CAPÍTULO 4 PROBABILIDADE PROBABILIDADE PPGEP Espaço Amostral e Eventos Espaço Amostral e Eventos UFRGS. Probabilidade.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "CAPÍTULO 4 PROBABILIDADE PROBABILIDADE PPGEP Espaço Amostral e Eventos Espaço Amostral e Eventos UFRGS. Probabilidade."

Transcrição

1 PROBABILIDADE CAPÍTULO 4 PROBABILIDADE UFRGS A Teoria das s estuda os fenômenos aleatórios. Fenômeno Aleatório: são os fenômenos cujo resultado não pode ser previsto exatamente. Se o fenômeno se repetir, sob condições similares, o resultado não será sempre o mesmo. Experimento Aleatório: Qualquer fenômeno aleatório que possa ser executado pelo homem Espaço Amostral e Eventos 4.1. Espaço Amostral e Eventos Os resultados de um experimento aleatório podem ser representados em um espaço amostral ao qual chamaremos de S. O espaço S pode ser uni ou k-dimensional, discreto ou contínuo, finito ou infinito. A figura a seguir apresenta um espaço bidimensional onde aparecem os eventos A e B. Como pode ser visto, os eventos A e B estão completamente contidos em S e apresentam interseção, ou seja, a sua ocorrência simultânea é possível. Evento: É um conjunto de resultados possíveis do experimento. É um subconjunto de S. Exemplo: Em uma linha de produção, peças são fabricadas em série. Conte o nº de peças defeituosas em cada 200 peças produzidas. S = {0, 1, 2,..., 200}; Eventos: A: ocorrer 10 peças defeituosas. A = {10}; B: ocorrer entre 10 e 15 peças defeituosas. B = {10, 11, 12, 13, 14, 15}; 3 4

2 4.2. Operações com Eventos 4.3. Definição de Usando o símbolo para união e o símbolo para interseção, podemos definir os eventos C e D: C = A B conjunto de valores que pertence a A ou B ou a ambos; D = A B conjunto de valores que pertence simultaneamente a A e B; Usaremos o símbolo para representar o conjunto vazio, e uma barra sobre a letra, por exemplo A, para representar o complemento de A, isto é, o conjunto de pontos que não pertence a A. Um experimento será chamado aleatório se puder ser repetido um grande número de vezes sob condições similares e se o resultado de uma observação não pode ser exatamente previsto. Uma variável será chamada aleatória se descreve os resultados de um experimento aleatório Definição de 4.3. Definição de Para um evento E em S, podemos definir a existência de uma função P tal que P represente a probabilidade que x pertença a E. Isto é: P(E = Pr (x E Alternativamente, pode ser enunciado: Para um evento E em S, podemos definir a existência de uma função P tal que P represente a probabilidade de ocorrência de E. Isto é: P(E = Pr(ocorrência do evento E Essa função P deve satisfazer algumas propriedades: 1 0 P(E 1 2 Se E 1 e E 2 são tais que E 1 =, tem-se que E 2 = + P(E 2 3 A probabilidade de ocorrência de um ponto qualquer do espaço amostral S deve ser igual a 1: P(S=1 Essas propriedades são importantes para derivar várias regras de cálculo de probabilidades. 7 8

3 4.3 Definição de 4.4. Soma de s Para determinar a probabilidade de um evento, usaremos o ponto de vista das freqüências relativas: P(E = m(e / m(s onde m(e e m(s representam as medidas de E e S. Eventos mutuamente exclusivos E 1 =. Para eventos mutuamente exclusivos, a soma das probabilidades é dada pela generalização da propriedade 2. E 2... E k = Σ P(E i Se os eventos E 1 e E 2 não são mutuamente exclusivos, mas são independentes, pode-se demonstrar que: E 2 = + P(E Soma de s 4.4. Soma de s Para o caso de três eventos, a generalização anterior é Exemplo: Um digestor químico é alimentado por material que vem de dois tanques independentes. E 2 E 3 = + P(E 2 + P(E 3 - [ + + E 3 + P(E 2 E 3 ] + E 3 O material do tanque 1 pode ser uma concentração de ácido que varia uniformemente entre 4 e 8, enquanto que o material do tanque 2 pode apresentar uma concentração de base entre 5 e 10. Sejam os seguintes eventos: A: material do tanque 1 com conc. superior a 6 B: material do tanque 2 com conc. inferior a

4 4.4. Soma de s 4.4. Soma de s P(A = m(a / m(s P(A = 10 / 20 = 0,5 P(A = 1 - P(A = 0,5 Exemplo: Considerando os dados do exemplo anterior, e sabendo que o processo apresenta problemas quando a concentração de ácido supera a concentração de base, calcule a probabilidade disso acontecer. P(B = 4 / 20 = 0,20 P(B = 1 - P(B = 0,80 P(A B = 2/20 = 0,10 P(A B = P(A + P(B - P(A B = 0,50 + 0,20-0,10 = 0,60 Solução: = m(e 1 / m(s = [(3x3/2] / 20 = 0, Produto de s 4.5. Produto de s A probabilidade de um evento A foi definida como a medida do conjunto A dividida pela medida de S. Poderíamos, então, escrever P(A/S para indicar de forma explícita que a probabilidade de A está referida a todo o espaço amostral S. Assim: P(A = P(A/S = m(a / m(s Algumas vezes, no entanto, estaremos interessados em calcular a probabilidade de um evento E 1 referida a um sub-espaço de S, por exemplo, ao espaço definido por E 2 : /E 2 = m (E 1 / m(e 2 Dividindo-se numerador e denominador por m(s: /E 2 = [m (E 1 / m(s] / [m(e 2 / m(s] /E 2 = / P(E 2 Essa expressão define a probabilidade de E 1 dado E 2 ou referida a E 2. A partir dessa expressão, obtém-se: = /E 2. P(E 2 (eq

5 4.5. Produto de s 4.5. Produto de s Da mesma forma, poderíamos escrever: P(E 2 /E 1 = / e então obter: Exemplo: Para o exemplo do digestor químico calcule a probabilidade da concentração de ácido superar a concentração de base quando sabe-se que a concentração de ácido é superior a 6,0. = P(E 2 /E 1. (eq. 3 As expressões (2 e (3 são análogas e definem a probabilidade do produto, ou seja, da ocorrência simultânea de E 1 e E 2. Para três eventos tem-se: E 3 =. P(E 2 /E 1. P(E 3 /E 1 ou expressões equivalentes usando P(E 2 ou P(E 3. Solução: O que se pede é a dado A. Essa probabilidade é: m(e A/m(S 4/20 P(E /A 1 = = m(a/m(s 10/20 1 = 0, Eventos Independentes 4.6. Eventos Independentes Dois eventos, E 1 e E 2 são ditos independentes se: /E 2 = nesse caso, Exemplo: Um construtor se submete a licitação para duas obras independentes, A e B. Baseado na experiência, os engenheiros estimam que a probabilidade de ganhar a obra A é 0,25; e a probabilidade de ganhar a obra B é 0,33. Pede-se: =. P(E 2 Para k eventos independentes, tem-se:... E k = Σ P(E i a Estimar a probabilidade de ganhar ao menos uma das duas obras: P(A B = P(A + P(B - P(A B = = 0,25 + 0,33 - (0,25. 0,33 = 0,

6 4.6. Eventos Independentes 4.6. Eventos Independentes b Estimar a probabilidade de ganhar a obra A, sabendo-se que o construtor irá ganhar ao menos uma obra: P(A (A B 0,25 P(A/A B = = = 0,50 P(A B 0,50 Note que P(A (A B é obviamente o mesmo que A, já que A está completamente contido em (A B. c Se o construtor submete-se a outra licitação para uma obra C, com probabilidade de ganhar igual a 0,25, qual a probabilidade de ganhar ao menos uma obra? P(A B C = 0,25 + 0,33 + 0,25 - (0,25. 0,33 + 0,25. 0,25 + 0,33. 0,25 + (0,25. 0,33. 0,25 = 0,625 Note que para o caso de eventos independentes vale também: P(A B C = 1 - P( A B C = 1 - (0,75. 0,67. 0,75 = 0, Total 4.7. Total Seja que no campo amostral S exista um evento B que consiste de k componentes mutuamente exclusivos: B = B 1 B 2... B k ; B i B j = E dado que no campo do evento B exista um outro evento A que pode ou não ocorrer simultaneamente com todos os componentes de B. Nesse caso, podemos escrever: A = (A B 1 (A B 2... (A B k Isso quer dizer que o evento A está descrito em forma total pelos componentes B 1...B k do evento B, os quais são mutuamente exclusivos. Então usando-se (1 e (2 tem-se: 23 24

7 4.7. Total 4.7. Total P(A = P(A B P(A B k Exemplo P(A = P(B 1. P(A/B P(B k. P(A/B k P(A = Σ P(B i. P(A/B i Na construção de um edifício usa-se 1000 Kg de material por dia; desse total, 600 Kg são adquiridos do fornecedor B 1 e 400 Kg do fornecedor B 2. Assim B = B 1 B 2, onde B é a provisão de 1000 Kg/dia O material pode ser defeituoso e por experiência prévia sabe-se que B 1 e B 2 têm as probabilidades de 0,03 e 0,01, respectivamente, de serem defeituosos Total Chamando A o evento material defeituoso tem-se: A = (A B 1 (A B 2 Isto é, se o material é defeituoso, pode vir de B 1 ou B 2. Então A pode ser calculado a partir de: P(B 1 = 0,6; P(B 2 = 0,4 P(A/B 1 = 0,03; P(A/B 2 = 0,01 P(A = P(B 1.P(A/B 1 + P(B 2.P(A/B 2 P(A = (0,6.(0,03 + (0,4.(0,001 = 0, ,004 = 0,022 Assim a probabilidade total de que o material seja defeituoso, vindo de B 1 ou B 2, é igual a 0,022. O Teorema de Bayes permite calcular a probabilidade posterior de um evento B j, P(B j /A, baseada em nova informação referente ao evento A e conhecendo-se a probabilidade anterior B j, P(B j. Usando o conceito de probabilidade condicional, temse: P(B j /A = P(B j A / P(A Como A está descrito em termos de B 1,...,B k, tem-se o Teorema de Bayes: P(B j /A = P(B j A / Σ P(B j. P(A/B j P(B j /A = P(B j. P(A/B j / [ Σ P(B j. P(A/B j ] 27 28

8 Nota-se que o Teorema de Bayes determina a probabilidade posterior de um evento B j, em função de um evento A e da probabilidade anterior de B j. Exemplo: A medição da espessura é feita usando um aparelho ultra-sônico, cuja confiabilidade é de 80%, ou seja, há uma probabilidade de 80% que a conclusão baseada neste aparelho seja correta. Uma seção de pavimento de concreto é aceita se sua espessura for superior a 7,5 cm. A experiência prévia indica que 90% das seções construídas são aceitas. Pede-se: a Qual a probabilidade que a seção esteja bem construída e seja aceita na inspeção? Solução: Seja A: seção bem construída, isto é, e > 7,5 cm. P(A =? Seja B: O aparelho indica que a seção está bem construída, ou seja, indica que e > 7,5 cm. P(B=0,90 c A probabilidade que a seção seja aceita quando se sabe que a seção está bem construída. Essa probabilidade pode ser estimada usando o Teorema de Bayes. O que se pede é a P(B/A. Ainda, P(A/B = 0,80 Assim, o que se pede é a P(A B: P(A B = P(B. P(A/B = (0,90. (0,80 = 0,72 b A probabilidade que a seção não esteja bem construída e seja aceita: P(A B = P(B.P(A / B = (0,90.(0,20 = 0,18 Como somente podemos dizer que a seção está bem construída baseado nas medições temos: A = (B A (B A Assim, P(A = P(B. P(A / B + P(B. P(A / B P(A = (0,90. (0,80 + (0,10. (0,20 = 0,74 P(B. P(A / B P(B / A = (0,90. (0,80 P(A = 0,74 =0,

9 Como se vê, a probabilidade anterior P(B = 0,90 é agora modificada para P(B/A = 0,973 depois de se saber o evento: a seção está bem construída Dois eventos são ditos mutuamente exclusivos se eles não tem elementos em comum, ou seja, se eles não podem ocorrer simultaneamente. E um grupo de eventos é dito coletivamente exaustivo se eles esgotam todos os resultados possíveis para o experimento em questão. Dê um exemplo de eventos mutuamente exclusivos e coletivamente exaustivo Qual a probabilidade de adivinhar o dia da semana em que nasceu Pedro Alvarez Cabral? Que suposição você fez para calcular essa probabilidade? Seja P(A= 0,30 e P(B=0,80 e P(A B=0,15. Pedese: a A e B são mutuamente exclusivos? b Determine P(B c Determine P(A B 4.4. Sejam A e B mutuamente excludentes, P(A=0,52 e P(B=0,27. Pede-se: a A e B são coletivamente exaustivos? b Determine P(A B c Determine P(A B 4.5. As falhas de diferentes equipamentos são independentes uma das outras. Se há três equipamentos e as suas respectivas probabilidades de falha em um determinado dia são 1%, 2% e 5%, indique: a a probabilidade de todos os equipamentos falharem em um mesmo dia b de nenhum falhar 4.6. Uma fábrica de azulejos tem um processo de inspeção em 3 etapas. A probabilidade de um lote defeituoso passar sem ser detectado em uma dessas etapas é de aproximadamente 25%. Com base nessa informação, calcule a probabilidade de um lote defeituoso passar sem ser detectado por todas as 3 etapas

10 4.7. Há 99% de probabilidade de uma máquina fabricar uma peça sem defeitos. Supondo que a fabricação de peças sucessivas constitua eventos independentes, calcule as seguintes probabilidades: 4.9. Repita o exercício 4.8 para o caso em que o inspetor tivesse examinado a matriz e verificado que ela era defeituosa. a de duas peças em seqüência serem defeituosas b de dez peças em seqüência sem defeitos 4.8. Três máquinas A, B e C fabricam matrizes para estamparia. O histórico dessas máquinas revela que elas produzem respectivamente 1%, 2% e 3% de defeituosos. Um inspetor examina uma matriz e verifica que ela está perfeita. Sabendo que cada máquina é responsável por 1/3 da produção total, calcule a probabilidade de ela ser produzida por cada uma das máquinas Repita o exercício 4.8 para o caso em que as máquinas A, B e C fossem responsáveis, respectivamente, pelos seguintes percentuais da produção total: 20%, 40% e 40% Uma cidade tem 30 mil habitantes e três jornais X, Y, Z. Uma pesquisa de opinião revela que: 12 mil lêem X, 8 mil Y, 7 mil X e Y, 6 mil Z, lêem X e Z, mil Y e Z e 500 lêem X,Y e Z. Qual a probabilidade de que um habitante leia: Uma empresa exploradora de petróleo perfura um poço quando acha que há pelo menos 25% de chance de encontrar petróleo. Ela perfura 4 poços, aos quais são atribuídas probabilidades de 0,3 ; 0,4 ; 0,7 e 0,8. a pelo menos um jornal b só um jornal c ler o jornal X sabendo que ele lê o jornal Z a Determine a probabilidade de nenhum poço produzir petróleo, com base nas estimativas da empresa. b Determine a probabilidade de os quatro poços produzirem petróleo. c Qual a probabilidade de só os poços com probabilidades 0,3 e 0,7 produzirem petróleo? 39 40

11 4.13. Os arquivos da polícia revelam que, das vítimas de acidente automobilístico que utilizam cinto de segurança, apenas 10% sofrem ferimentos graves, enquanto que a incidência é de 50% entre as vítimas que não utilizam cinto de segurança. Estima-se que em 60% a porcentagem dos motoristas que usam o cinto. A polícia acaba de ser chamada para investigar um acidente em que houve um indivíduo gravemente ferido. Calcule a probabilidade de ele estar usando o cinto no momento do acidente. A pessoa que dirigia o outro carro não sofreu ferimentos graves. Calcule a probabilidade dela estar usando o cinto no momento do acidente. 41

Probabilidade ENG /2. Prof. Alexandre Pedott ENG Estatística para Engenharia

Probabilidade ENG /2. Prof. Alexandre Pedott ENG Estatística para Engenharia Probabilidade ENG09004 2014/2 Prof. Alexandre Pedott pedott@producao.ufrgs.br Alguns anos atrás, um homem ganhou na loteria nacional espanhola com um bilhete que terminava com o numero 48. Orgulhoso por

Leia mais

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω.

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω. PROBABILIDADE 1.0 Conceitos Gerais No caso em que os possíveis resultados de um experimento aleatório podem ser listados (caso discreto), um modelo probabilístico pode ser entendido como a listagem desses

Leia mais

Probabilidade ESQUEMA DO CAPÍTULO. UFMG-ICEx-EST Cap. 2- Probabilidade 1

Probabilidade ESQUEMA DO CAPÍTULO. UFMG-ICEx-EST Cap. 2- Probabilidade 1 Probabilidade ESQUEMA DO CAPÍTULO 2.1 ESPAÇOS AMOSTRAIS E EVENTOS 2.2 INTERPRETAÇÕES DE PROBABILIADE 2.3 REGRAS DE ADIÇÃO 2.4 PROBABILIDADE CONDICIONAL 2.5 REGRAS DA MULTIPLICAÇÃO E DA PROBABILIDADE TOTAL

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades 08/06/07 Universidade Federal do Pará Instituto de Tecnologia Estatística Aplicada I Prof. Dr. Jorge Teófilo de Barros Lopes Campus de Belém Curso de Engenharia Mecânica Universidade Federal do Pará Instituto

Leia mais

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Def.: Um experimento é dito aleatório quando o seu resultado não for previsível antes de sua realização, ou seja,

Leia mais

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES PROBABILIDADE E ESTATÍSTICA PROBABILIDADES Bruno Baierle Maurício Furigo Prof.ª Sheila Regina Oro (orientadora) Edital 06/2013 - Produção de Recursos Educacionais Digitais Revisando - Análise combinatória

Leia mais

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA PROBABILIDADES PROBABILIDADE E ESTATÍSTICA PROBABILIDADES Bruno Baierle Maurício Furigo Prof.ª Sheila Regina Oro (orientadora) Edital 06/2013 - Produção de Recursos Educacionais Digitais Revisando - Análise combinatória

Leia mais

1 Definição Clássica de Probabilidade

1 Definição Clássica de Probabilidade Centro de Ciências e Tecnologia Agroalimentar - Campus Pombal Disciplina: Estatística Básica - 2013 Aula 4 Professor: Carlos Sérgio UNIDADE 2 - Probabilidade: Definições (Notas de aula) 1 Definição Clássica

Leia mais

Cap. 4 - Probabilidade

Cap. 4 - Probabilidade Estatística para Cursos de Engenharia e Informática Pedro Alberto Barbetta / Marcelo Menezes Reis / Antonio Cezar Bornia São Paulo: Atlas, 2004 Cap. 4 - Probabilidade APOIO: Fundação de Apoio à Pesquisa

Leia mais

Teoria da Probabilidade

Teoria da Probabilidade Teoria da Probabilidade Luis Henrique Assumpção Lolis 14 de fevereiro de 2014 Luis Henrique Assumpção Lolis Teoria da Probabilidade 1 Conteúdo 1 O Experimento Aleatório 2 Espaço de amostras 3 Álgebra dos

Leia mais

Probabilidade - aula II

Probabilidade - aula II 2012/02 1 Interpretações de Probabilidade 2 3 Amostras Aleatórias e Objetivos Ao final deste capítulo você deve ser capaz de: Calcular probabilidades de eventos conjuntos. Interpretar e calcular probabilidades

Leia mais

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL.

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL. Estatística Aplicada Administração p(a) = n(a) / n(u) PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL Prof. Carlos Alberto Stechhahn 2014 1. Noções de Probabilidade Chama-se experimento

Leia mais

Probabilidade - aula III

Probabilidade - aula III 2012/02 1 Regra da Multiplicação 2 3 4 5 Objetivos Ao final deste capítulo você deve ser capaz de: Usar a regra da multiplicação para calcular probabilidade de eventos Usar a. Regra da Multiplicação Frequentemente

Leia mais

Probabilidade - aula II

Probabilidade - aula II 25 de Março de 2014 Interpretações de Probabilidade Amostras Aleatórias e Objetivos Ao final deste capítulo você deve ser capaz de: Calcular probabilidades de eventos conjuntos. Interpretar e calcular

Leia mais

Probabilidade Aula 03

Probabilidade Aula 03 0303200 Probabilidade Aula 03 Magno T. M. Silva Escola Politécnica da USP Março de 2017 Sumário Teorema de Bayes 2.5 Independência Teorema de Bayes Sejam A 1,,A k uma partição de S (eventos disjuntos)

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 7 - Probabilidade condicional e independência Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Probabilidade condicional Seja (Ω, A, P) um espaço de probabilidade. Se

Leia mais

Prof.Letícia Garcia Polac. 26 de setembro de 2017

Prof.Letícia Garcia Polac. 26 de setembro de 2017 Bioestatística Prof.Letícia Garcia Polac Universidade Federal de Uberlândia UFU-MG 26 de setembro de 2017 Sumário 1 2 Probabilidade Condicional e Independência Introdução Neste capítulo serão abordados

Leia mais

Conceitos básicos de teoria da probabilidade

Conceitos básicos de teoria da probabilidade Conceitos básicos de teoria da probabilidade Experimento Aleatório: procedimento que, ao ser repetido sob as mesmas condições, pode fornecer resultados diferentes Exemplos:. Resultado no lançamento de

Leia mais

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://paginapessoal.utfpr.edu.br/ngsilva Probabilidade Probabilidade Experimento Aleatório Um experimento é dito aleatório quando satisfaz

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

UAlg esght PROBABILIDADE EXERCÍCIOS. Paulo Batista Basílio ( )

UAlg esght PROBABILIDADE EXERCÍCIOS. Paulo Batista Basílio ( ) UAlg esght PROBABILIDADE EXERCÍCIOS ( pbasilio@ualg.pt ) Dezembro 2014 Probabilidade - Exercícios 1 1. Extrai-se, ao acaso, uma bola de uma caixa que contém 6 bolas vermelhas, 4 bolas brancas e 5 bolas

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Espaço Amostral, Eventos, Álgebra de eventos Aula de hoje Probabilidade Análise Combinatória Independência Probabilidade Experimentos

Leia mais

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti PROBABILIDADE Dizemos que a probabilidade é uma medida da quantidade de incerteza que existe em um determinado experimento.

Leia mais

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência Prof. Clécio da Silva Ferreira Depto Estatística - UFJF 1 Perguntas 1. Um novo aparelho para detectar um certo tipo de

Leia mais

CAPÍTULO 5: VARIÁVEIS ALEATÓRIAS BIDIMENSIONAIS Todas as coisas aparecem e desaparecem por causa da concorrência de causas e condições. Nada nunca existe inteiramente só, tudo está em relação com todo

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

Processos Estocásticos. Luiz Affonso Guedes

Processos Estocásticos. Luiz Affonso Guedes Processos Estocásticos Luiz Affonso Guedes Sumário Probabilidade Variáveis Aleatórias Funções de Uma Variável Aleatória Funções de Várias Variáveis Aleatórias Momentos e Estatística Condicional Teorema

Leia mais

Probabilidade Condicional. Prof.: Ademilson

Probabilidade Condicional. Prof.: Ademilson Probabilidade Condicional Prof.: Ademilson Operações com eventos Apresentam-se abaixo algumas propriedades decorrentes de complementação, união e interseção de eventos, úteis no estudo de probabilidade.

Leia mais

Definição: É uma coleção bem definida de

Definição: É uma coleção bem definida de EST029 Cálculo de Probabilidade I Cap. 1: Introdução à Probabilidade Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Conjuntos: Definição e notação Definição: É uma coleção bem definida de objetos,

Leia mais

Probabilidade. Professora Ana Hermínia Andrade. Universidade Federal do Amazonas Faculdade de Estudos Sociais Departamento de Economia e Análise

Probabilidade. Professora Ana Hermínia Andrade. Universidade Federal do Amazonas Faculdade de Estudos Sociais Departamento de Economia e Análise Probabilidade Professora Ana Hermínia Andrade Universidade Federal do Amazonas Faculdade de Estudos Sociais Departamento de Economia e Análise Período 2016.2 Você reconhece algum desses experimentos? Alguns

Leia mais

Lista 2: Probabilidade Condicional

Lista 2: Probabilidade Condicional Probabilidade Lista 2: Probabilidade Condicional 1) Em uma competição de aeromodelismo, vence o participante que conseguir pousar mais vezes seu aeroplano na área especificada. Esta área consiste em um

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística. Probabilidade

UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística. Probabilidade UNIVERSIDADE FEDERAL DA PARAÍBA Departamento de Estatística Probabilidade Disciplina: Cálculo das Probabilidades e Estatística I Prof. Tarciana Liberal Existem muitas situações que envolvem incertezas:

Leia mais

Modelos de Probabilidade e Inferência Estatística

Modelos de Probabilidade e Inferência Estatística Modelos de Probabilidade e Inferência Estatística Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 03/14 1 / 48 É provável que você

Leia mais

CE Estatística I

CE Estatística I CE 002 - Estatística I Agronomia - Turma B Professor Walmes Marques Zeviani Laboratório de Estatística e Geoinformação Departamento de Estatística Universidade Federal do Paraná 1º semestre de 2012 Zeviani,

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

2 Conceitos Básicos de Probabilidade

2 Conceitos Básicos de Probabilidade CE003 1 1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento de técnicas estatísticas

Leia mais

3 NOÇÕES DE PROBABILIDADE

3 NOÇÕES DE PROBABILIDADE 3 NOÇÕES DE PROILIDDE 3.1 Conjuntos Um conjunto pode ser considerado como uma coleção de objetos chamados elementos do conjunto. Em geral denota-se conjunto por letras maiúsculas,, C,... e a sua representação

Leia mais

Probabilidade e Estatística 2008/2. Regras de adicão, probabilidade condicional, multiplicação e probabilidade total.

Probabilidade e Estatística 2008/2. Regras de adicão, probabilidade condicional, multiplicação e probabilidade total. Probabilidade e Estatística 2008/2 Prof. Fernando Deeke Sasse Problemas Resolvidos Regras de adicão, probabilidade condicional, multiplicação e probabilidade total. 1. Um fabricante de lâmpadas para faróis

Leia mais

Capítulo4- Modelos de probabilidade.

Capítulo4- Modelos de probabilidade. Capítulo4- Modelos de probabilidade. 1- Modelos de probabilidade(110) 1.1) Introdução.(110) 1.) Fenómenos aleatórios(11) Experiência determinística-produz sempre o mesmo resultado desde que seja repetido

Leia mais

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução.

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução. Parte 2 Introdução à Teoria da Probabilidade Ramiro Brito Willmersdorf ramiro@willmersdorf.net Departamento de Engenharia Mecânica Universidade Federal de Pernambuco 2011.2 Resumo 1 Introdução 2 Espaço

Leia mais

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade Magnos Martinello Universidade Federal do Espírito Santo - UFES Departamento de Informática DI Laboratório de Pesquisas em Redes Multimidia LPRM Objetivos 1. Definições: Experimento Espaço Amostral Evento

Leia mais

Definição de Probabilidade

Definição de Probabilidade INTRODUÇÃO A TEORIA DAS PROBABILIDADES A teoria das probabilidade nada mais é do que o bom senso transformado em cálculo A probabilidade é uma medida da incerteza dos fenômenos. Traduz-se por um número

Leia mais

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17)

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17) Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 016/17) 1- Modelos de probabilidade(136) 1.1) Introdução.(36) (Vídeo: 33) 1.) Fenómenos aleatórios(138) Experiência determinística-produz

Leia mais

Prof.: Joni Fusinato

Prof.: Joni Fusinato Introdução a Teoria da Probabilidade Prof.: Joni Fusinato joni.fusinato@ifsc.edu.br jfusinato@gmail.com Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso

Leia mais

Probabilidade e Estatística. Estimação de Parâmetros Intervalo de Confiança

Probabilidade e Estatística. Estimação de Parâmetros Intervalo de Confiança Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://páginapessoal.utfpr.edu.br/ngsilva Estimação de Parâmetros Intervalo de Confiança Introdução A inferência estatística é o processo

Leia mais

Probabilidade e Modelos Probabilísticos. Conceitos básicos, variáveis aleatórias

Probabilidade e Modelos Probabilísticos. Conceitos básicos, variáveis aleatórias robabilidade e Modelos robabilísticos Conceitos básicos, variáveis aleatórias 1 Incerteza e robabilidade Tomar decisões: Curso mais provável de ação: Se desejamos passear de barco e não sabemos nadar,

Leia mais

Probabilidade e Estatística Probabilidade Condicional

Probabilidade e Estatística Probabilidade Condicional Introdução Probabilidade e Estatística Probabilidade Condicional Em algumas situações, a probabilidade de ocorrência de um certo evento pode ser afetada se tivermos alguma informação sobre a ocorrência

Leia mais

DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS DISTRIBUIÇÕES CONJUNTAS ROTEIRO DISTRIBUIÇÃO CONJUNTA

DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS DISTRIBUIÇÕES CONJUNTAS ROTEIRO DISTRIBUIÇÃO CONJUNTA ROTEIRO DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS 1. Distribuições conjuntas 2. Independência 3. Confiabilidade 4. Combinações lineares de variáveis aleatórias 5. Referências DISTRIBUIÇÃO CONJUNTA Em muitos

Leia mais

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS CENTRO UNIVERSITÁRIO FRANCISCANO Curso de Administração Disciplina: Estatística I Professora: Stefane L. Gaffuri RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS Sessão 1 Experimentos Aleatórios e

Leia mais

TEORIA DAS PROBABILIDADES

TEORIA DAS PROBABILIDADES TEORIA DAS PROBABILIDADES 1.1 Introdução Ao estudarmos um fenômeno coletivo, verificamos a necessidade de descrever o próprio fenômeno e o modelo matemático associado ao mesmo, que permita explicá-lo da

Leia mais

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico.

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico. Tipos de Modelo Sistema Real Determinístico Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.mat.ufrgs.br/~viali/ Probabilístico Modelo determinístico Exemplos Gravitação F GM 1 M 2 /r 2 Causas Efeito

Leia mais

Sumário. 2 Índice Remissivo 12

Sumário. 2 Índice Remissivo 12 i Sumário 1 Definições Básicas 1 1.1 Fundamentos de Probabilidade............................. 1 1.2 Noções de Probabilidade................................ 3 1.3 Espaços Amostrais Finitos...............................

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA

UNIVERSIDADE FEDERAL DA PARAÍBA UNIVERSIDADE FEDERAL DA PARAÍBA Probabilidade Departamento de Estatística UFPB Luiz Medeiros Introdução Encontramos na natureza dois tipos de fenômenos Determinísticos: Os resultados são sempre os mesmos

Leia mais

Amostragem e distribuições por amostragem

Amostragem e distribuições por amostragem Amostragem e distribuições por amostragem Carla Henriques e Nuno Bastos Departamento de Matemática Escola Superior de Tecnologia de Viseu Contabilidade e Administração População, amostra e inferência estatística

Leia mais

Experimento Aleatório

Experimento Aleatório Probabilidades 1 Experimento Aleatório Experimento aleatório (E) é o processo pelo qual uma observação é ob;da. Exemplos: ü E 1 : Jogar uma moeda 3 vezes e observar o número de caras ob;das; ü E 2 : Lançar

Leia mais

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA Aula 2 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade condicional 3. Eventos Dependentes e Independentes 4. Regra da Multiplicação

Leia mais

Amostragem Aleatória e Descrição de Dados - parte I

Amostragem Aleatória e Descrição de Dados - parte I Amostragem Aleatória e Descrição de Dados - parte I 2012/02 1 Amostra e População 2 3 4 Objetivos Ao final deste capítulo você deve ser capaz de: Calcular e interpretar as seguintes medidas de uma amostra:

Leia mais

ESTATÍSTICA EXPLORATÓRIA

ESTATÍSTICA EXPLORATÓRIA ESTATÍSTICA EXPLORATÓRIA Prof Paulo Renato A. Firmino praf62@gmail.com Aulas 07-08 Probabilidade Apanhado Geral Seguimos nossas discussões sobre a Incerteza Decidir usualmente envolve incerteza Uma presa

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Experiência aleatória Observação de uma acção cujos resultados não são conhecidos a priori (conhecendo-se no entanto quais as possibilidades) Características: Possibilidade de repetição da experiência

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Exemplos de aplicação de probabilidade e estatística Informações do curso Aula de hoje Espaço amostral Álgebra de Eventos Eventos

Leia mais

Estatística Empresarial. Fundamentos de Probabilidade

Estatística Empresarial. Fundamentos de Probabilidade Fundamentos de Probabilidade A probabilidade de chuva é de 90% A probabilidade de eu sair é de 5% Conceitos Básicos Conceitos Básicos 1. Experiência Aleatória (E) Processo de obtenção de uma observação

Leia mais

NOÇÕES DE PROBABILIDADE

NOÇÕES DE PROBABILIDADE NOÇÕES DE PROBABILIDADE ALEATORIEDADE Menino ou Menina me? CARA OU COROA? 3 Qual será o rendimento da Caderneta de Poupança no final deste ano? E qual será a taxa de inflação acumulada em 014? Quem será

Leia mais

PROBABILIDADE. Aula 2 Probabilidade Básica. Fernando Arbache

PROBABILIDADE. Aula 2 Probabilidade Básica. Fernando Arbache PROBABILIDADE Aula 2 Probabilidade Básica Fernando Arbache Probabilidade Medida da incerteza associada aos resultados do experimento aleatório Deve fornecer a informação de quão verossímil é a ocorrência

Leia mais

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE.1 INTRODUÇÃO Admita que, de um lote de 10 peças, 3 das quais são defeituosas, peças são etraídas ao acaso, juntas (ou uma a uma, sem reposição). Estamos

Leia mais

Unidade II ESTATÍSTICA APLICADA. Prof. Luiz Felix

Unidade II ESTATÍSTICA APLICADA. Prof. Luiz Felix Unidade II ESTATÍSTICA APLICADA Prof. Luiz Felix Distribuição de frequências - média Cálculo da Média x = X i. f i n Onde: x média aritmética da distribuição de frequência X i ponto médio de cada classe

Leia mais

Introdução à Probabilidade - parte III

Introdução à Probabilidade - parte III Introdução à Probabilidade - parte III Erica Castilho Rodrigues 02 de Outubro de 2012 Eventos Independentes 3 Eventos Independentes Independência Em alguns casos podemos ter que P(A B) = P(A). O conhecimento

Leia mais

Processos Estocásticos

Processos Estocásticos Processos Estocásticos Primeira Lista de Exercícios de junho de 0 Quantos códigos de quatro letras podem ser construídos usando-se as letras a, b, c, d, e, f se: a nenhuma letra puder ser repetida? b qualquer

Leia mais

Experiências Aleatórias. Espaço de Resultados. Acontecimentos

Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiência Aleatória É uma experiência em que: não se sabe exactamente o resultado que se virá a observar; conhece-se o universo dos resultados

Leia mais

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013 Métodos Quantitativos para Ciência da Computação Experimental Jussara Almeida DCC-UFMG 2013 Revisão de Probabilidade e Estatística Concentrado em estatística aplicada Estatística apropriada para medições

Leia mais

Momentos: Esperança e Variância. Introdução

Momentos: Esperança e Variância. Introdução Momentos: Esperança e Variância. Introdução Em uma relação determinística pode-se ter a seguinte relação: " + " = 0 Assim, m =, é a declividade e a e b são parâmetros. Sabendo os valores dos parâmetros

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

Estatística Aplicada. Árvore de Decisão. Prof. Carlos Alberto Stechhahn PARTE II. Administração. p(a/b) = n(a B)/ n(b)

Estatística Aplicada. Árvore de Decisão. Prof. Carlos Alberto Stechhahn PARTE II. Administração. p(a/b) = n(a B)/ n(b) Estatística Aplicada Administração p(a/b) = n(a B)/ n(b) PARTE II Árvore de Decisão Prof. Carlos Alberto Stechhahn 2014 1. Probabilidade Condicional - Aplicações Considere que desejamos calcular a probabilidade

Leia mais

Noções de Probabilidade

Noções de Probabilidade Noções de Probabilidade Joel M. Corrêa da Rosa 2011 A estatística descritiva é ferramenta indispensável para extrair informação em um conjunto de dados. Entretanto, a tomada de decisões está fortemente

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos Processos Estocásticos Luiz ffonso Guedes Sumário Probabilidade Variáveis leatórias Funções de Uma Variável leatória Funções de Várias Variáveis leatórias Momentos e Estatística Condicional Teorema do

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba Probabilidade I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 08/16 1 / 56 Introdução É provável que você ganhe um aumento....

Leia mais

Espaços Amostrais Finitos

Espaços Amostrais Finitos 2 ESQUEMA DO CAPÍTULO Espaços Amostrais Finitos 1.1 ESPAÇO AMOSTRAL FINITO 1.2 RESULTADOS IGUALMENTE VEROSSÍMEIS 1.3 MÉTODOS DE ENUMERAÇÃO UFMG-ICEx-EST-032/045 Cap. 2 - Espaços Amostrais Finitos 1 2.1

Leia mais

Introdução aos Proc. Estocásticos - ENG 430

Introdução aos Proc. Estocásticos - ENG 430 Introdução aos Proc. Estocásticos - ENG 430 Fabrício Simões IFBA 16 de novembro de 2015 Fabrício Simões (IFBA) Introdução aos Proc. Estocásticos - ENG 430 16 de novembro de 2015 1 / 34 1 Motivação 2 Conceitos

Leia mais

T o e r o ia a da P oba ba i b lida d de

T o e r o ia a da P oba ba i b lida d de Teoria da Probabilidade Prof. Joni Fusinato Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso cotidiano. Usa o princípio básico do aprendizado humano que

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aula passada Motivação Exemplos de aplicação de probabilidade e estatística Informações do curso Aula de hoje Espaço amostral Álgebra de Eventos Eventos Mutuamente

Leia mais

47 = 1349 (ou multiplicando por 100 para converter para porcentagem: 3,5%).

47 = 1349 (ou multiplicando por 100 para converter para porcentagem: 3,5%). Probabilidade Elementar Probabilidade e Estatística I Antonio Roque Aula 9 Fundamentos A tabela a seguir apresenta freqüências associadas a classes de níveis de colesterol no soro de uma amostra de homens

Leia mais

1 Definição de Probabilidade 2 Principais Teoremas 3 Probabilidades dos Espaços Amostrais 4 Espaços Amostrais Equiprováveis. Francisco Cysneiros

1 Definição de Probabilidade 2 Principais Teoremas 3 Probabilidades dos Espaços Amostrais 4 Espaços Amostrais Equiprováveis. Francisco Cysneiros Probabilidade 1 Definição de Probabilidade 2 Principais Teoremas 3 Probabilidades dos Espaços Amostrais 4 Espaços Amostrais Equiprováveis Francisco Cysneiros Introdução 1 - Conceito Clássico Se uma experiência

Leia mais

Matemática & Raciocínio Lógico

Matemática & Raciocínio Lógico Matemática & Raciocínio Lógico para concursos Prof. Me. Jamur Silveira www.professorjamur.com.br facebook: Professor Jamur PROBABILIDADE No estudo das probabilidades estamos interessados em estudar o experimento

Leia mais

2. Probabilidade. Aula 3

2. Probabilidade. Aula 3 Aula 3 2. Probabilidade 2-1 Espaços de amostragem e eventos 2-1.1 Experimentos randômicos 2-1.2 Espaços de amostragem 2-1.3 Eventos 2-2 Interpretações de probabilidade 2-2.1 Introdução 2-2.2 Axiomas de

Leia mais

Departamento de InformáAca - PUC- Rio. Hélio Lopes Departamento de InformáAca PUC- Rio. Probabilidade

Departamento de InformáAca - PUC- Rio. Hélio Lopes Departamento de InformáAca PUC- Rio. Probabilidade Introdução à Simulação Estocás5ca usando R INF2035 PUC- Rio, 2013.1 Departamento de InformáAca - PUC- Rio Hélio Lopes Departamento de InformáAca PUC- Rio Experimentos aleatórios: no estudo de probabilidade,

Leia mais

REGRAS DE PROBABILIDADE

REGRAS DE PROBABILIDADE REGRAS DE PROBABILIDADE Lucas Santana da Cunha lscunha@uel.br http://www.uel.br/pessoal/lscunha/ Universidade Estadual de Londrina 24 de maio de 2017 Propriedades As probabilidades sempre se referem a

Leia mais

EXPERIMENTO I MEDIDAS E ERROS

EXPERIMENTO I MEDIDAS E ERROS EXPERIMENTO I MEDIDAS E ERROS Introdução Na leitura de uma medida física deve-se registrar apenas os algarismos significativos, ou seja, todos aqueles que a escala do instrumento permite ler mais um único

Leia mais

Probabilidade e Estatística

Probabilidade e Estatística Plano de Curso Probabilidade e Estatística UAEst/CCT/UFCG Ementa Fenômeno aleatório versus fenômeno determinístico. Espaço amostral e eventos. Introdução à teoria das probabilidades. Abordagem axiomática

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

Universidade Federal de Lavras

Universidade Federal de Lavras Universidade Federal de Lavras Departamento de Estatística Prof. Daniel Furtado Ferreira 13 a Lista de Exercícios Práticos Conceitos Básicos de Probabilidade 1) Considere um experimento que consiste em

Leia mais

DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS DISTRIBUIÇÕES CONJUNTAS ROTEIRO DISTRIBUIÇÃO CONJUNTA. Estatística Aplicada à Engenharia

DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS DISTRIBUIÇÕES CONJUNTAS ROTEIRO DISTRIBUIÇÃO CONJUNTA. Estatística Aplicada à Engenharia ROTEIRO DISTRIBUIÇÕES DE PROBABILIDADE CONJUNTAS 1. Distribuições conjuntas 2. Independência 3. Confiabilidade 4. Combinações lineares de variáveis aleatórias 5. Referências Estatística Aplicada à Engenharia

Leia mais

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves PROBABILIDADE ENEM 2016 Prof. Marcela Naves PROBABILIDADE NO ENEM As questões de probabilidade no Enem podem cobrar conceitos relacionados com probabilidade condicional e probabilidade de eventos simultâneos.

Leia mais

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES 1- Ordene os dados indicando o 1º, 2º e 3º quartil 45, 56, 62, 67, 48, 51, 64, 71, 66, 52, 44, 58, 55, 61, 48, 50, 62, 51, 61, 55 2- Faça a análise da

Leia mais

Métodos Quantitativos

Métodos Quantitativos Métodos Quantitativos Unidade 3 Estatística inferencial parte I Prof. Me. Diego Fernandes 1 Sumário Seção Slides 3.1 Noções de probabilidade 03 21 3.2 Distribuição dos estimadores 22 41 3.3 e 3.4 - Testes

Leia mais

CAPÍTULO 3 PROBABILIDADE

CAPÍTULO 3 PROBABILIDADE CAPÍTULO 3 PROBABILIDADE 1. Conceitos 1.1 Experimento determinístico Um experimento se diz determinístico quando repetido em mesmas condições conduz a resultados idênticos. Exemplo 1: De uma urna que contém

Leia mais

2 a Lista de PE Solução

2 a Lista de PE Solução Universidade de Brasília Departamento de Estatística 2 a Lista de PE Solução 1. a Ω {(d 1, d 2, m : d 1, d 2 {1,..., 6}, m {C, K}}, onde C coroa e K cara. b Ω {0, 1, 2,...} c Ω {(c 1, c 2, c 3, c 4 : c

Leia mais

DISCIPLINA: MATEMÁTICA BÁSICA PROF. ELIONARDO ROCHELLY TEC. ALIMENTOS TEC. SISTEMAS INTERNET MATUTINO/VESPERTINO

DISCIPLINA: MATEMÁTICA BÁSICA PROF. ELIONARDO ROCHELLY TEC. ALIMENTOS TEC. SISTEMAS INTERNET MATUTINO/VESPERTINO DISCIPLINA: MATEMÁTICA BÁSICA PROF. ELIONARDO ROCHELLY TEC. ALIMENTOS TEC. SISTEMAS INTERNET MATUTINO/VESPERTINO Conjuntos A noção de conjunto em Matemática é praticamente a mesma utilizada na linguagem

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais