quais são as chances do operador retirar aleatoriamente 2 Micros em sequência?

6 Resposta: Será uma chance de 2 em 5 seguida de 1 em 4. Em árvores de probabilidades nós MULTIPLICAMOS as probabilidade através dos ramos e SOMAMOS as probabilidades descendo nas colunas. Dessa forma, multiplicando-se as chances teremos: = 2 20 = 1 10 Logo, teremos 10% de chance para a retirada de dois Micros M em sequência. 3. Notação de Probabilidade P(A) significa PROBABILIDADE DO EVENTO A OCORRER. No nosso exemplo o evento A é RETIRAR 1 MICRO primeiro, com probabilidade de 2/5. Analogamente, P(B) significa PROBABILIDADE DO EVENTO B OCORRER. E o evento B é retirar um Micro na 2ª. tentativa. Mas para isso teríamos 2 escolhas: E1) Se a 1ª. peça que foi retirada foi um Micro teríamos 1/4 de chance de retirar um Micro na 2ª. tentativa. No entanto, E2) Se a 1ª. peça retirada foi um Conector, a chance de retirar um Micro na 2ª. tentativa seria de 2/4.

7 Então, para o nosso caso, devemos dizer qual o EVENTO que queremos para obtermos as chances do operador retirar 2 Micros em sequência. Já podemos portanto usar a notação de probabilidade em nossa árvore. P(B A) lê-se P B barra A. É a probabilidade do evento B dado o evento A. Em outras palavras, o evento A já ocorreu, qual a probabilidade do evento B? P(B A) é também chamado de probabilidade condicional de B dado A. Em nosso caso P(B A) = 1/4.

8 Probabilidade do evento A e evento B, P(A e B) = P(A B) (1) é igual a probabilidade do evento A vezes a probabilidade do evento B dado A. p(a B) = p(a,b) = p(a). p(a B) (2) Probabilidade do evento A e B é a probabilidade de se retirar um Micro na 1ª. tentativa e na 2ª. tentativa. Então, a probabilidade do operador retirar, em sequência, dois Micros é P(A e B) = P(A B) = = 1 10 E podemos escrever a expressão (2) do seguinte modo: P(A B) = P(A B) P(A) que é a fórmula da probabilidade condicional. Vamos estudar agora uma situação muito comum e de muita importância em nossa empresa. Supondo agora que temos 3 caixas e cada caixa contendo um número diferente de peças. Na 1ª. caixa temos 10 peças, sendo 4 delas defeituosas, D. Na 2ª. caixa temos 6 peças, sendo 1 delas defeituosa, D. Na 3ª. caixa temos 8 peças, das quais 3 delas defeituosas, D. Qual a probabilidade de ele retirar 1 peça defeituosa sendo que ele escolhe aleatoriamente entre as 3 caixas? Vamos primeiramente construir a ÁRVORE DE PROBABILIDADES. Chamemos de A1 o evento de ele escolher a caixa 1, de A2 o evento de ele escolher a caixa 2, de A3 o evento de ele escolher a caixa 3.

9 Sabemos das notações da Estatística que podemos, neste caso, escrever de uma maneira geral os eventos por Ai onde i = 1,2 ou 3. Vamos chamar ainda de B o evento de ele escolher uma peça defeituosa. Como as chances, do operário escolher uma caixa, são as mesmas, pois, elas são visualmente iguais, teremos 1/3 de chance de ele escolher uma das caixas. Analisemos inicialmente a caixa 1: A probabilidade de ele escolher 1 peça D (defeituosa) é 4/10. Dessa forma a probabilidade de B dado A1 é de 4/10 P(B A 1 ) = 4 10 Vamos ter, nessa sequência, que a probabilidade de B dado A2 é de 1/6 e a probabilidade de B dado A3 é de 3/8. Para descobrirmos a probabilidade de ele descobrir uma peça defeituosa temos que verificar quais são os casos (escolhas) em que ele pode retirar uma peça defeituosa. Esses casos sã P(A 1 ). P(B A 1 ) = 4 30 P(A 2 )P(B A 2 ) = 1 18 P(A 3 )P(B A 3 ) = 3 24

10 Em ÁRVORES DE PROBABILIDADE nós somamos as probabilidades. Então teremos que a PROBABILIDADE de um operário tirar uma peça defeituosa será: P(B) = P(A 1 )P(B A 1 ) + P(A 2 )P(B A 2 ) + P(A 3 )P(B A 3 ) ou seja, P(B) = = Com isto podemos verificar um importante teorema conhecido como TEOREMA DA PROBABILIDADE TOTAL P(B) = P(A 1 )P(B A 1 ) + P(A 2 )P(B A 2 ) + + P(A i )P(B A i ) Considerando ainda a situação acima (3 caixas semelhantes com diferentes números de peças em cada uma) Qual a probabilidade ser da CAIXA 1 dado que ele escolheu 1 peça defeituosa? P(A 1 B) = probabilidade de ser 1 peça da CAIXA 1 dado que ele retirou 1 peça defeituosa. Mas a probabilidade de A1 dado B não aparece em nossa árvore de probabilidade. Como poderíamos calcular essa probabilidade usando o que aprendemos, bem como, nossa ÁRVORE DE PROBABILIDADE. Devemos, neste caso, reescrever a fórmula da nossa probabilidade condicional. P(A 1 B) = P(A 1, B) P(B) = P(A 1). P(B A 1 ) P(B)

11 Cada um dos fatores da equação acima pode ser encontrado na árvore de probabilidade. Ela nos informa que: P(A 1 ) = 1 3 P(B A 1 ) = 4 10 P(B) = Dessa forma, é possível calcular a probabilidade de uma peça ser da CAIXA 1 dado que ele escolheu 1 peça defeituosa: P(A 1 B) = P(A 1). P(B A 1 ) P(B) = = Esses cálculos acima efetuados para se inferior que a peça defeituosa foi retirada da CAIXA 1 pode ser generalizado. 4. TEOREMA DE BAYES É o procedimento geral para se inferior a probabilidade de um evento passado em função de evidências presentes ou futuras. TB: Se conhecermos a probabilidade de B dado A podemos calcular a probabilidade de A dado B usando a seguinte equação P(A B) = P(A). P(B A) P(B)

12 Ou seja, se soubermos a prob das evidências, dado um certo histórico, o Teorema de Bayes nos permite voltar no tempo e calcular a probabilidade do histórico dadas as evidências. APLICAÇÕES: (diferentes áreas do conhecimento) Técnicas de Aprendizado de Máquina (usada em diversos ramos da computação como o reconhecimento de imagens e roteamento de redes). Estatísticas Criminais: usadas nas investigações de crimes onde se pode inferir sobre o passado através de probabilidades sobre o que ocorreu no crime condicionado nas evidências.

13 CONCLUSÕES: A Probabilidade Condicional é útil não só para se inferir probabilidade de eventos no futuro mas também para inferir problemas no passado. Saber como condicionar é uma arte. Podemos quebrar problema aparentemente muito complicado em subproblemas simples e tratáveis sejam eles acadêmicos ou da vida real.

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL.

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL. Estatística Aplicada Administração p(a) = n(a) / n(u) PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL Prof. Carlos Alberto Stechhahn 2014 1. Noções de Probabilidade Chama-se experimento

Leia mais

Exercícios resolvidos sobre Teoremas de Probabilidade

Exercícios resolvidos sobre Teoremas de Probabilidade Exercícios resolvidos sobre Teoremas de Probabilidade Aqui você tem mais uma oportunidade de estudar os teoremas da probabilidade, por meio de um conjunto de exercícios resolvidos. Observe como as propriedades

Leia mais

Sumário. 2 Índice Remissivo 12

Sumário. 2 Índice Remissivo 12 i Sumário 1 Definições Básicas 1 1.1 Fundamentos de Probabilidade............................. 1 1.2 Noções de Probabilidade................................ 3 1.3 Espaços Amostrais Finitos...............................

Leia mais

Probabilidade Condicional. Prof.: Ademilson

Probabilidade Condicional. Prof.: Ademilson Probabilidade Condicional Prof.: Ademilson Operações com eventos Apresentam-se abaixo algumas propriedades decorrentes de complementação, união e interseção de eventos, úteis no estudo de probabilidade.

Leia mais

Teoria da Probabilidade

Teoria da Probabilidade Teoria da Probabilidade Luis Henrique Assumpção Lolis 14 de fevereiro de 2014 Luis Henrique Assumpção Lolis Teoria da Probabilidade 1 Conteúdo 1 O Experimento Aleatório 2 Espaço de amostras 3 Álgebra dos

Leia mais

Estatística Básica. Probabilidade. Renato Dourado Maia. Instituto de Ciências Agrárias. Universidade Federal de Minas Gerais

Estatística Básica. Probabilidade. Renato Dourado Maia. Instituto de Ciências Agrárias. Universidade Federal de Minas Gerais Estatística Básica Probabilidade Renato Dourado Maia Instituto de Ciências Agrárias Universidade Federal de Minas Gerais Probabilidade Condicional Dados dois eventos A e B, a probabilidade condicional

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais

Modelos de Probabilidade e Inferência Estatística

Modelos de Probabilidade e Inferência Estatística Modelos de Probabilidade e Inferência Estatística Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 03/14 1 / 48 É provável que você

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 7 - Probabilidade condicional e independência Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Probabilidade condicional Seja (Ω, A, P) um espaço de probabilidade. Se

Leia mais

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Def.: Um experimento é dito aleatório quando o seu resultado não for previsível antes de sua realização, ou seja,

Leia mais

BIOESTATISTICA. Unidade IV - Probabilidades

BIOESTATISTICA. Unidade IV - Probabilidades BIOESTATISTICA Unidade IV - Probabilidades 0 PROBABILIDADE E DISTRIBUIÇÃO DE FREQUÊNCIAS COMO ESTIMATIVA DA PROBABILIDADE Noções de Probabilidade Após realizar a descrição dos eventos utilizando gráficos,

Leia mais

Processos Estocásticos

Processos Estocásticos Processos Estocásticos Primeira Lista de Exercícios de junho de 0 Quantos códigos de quatro letras podem ser construídos usando-se as letras a, b, c, d, e, f se: a nenhuma letra puder ser repetida? b qualquer

Leia mais

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência Prof. Clécio da Silva Ferreira Depto Estatística - UFJF 1 Perguntas 1. Um novo aparelho para detectar um certo tipo de

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA

UNIVERSIDADE FEDERAL DA PARAÍBA UNIVERSIDADE FEDERAL DA PARAÍBA Probabilidade Departamento de Estatística UFPB Luiz Medeiros Introdução Encontramos na natureza dois tipos de fenômenos Determinísticos: Os resultados são sempre os mesmos

Leia mais

Prof.Letícia Garcia Polac. 26 de setembro de 2017

Prof.Letícia Garcia Polac. 26 de setembro de 2017 Bioestatística Prof.Letícia Garcia Polac Universidade Federal de Uberlândia UFU-MG 26 de setembro de 2017 Sumário 1 2 Probabilidade Condicional e Independência Introdução Neste capítulo serão abordados

Leia mais

INTRODUÇÃO À PROBABILIDADE

INTRODUÇÃO À PROBABILIDADE INTRODUÇÃO À PROBABILIDADE Foto extraída em http://www.alea.pt Profª Maria Eliane Universidade Estadual de Santa Cruz USO DE PROBABILIDADES EM SITUAÇÕES DO COTIDIANO Escolhas pessoais Previsão do tempo

Leia mais

Probabilidade e Estatística Probabilidade Condicional

Probabilidade e Estatística Probabilidade Condicional Introdução Probabilidade e Estatística Probabilidade Condicional Em algumas situações, a probabilidade de ocorrência de um certo evento pode ser afetada se tivermos alguma informação sobre a ocorrência

Leia mais

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://paginapessoal.utfpr.edu.br/ngsilva Probabilidade Probabilidade Experimento Aleatório Um experimento é dito aleatório quando satisfaz

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova 1 de Probabilidade I Prof.: Fabiano F. T. dos Santos Goiânia, 15 de setembro de 2014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES PROBABILIDADE E ESTATÍSTICA PROBABILIDADES Bruno Baierle Maurício Furigo Prof.ª Sheila Regina Oro (orientadora) Edital 06/2013 - Produção de Recursos Educacionais Digitais Revisando - Análise combinatória

Leia mais

Estatística II Aula 2. Prof.: Patricia Maria Bortolon, D. Sc.

Estatística II Aula 2. Prof.: Patricia Maria Bortolon, D. Sc. Estatística II Aula Prof.: Patricia Maria Bortolon, D. Sc. Distribuições Amostrais ... vocês lembram que: Antes de tudo... Estatística Parâmetro Amostra População E usamos estatíticas das amostras para

Leia mais

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES PROBABILIDADE E ESTATÍSTICA PROBABILIDADES Bruno Baierle Maurício Furigo Prof.ª Sheila Regina Oro (orientadora) Edital 06/2013 - Produção de Recursos Educacionais Digitais Revisando - Análise combinatória

Leia mais

T o e r o ia a da P oba ba i b lida d de

T o e r o ia a da P oba ba i b lida d de Teoria da Probabilidade Prof. Joni Fusinato Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso cotidiano. Usa o princípio básico do aprendizado humano que

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013 Métodos Quantitativos para Ciência da Computação Experimental Jussara Almeida DCC-UFMG 2013 Revisão de Probabilidade e Estatística Concentrado em estatística aplicada Estatística apropriada para medições

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba Probabilidade I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 08/16 1 / 56 Introdução É provável que você ganhe um aumento....

Leia mais

Conceitos básicos de teoria da probabilidade

Conceitos básicos de teoria da probabilidade Conceitos básicos de teoria da probabilidade Experimento Aleatório: procedimento que, ao ser repetido sob as mesmas condições, pode fornecer resultados diferentes Exemplos:. Resultado no lançamento de

Leia mais

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Dois ou mais eventos são mutuamente exclusivos, ou disjuntos, se os mesmos não podem ocorrer simultaneamente. Isto é, a ocorrência de um

Leia mais

Aula 00 Aula Demonstrativa

Aula 00 Aula Demonstrativa Aula 00 Modelos de questões comentadas CESPE-UnB... 3 Relação das questões comentadas... 12 Gabaritos... 13 1 Olá, pessoal. Como vocês já sabem, saiu o edital para o concurso do TCE-SC. Esta é a aula demonstrativa

Leia mais

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE.1 INTRODUÇÃO Admita que, de um lote de 10 peças, 3 das quais são defeituosas, peças são etraídas ao acaso, juntas (ou uma a uma, sem reposição). Estamos

Leia mais

Material Teórico - Módulo Probabilidade Condicional. Probabilidade Condicional - Parte 1. Segundo Ano do Ensino Médio

Material Teórico - Módulo Probabilidade Condicional. Probabilidade Condicional - Parte 1. Segundo Ano do Ensino Médio Material Teórico - Módulo Probabilidade Condicional Probabilidade Condicional - Parte 1 Segundo Ano do Ensino Médio Autor: Prof. Fabrício Siqueira Benevides Revisor: Prof. Antonio Caminha M. Neto 1 Probabilidade

Leia mais

Noções sobre Probabilidade

Noções sobre Probabilidade Noções sobre Probabilidade Introdução Vimos anteriormente como apresentar dados em tabelas e gráficos, e também como calcular medidas que descrevem características específicas destes dados. Mas além de

Leia mais

CAPÍTULO 4 PROBABILIDADE PROBABILIDADE PPGEP Espaço Amostral e Eventos Espaço Amostral e Eventos UFRGS. Probabilidade.

CAPÍTULO 4 PROBABILIDADE PROBABILIDADE PPGEP Espaço Amostral e Eventos Espaço Amostral e Eventos UFRGS. Probabilidade. PROBABILIDADE CAPÍTULO 4 PROBABILIDADE UFRGS A Teoria das s estuda os fenômenos aleatórios. Fenômeno Aleatório: são os fenômenos cujo resultado não pode ser previsto exatamente. Se o fenômeno se repetir,

Leia mais

Probabilidade. Prof. Paulo Cesar F. de Oliveira, BSc, PhD

Probabilidade. Prof. Paulo Cesar F. de Oliveira, BSc, PhD Prof. Paulo Cesar F. de Oliveira, BSc, PhD 1 Seção 3.1 Conceitos básicos de probabilidade 2 ² Experimento de ² Uma ação, ou tentativa, por meio do qual resultados específicos (i.e. contagens, medições

Leia mais

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade Magnos Martinello Universidade Federal do Espírito Santo - UFES Departamento de Informática DI Laboratório de Pesquisas em Redes Multimidia LPRM Objetivos 1. Definições: Experimento Espaço Amostral Evento

Leia mais

1 Definição Clássica de Probabilidade

1 Definição Clássica de Probabilidade Centro de Ciências e Tecnologia Agroalimentar - Campus Pombal Disciplina: Estatística Básica - 2013 Aula 4 Professor: Carlos Sérgio UNIDADE 2 - Probabilidade: Definições (Notas de aula) 1 Definição Clássica

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

Distribuições Amostrais

Distribuições Amostrais Distribuições Amostrais 1 Da população, com parâmetro, retira-se k amostras de tamanho n e calcula-se a estatística. Estas estatísticas são as estimativas de. As estatísticas, sendo variáveis aleatórias,

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística. Probabilidade

UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística. Probabilidade UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística Probabilidade Disciplina: Cálculo das Probabilidades e Estatística I Prof. Tarciana Liberal Existem muitas situações que envolvem incertezas:

Leia mais

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS CENTRO UNIVERSITÁRIO FRANCISCANO Curso de Administração Disciplina: Estatística I Professora: Stefane L. Gaffuri RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS Sessão 1 Experimentos Aleatórios e

Leia mais

Estatística Empresarial. Fundamentos de Probabilidade

Estatística Empresarial. Fundamentos de Probabilidade Fundamentos de Probabilidade A probabilidade de chuva é de 90% A probabilidade de eu sair é de 5% Conceitos Básicos Conceitos Básicos 1. Experiência Aleatória (E) Processo de obtenção de uma observação

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA Aula 2 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade condicional 3. Eventos Dependentes e Independentes 4. Regra da Multiplicação

Leia mais

Probabilidade - aula II

Probabilidade - aula II 25 de Março de 2014 Interpretações de Probabilidade Amostras Aleatórias e Objetivos Ao final deste capítulo você deve ser capaz de: Calcular probabilidades de eventos conjuntos. Interpretar e calcular

Leia mais

Variáveis Aleatórias Discretas e Distribuição de Probabilidade

Variáveis Aleatórias Discretas e Distribuição de Probabilidade Variáveis Aleatórias Discretas e Distribuição de Probabilidades - parte III 08 de Abril de 2014 Distribuição Binomial Negativa Objetivos Ao final deste capítulo você deve ser capaz de: Ententer suposições

Leia mais

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados.

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Probabilidades O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Quando lançamos um dado, os resultados possíveis são sempre um dos elementos

Leia mais

CONTABILOMETRIA. Revisão de Probabilidade e Teorema de Bayes

CONTABILOMETRIA. Revisão de Probabilidade e Teorema de Bayes CONTAILOMETRIA Revisão de robabilidade e Teorema de ayes Os ostulados de robabilidade 1. As probabilidades são números reais positivos maiores que zero e menores que 1; simbolicamente, 0 A 1 para qualquer

Leia mais

Prof.: Joni Fusinato

Prof.: Joni Fusinato Introdução a Teoria da Probabilidade Prof.: Joni Fusinato joni.fusinato@ifsc.edu.br jfusinato@gmail.com Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso

Leia mais

Probabilidade - aula II

Probabilidade - aula II 2012/02 1 Interpretações de Probabilidade 2 3 Amostras Aleatórias e Objetivos Ao final deste capítulo você deve ser capaz de: Calcular probabilidades de eventos conjuntos. Interpretar e calcular probabilidades

Leia mais

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues Unidade III ESTATÍSTICA Prof. Fernando Rodrigues Medidas de dispersão Estudamos na unidade anterior as medidas de tendência central, que fornecem importantes informações sobre uma sequência numérica. Entretanto,

Leia mais

CAPÍTULO 3 PROBABILIDADE

CAPÍTULO 3 PROBABILIDADE CAPÍTULO 3 PROBABILIDADE 1. Conceitos 1.1 Experimento determinístico Um experimento se diz determinístico quando repetido em mesmas condições conduz a resultados idênticos. Exemplo 1: De uma urna que contém

Leia mais

Resolução da Prova MPU Técnico Disciplina: Raciocínio Lógico Professor: Valdenilson Garcia

Resolução da Prova MPU Técnico Disciplina: Raciocínio Lógico Professor: Valdenilson Garcia Resolução da Prova MPU 01 - Técnico Disciplina: Raciocínio Lógico Professor: Valdenilson Garcia e-mail: profvaldenilson@hotmail.com 01 Copyright. Curso Agora eu Passo - Todos os direitos reservados ao

Leia mais

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω.

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω. PROBABILIDADE 1.0 Conceitos Gerais No caso em que os possíveis resultados de um experimento aleatório podem ser listados (caso discreto), um modelo probabilístico pode ser entendido como a listagem desses

Leia mais

Aula 9 Teorema da probabilidade total e teorema de Bayes

Aula 9 Teorema da probabilidade total e teorema de Bayes Aula 9 Teorema da probabilidade total e teorema de Bayes Nesta aula você estudará dois importantes teoremas de probabilidade e verá suas aplicações em diversas situações envolvendo a tomada de decisão.

Leia mais

2 a Lista de PE Solução

2 a Lista de PE Solução Universidade de Brasília Departamento de Estatística 2 a Lista de PE Solução 1. a Ω {(d 1, d 2, m : d 1, d 2 {1,..., 6}, m {C, K}}, onde C coroa e K cara. b Ω {0, 1, 2,...} c Ω {(c 1, c 2, c 3, c 4 : c

Leia mais

Probabilidade ESQUEMA DO CAPÍTULO. UFMG-ICEx-EST Cap. 2- Probabilidade 1

Probabilidade ESQUEMA DO CAPÍTULO. UFMG-ICEx-EST Cap. 2- Probabilidade 1 Probabilidade ESQUEMA DO CAPÍTULO 2.1 ESPAÇOS AMOSTRAIS E EVENTOS 2.2 INTERPRETAÇÕES DE PROBABILIADE 2.3 REGRAS DE ADIÇÃO 2.4 PROBABILIDADE CONDICIONAL 2.5 REGRAS DA MULTIPLICAÇÃO E DA PROBABILIDADE TOTAL

Leia mais

Cap. 4 - Probabilidade

Cap. 4 - Probabilidade Estatística para Cursos de Engenharia e Informática Pedro Alberto Barbetta / Marcelo Menezes Reis / Antonio Cezar Bornia São Paulo: Atlas, 2004 Cap. 4 - Probabilidade APOIO: Fundação de Apoio à Pesquisa

Leia mais

Probabilidade Condicional e Independência

Probabilidade Condicional e Independência Instituto Tecnológico de Aeronáutica Divisão de Engenharia Mecânica-Aeronáutica MOQ-13 Probabilidade e Estatística Profa. Denise Beatriz Ferrari www.mec.ita.br/ denise denise@ita.br 17/08/2011 Probabilidade

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE Prof. Aurimenes A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios.

Leia mais

Uma proposta didático- -pedagógica para o estudo da concepção clássica de probabilidade

Uma proposta didático- -pedagógica para o estudo da concepção clássica de probabilidade Texto complementar Uma proposta didático- -pedagógica para o estudo da concepção clássica de probabilidade José Marcos Lopes MATEMÁTICA 1 Matemática Assunto: Probabilidade Uma proposta didático-pedagógica

Leia mais

Prof. Luiz Alexandre Peternelli

Prof. Luiz Alexandre Peternelli Exercícios propostos 1. Numa prova há 7 questões do tipo verdadeiro-falso ( V ou F ). Calcule a probabilidade de acertarmos todas as 7 questões se: a) Escolhermos aleatoriamente as 7 respostas. b) Escolhermos

Leia mais

Universidade Federal de Lavras

Universidade Federal de Lavras Universidade Federal de Lavras Departamento de Estatística Prof. Daniel Furtado Ferreira 13 a Lista de Exercícios Práticos Conceitos Básicos de Probabilidade 1) Considere um experimento que consiste em

Leia mais

Aprendizado Bayesiano Anteriormente...

Aprendizado Bayesiano Anteriormente... Aprendizado Bayesiano Anteriormente... Conceito de Probabilidade Condicional É a probabilidade de um evento A dada a ocorrência de um evento B Universidade de São Paulo Instituto de Ciências Matemáticas

Leia mais

Introdução à Probabilidade - parte III

Introdução à Probabilidade - parte III Introdução à Probabilidade - parte III Erica Castilho Rodrigues 02 de Outubro de 2012 Eventos Independentes 3 Eventos Independentes Independência Em alguns casos podemos ter que P(A B) = P(A). O conhecimento

Leia mais

Processos Estocásticos. Luiz Affonso Guedes

Processos Estocásticos. Luiz Affonso Guedes Processos Estocásticos Luiz Affonso Guedes Sumário Probabilidade Variáveis Aleatórias Funções de Uma Variável Aleatória Funções de Várias Variáveis Aleatórias Momentos e Estatística Condicional Teorema

Leia mais

O ensino de probababilidade através de um jogo de dados e da metodologia de resolução de problemas

O ensino de probababilidade através de um jogo de dados e da metodologia de resolução de problemas V Bienal da SBM Sociedade Brasileira de Matemática UFPB - Universidade Federal da Paraíba 18 a 22 de outubro de 2010 O ensino de probababilidade através de um jogo de dados e da metodologia de resolução

Leia mais

Probabilidades- Teoria Elementar

Probabilidades- Teoria Elementar Probabilidades- Teoria Elementar Experiência Aleatória Experiência aleatória é uma experiência em que: não se sabe exactamente o resultado que se virá a observar, mas conhece-se o universo dos resultados

Leia mais

Probabilidade Condicional (grupo 2)

Probabilidade Condicional (grupo 2) page 39 Capítulo 5 Probabilidade Condicional (grupo 2) Veremos a seguir exemplos de situações onde a probabilidade de um evento émodificadapelainformação de que um outro evento ocorreu, levando-nos a definir

Leia mais

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti PROBABILIDADE Dizemos que a probabilidade é uma medida da quantidade de incerteza que existe em um determinado experimento.

Leia mais

3. A probabilidade do evento de números pares. 4. O evento formado por número menor que três. 5. A probabilidade do evento número menor que três.

3. A probabilidade do evento de números pares. 4. O evento formado por número menor que três. 5. A probabilidade do evento número menor que três. 1 a Lista de Exercício - Estatística (Probabilidade) Profa. Ms. Ulcilea A. Severino Leal Algumas considerações importantes sobre a resolução dos exercícios. (i) Normas da língua culta, sequência lógica

Leia mais

CE Estatística I

CE Estatística I CE 002 - Estatística I Agronomia - Turma B Professor Walmes Marques Zeviani Laboratório de Estatística e Geoinformação Departamento de Estatística Universidade Federal do Paraná 1º semestre de 2012 Zeviani,

Leia mais

PROBABILIDADE CONTEÚDOS

PROBABILIDADE CONTEÚDOS PROBABILIDADE CONTEÚDOS Experimentos aleatórios Eventos Probabilidade Probabilidade de união de dois eventos Probabilidade de eventos independentes Probabilidade condicional AMPLIANDO SEUS CONHECIMENTOS

Leia mais

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S.

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S. PROBABILIDADE A história da teoria das probabilidades, teve início com os jogos de cartas, dados e de roleta. Esse é o motivo da grande existência de exemplos de jogos de azar no estudo da probabilidade.

Leia mais

Prova Resolvida Raciocínio Lógico Quantitativo e Estatística (ANAC/2016) Prof. Guilherme Neves

Prova Resolvida Raciocínio Lógico Quantitativo e Estatística (ANAC/2016) Prof. Guilherme Neves Prova Resolvida Raciocínio Lógico Quantitativo e Estatística (ANAC/2016) 31- (ANAC 2016/ESAF) A negação da proposição se choveu, então o voo vai atrasar pode ser logicamente descrita por a) não choveu

Leia mais

Introdução à Inferência Estatística

Introdução à Inferência Estatística Introdução à Inferência Estatística Capítulo 10, Estatística Básica (Bussab&Morettin, 7a Edição) 2a AULA 02/03/2015 MAE229 - Ano letivo 2015 Lígia Henriques-Rodrigues 2a aula (02/03/2015) MAE229 1 / 16

Leia mais

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e):

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Adição de probabilidades O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Dois eventos A e B são ditos mutuamente exclusivos se, e somente se, A B

Leia mais

Carlos Pedreira.

Carlos Pedreira. Bio-Estatística Carlos Pedreira pedreira@ufrj.br CAPÍTULO 1 Conceitos Básicos de Probabilidade Em qual resultado você apostaria em 1 jogada de uma moeda justa? porque? Agora vamos jogar a moeda 2 vezes,

Leia mais

Para iniciar o conceito do que é probabilidade condicional, vamos considerar o seguinte problema.

Para iniciar o conceito do que é probabilidade condicional, vamos considerar o seguinte problema. PROBABILIDADE CONDICIONAL E DISTRIBUIÇÃO BINOMINAL 1. PROBABILIDADE CONDICIONAL Para iniciar o conceito do que é probabilidade condicional, vamos considerar o seguinte problema. Suponha que um redator

Leia mais

MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos Propostas de resolução

MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos Propostas de resolução MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos Propostas de resolução Exercícios de exames e testes intermédios 1. Como P (B) = 1 P ( B ) = P (B) P (A B) vem que P (B) = 1 0,7

Leia mais

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos:

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos: Eisencraft e Loiola 2.1 Probabilidade 37 Modelo matemático de experimentos Para resolver problemas de probabilidades são necessários 3 passos: a Estabelecimento do espaço das amostras b Definição dos eventos

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

1.4.2 Probabilidade condicional

1.4.2 Probabilidade condicional M. Eisencraft 1.4 Probabilidades condicionais e conjuntas 9 Portanto, P(A B) = P(A)+P(B) P(A B) (1.2) Para eventos mutuamente exclusivos, P(A B) = e P(A)+P(B) = P(A B). 1.4.2 Probabilidade condicional

Leia mais

Probabilidade e Estatística Preparação para P1

Probabilidade e Estatística Preparação para P1 robabilidade e Estatística reparação para rof.: Duarte ) Uma TV que valia R$ 00,00, entrou em promoção e sofreu uma redução de 0% em seu preço. Qual é o novo preço da TV? ) Um produto foi vendido por R$

Leia mais

Unidade IV ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade IV ESTATÍSTICA. Prof. Fernando Rodrigues Unidade IV ESTATÍSTICA Prof. Fernando Rodrigues Análise combinatória Analise combinatória é a área da Matemática que trata dos problemas de contagem. Ela é utilizada para contarmos o número de eventos

Leia mais

Problemas do 2º grau

Problemas do 2º grau A UUL AL A 6 6 Problemas do º grau Nas Aulas 4 e 5, tratamos de resoluções de equações do º grau. Nesta aula, vamos resolver problemas que dependem dessas equações. Observe que o significado das incógnitas

Leia mais

2. Probabilidade. Aula 3

2. Probabilidade. Aula 3 Aula 3 2. Probabilidade 2-1 Espaços de amostragem e eventos 2-1.1 Experimentos randômicos 2-1.2 Espaços de amostragem 2-1.3 Eventos 2-2 Interpretações de probabilidade 2-2.1 Introdução 2-2.2 Axiomas de

Leia mais

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto Estatística Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas Professor Fernando Porto Lançam-se 3 moedas. Seja X o número de ocorrências da face cara. O espaço amostral do experimento é: W = {(c,c,c),(c,c,r),(c,r,c),(c,r,r),(r,c,c),(r,c,r),(r,r,c),(r,r,r)}

Leia mais

Estatística para Cursos de Engenharia e Informática

Estatística para Cursos de Engenharia e Informática Estatística para Cursos de Engenharia e Informática BARBETTA, Pedro Alberto REIS, Marcelo Menezes BORNIA, Antonio Cezar MUDANÇAS E CORREÇOES DA ª EDIÇÃO p. 03, após expressão 4.9: P( A B) = P( B A) p.

Leia mais

EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais

EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais EST029 Cálculo de Probabilidade I Cap. 4: Variáveis Aleatórias Unidimensionais Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Introdução Considere o experimento: Lançamento de uma moeda. Resultados

Leia mais

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico.

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico. Tipos de Modelo Sistema Real Determinístico Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.mat.ufrgs.br/~viali/ Probabilístico Modelo determinístico Exemplos Gravitação F GM 1 M 2 /r 2 Causas Efeito

Leia mais

BANCO DE QUESTÕES TURMA PM-PE PROBABILIDADE

BANCO DE QUESTÕES TURMA PM-PE PROBABILIDADE 01. (UNICAMP 016) Uma moeda balanceada é lançada quatro vezes, obtendo-se cara exatamente três vezes. A probabilidade de que as caras tenham saído consecutivamente é igual a A) 1. B). 8 C) 1. D). 0. (UNESP

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

Termo-Estatística (2013) 2ª Aula. Prof. Alvaro Vannucci

Termo-Estatística (2013) 2ª Aula. Prof. Alvaro Vannucci Termo-Estatística (2013) 2ª Aula Prof. Alvaro Vannucci Na Mecânica Estatística, será muito útil a utilização dos conceitos básicos de Análise Combinatória e Probabilidade. Por ex., uma garota vai sair

Leia mais

Processamento digital de imagens

Processamento digital de imagens Processamento digital de imagens Agostinho Brito Departamento de Engenharia da Computação e Automação Universidade Federal do Rio Grande do Norte 27 de maio de 2016 Reconhecimento de objetos Padrão: arranjo

Leia mais

tomando o cuidado de notar que de fato: Analogamente: De forma que:

tomando o cuidado de notar que de fato: Analogamente: De forma que: tomando o cuidado de notar que Teoria Quântica de Campos I 51 de fato: Analogamente: De forma que: ( eq. 51.1 ) Esta separação entre a teoria livre e a parte interagente exige um cuidado adicional. Anteriormente

Leia mais

Sequências Generalizando um pouco, podemos então dizer que sequências de elementos são grupos com elementos obedecendo a determinada ordem. Obteremos uma sequência diferente quando se altera a ordem. No

Leia mais

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução.

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução. Parte 2 Introdução à Teoria da Probabilidade Ramiro Brito Willmersdorf ramiro@willmersdorf.net Departamento de Engenharia Mecânica Universidade Federal de Pernambuco 2011.2 Resumo 1 Introdução 2 Espaço

Leia mais

Métodos Quantitativos

Métodos Quantitativos Métodos Quantitativos Unidade 3 Estatística inferencial parte I Prof. Me. Diego Fernandes 1 Sumário Seção Slides 3.1 Noções de probabilidade 03 21 3.2 Distribuição dos estimadores 22 41 3.3 e 3.4 - Testes

Leia mais

Problemas do 2º grau

Problemas do 2º grau A UUL AL A 6 6 Problemas do º grau Nas Aulas 4 e 5, tratamos de resoluções de equações do º grau. Nesta aula, vamos resolver problemas que dependem dessas equações. Observe que o significado das incógnitas

Leia mais