Noções sobre Probabilidade

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Noções sobre Probabilidade"

Transcrição

1 Noções sobre Probabilidade Introdução Vimos anteriormente como apresentar dados em tabelas e gráficos, e também como calcular medidas que descrevem características específicas destes dados. Mas além de apresentar dados e realizar determinados cálculos em cima desses dados, também é interessante poder fazer algum tipo de inferência. Imagine que um pesquisador anotou a idade e a pressão arterial de seus pacientes. Com esses dados, ele pode montar tabelas e gráficos, realizar as medidas desejadas como médias e desvios padrões, além de traçar a reta que dá a variação da pressão arterial em função da idade. Mas este pesquisador também gostaria de estender suas conclusões a outros pacientes, além daqueles que examinou. Então, este pesquisador gostaria de fazer inferência. Para fazer inferência estatística usam-se técnicas que exigem o conhecimento de probabilidade, embora, consciente ou inconscientemente, a probabilidade é usada por qualquer indivíduo que toma decisão em situações de incerteza. A utilização das probabilidades indica a existência de um elemento de acaso, ou de incerteza, quanto à ocorrência ou não de um evento. Por exemplo, se lançarmos uma moeda para o ar, de modo geral não podemos afirmar se vai dar cara ou coroa. A probabilidade nos indicará uma medida de quão provável é a ocorrência de determinado evento. São várias situações em que é desejável se ter uma medida (avaliação numérica) de quão provável é a ocorrência de determinado evento futuro: lançamento de um produto, evolução de uma doença, fazer uma previsão do número de internações em um período, chover amanhã à tarde etc. Experiência aleatória Considere uma experiência onde os resultados sejam imprevisíveis e mutuamente exclusivos, ou seja, em cada repetição dessa experiência é impossível prever, com absoluta certeza, qual o resultado que será obtido; além disso, a ocorrência de um deles exclui a ocorrência dos demais. Como exemplo, imagine o lançamento de um dado. Os resultados possíveis são: 1, 2, 3, 4, 5, 6. Você não pode prever qual o valor que sairá na próxima E Nemer 1 / 15

2 jogada do dado. Outro ponto importante é que a ocorrência de um valor exclui a ocorrência dos demais pois é impossível você tirar dois valores em uma única jogada do dado. Chama-se a uma experiência desse tipo de experiência aleatória, e seus resultados, que são mutuamente exclusivos, são chamados eventos simples. Espaço Amostral O conjunto de todos os eventos simples (resultados mutuamente exclusivos) de uma experiência aleatória é chamado de espaço amostral S. Como exemplo de espaços amostrais, temos: o lançamento de um dado: S {1,2,3,4,5,6} o lançamento de uma moeda: S {c, k}, onde ccara e kcoroa Medidas de Probabilidades Na definição clássica de probabilidade, tomamos um espaço amostral finito S {a 1,a 2,a 3...,a n }, no qual os pontos amostrais a i (i1,2,..., n) podem ter a mesma probabilidade de ocorrer, ou seja, são considerados equiprováveis. Então, todo subconjunto A do espaço amostral diz-se um evento, sendo sua probabilidade dada por: m P ( n número de casos favoráveis ao evento A ou seja, a probabilidade de um evento é definida como o quociente do número m de casos que lhe são favoráveis, pelo número n de resultados possíveis. Por exemplo, se um dado é não viciado, espera-se que as várias faces sejam equiprováveis, ou seja, que qualquer das faces do dado tenha a mesma probabilidade de sair quanto às outras. Assim, temos que a probabilidade de sair o número 5 em um lançamento de dado, ou seja 5), é calculada da seguinte forma: o Número de casos favoráveis ao evento 5 1 (pois só existe uma face do dado com o número 5); o Número de casos possíveis 6 (pois existem seis números que podem sair visto que o dado tem seis faces: 1,2,3,4,5 ou 6). Esses seis eventos são mutuamente exclusivos porque duas E Nemer 2 / 15

3 faces não podem ocorrer ao mesmo tempo. Se o dado for honesto, os seis eventos são igualmente prováveis. o Logo, temos que: m número de casos favoráveis ao evento 5 1 P ( 5) 16,67 % n 6 Como um outro exemplo, qual seria a probabilidade de sair número ímpar? Neste caso, temos que: o Número de casos favoráveis ao evento número ímpar 3 (pois existem três faces do dado com número ímpar: 1, 3 e 5); o Número de casos possíveis 6 (pois existem seis números que podem sair visto que o dado tem seis faces: 1,2,3,4,5 ou 6). Esses seis eventos são mutuamente exclusivos porque duas faces não podem ocorrer ao mesmo tempo. Se o dado for honesto, os seis eventos são igualmente prováveis. o Logo, temos que: m número de casos favoráveis ao evento número ímpar 3 1 5) 50 % n 6 2 Considere mais um exemplo. Uma carta será retirada ao acaso de um baralho. Qual é a probabilidade de sair um ás? Ora, um baralho tem 52 cartas, das quais quatro são ases. Neste caso, temos que: o Número de casos favoráveis ao evento tirar ás 4 (pois existem quatro ases em um baralho); o Número de casos possíveis 52 (pois um baralho contém 52 cartas). Esses seis eventos são mutuamente exclusivos porque dois ases não podem ocorrer ao mesmo tempo. Os 52 eventos são igualmente prováveis. o Logo, temos que: m número de casos favoráveis ao evento tirar ás 4 1 ás) 7,69 % n E Nemer 3 / 15

4 Regras básicas da probabilidade i. Campo de variação das probabilidades A probabilidade de um evento A deve ser um número maior ou igual a 0 (zero), porém menor ou igual a 1. Isto é: 0 P ( 1 ou 0 % P ( 100 % Se é certo ocorrer determinado evento, a probabilidade desse evento é 1, ou 100%; se é impossível ocorrer determinado evento, a probabilidade desse evento é zero. Por exemplo, a probabilidade de ocorrer número menor do que 8 no lançamento de um dado é 1, ou 100% (evento certo pois todos os números de um dado são menores do que 8). Já a probabilidade de ocorrer um número maior do que 8 é zero (evento impossível). ii. Probabilidade do espaço amostral A probabilidade do espaço amostral S é igual a 1. Isto é: P ( S) 1 ou P ( S) 100 % iii. Regra da adição de probabilidades A probabilidade de ocorrência do evento A, ou do evento B (ou de ambos) é igual a: A + A E Nemer 4 / 15

5 Caso os eventos A e B sejam mutuamente exclusivos, isto é: A B, então: P ( A + Essa regra pode ser estendida para n eventos mutuamente exclusivos: A 1, A 2, A 3,..., A n. Assim: P A A K A ) A ) + A ) + K+ A ) ( 1 2 n 1 2 n Fica mais fácil entender o teorema da soma com a ajuda de exemplos. Suponha, então, que uma urna contém duas bolas brancas, uma azul e uma vermelha. Retira-se uma bola da urna ao acaso. Qual a probabilidade de ter saído bola colorida, isto é, azul ou vermelha? Ora, a probabilidade de sair bola azul é: número de casos favoráveis ao evento bola azul 1 P ( azul) 0,25 ou 25 % 4 E a probabilidade de sair bola vermelha é: número de casos favoráveis ao evento bola vermelha 1 P ( vermelha) 0,25 ou 25 % 4 Então, a probabilidade de sair bola colorida, isto é, azul ou vermelha, é dada pela soma: 1 1 P ( azul ou vermelha) azul) + vermelha) + 0,5 ou 50 % 4 4 Imagine, agora, que uma carta será retirada ao acaso de um baralho. Qual é a probabilidade de sair uma carta de espadas ou um ás? Como um baralho tem 52 cartas, das quais 13 são de espadas e quatro são ases, alguém poderia pensar que a probabilidade de sair uma carta de espadas ou um ás é dada pela soma 13 P ( espadas ou ás) E Nemer 5 / 15

6 Mas esta resposta estaria errada, porque existe uma carta, o ás de espadas, que é tanto ás como espadas. Então, o ás de espadas teria sido contado duas vezes. A probabilidade de sair uma carta de espadas ou um ás de espadas é dada por: espadas ás) espadas) + ás) espadas ás) + 30,77 % Recapitulando, agora fica mais fácil entender o teorema da soma. Se os eventos A e B não podem ocorrer ao mesmo tempo, a probabilidade de ocorrer A ou B é dada pela probabilidade de A, mais a probabilidade de B. Logo, escreve-se que: P ( A + Se A e B podem ocorrer ao mesmo tempo, a probabilidade de ocorrer A ou B é dada pela probabilidade de A, mais a probabilidade de B, menos a probabilidade de A e B. Escreve-se: A + A iv. Probabilidade de um evento complementar Se Ā é o evento complementar de A, então: 1 Como exemplo, considere retirar uma carta qualquer exceto copas de um baralho de 52 cartas. A probabilidade de se retirar uma carta qualquer do baralho é dada por: número de casos favoráveis ao evento carta qualquer 52 P ( carta qualquer) 1 ou 100 % 52 obs: nesse caso, o evento A é igual a S, assim: S)1 A probabilidade de se retirar uma carta de copas do baralho é dada por: E Nemer 6 / 15

7 número de casos favoráveis ao evento carta de copas P ( copas) Se A {carta de copas}, então Ā {qualquer carta exceto copas}. Logo, temos que: 1 qualquer carta exceto copas) 1 carta de copas) Logo, temos que: P ( qualquer carta exceto copas) 1 0,75 ou 75% Multiplicando probabilidades e independência estatística Dois eventos estão estatisticamente independentes se a ocorrência de um deles não afetar a ocorrência do outro. Assim, no lançamento de uma moeda por duas vezes, a probabilidade de obter uma cara, ou coroa, no segundo lance, não é afetada pelo resultado do primeiro lance. No caso do lançamento de duas moedas, existem quatro possibilidades, isto é: S {cc, ck, kc, kk}, onde c cara e kcoroa. Cada resultado é igualmente provável e a qualquer um pode ser atribuída a probabilidade de ¼. A probabilidade de obter uma seqüência particular de sucessos, por exemplo, duas caras, pode ser calculada como o produto das probabilidades associadas com os acontecimentos em cada lance, separadamente, assim: 1 1 P ( CC) C) C) Logo, dados dois eventos independentes, A e B, a probabilidade da ocorrência conjunta é definida pela regra de multiplicação: P ( A. A Essa regra é válida para n eventos independentes: A1, A2, A3,..., Na, desde que as condições para a multiplicação de probabilidades sejam satisfeitas para todas as combinações de dois ou mais eventos, isto é, E Nemer 7 / 15

8 desde que todas as combinações sejam constituídas por eventos independentes. P A. A. K A ) A A K A ) A ) A ) K A ) ( 1 2 n 1 2 n 1 2 n Como um exemplo, imagine uma experiência que consiste em lançar, simultaneamente, um dado e duas moedas. Qual é a probabilidade de obter um cinco e duas coroas em uma única jogada? Como os eventos são, evidentemente, independentes, a probabilidade procurada é: P ( 5KK) 5 K K) 5) K) K) 0,0416 ou 4,16 % i. Probabilidade condicionada Se a condição de independência estatística não for satisfeita, deve ser usada uma fórmula mais geral, envolvendo probabilidades condicionadas. Denomina-se probabilidade condicional à probabilidade de ocorrer determinado evento sob uma dada condição. Dados dois eventos, A e B, a probabilidade de que o evento B ocorra, dado que o evento A já ocorreu, é a probabilidade condicionada de B, escrita por B/. Similarmente, escrevemos a probabilidade da ocorrência de A, condicionada à ocorrência de B, como A/ (lê-se probabilidade de A dado que B tenha ocorrido ou probabilidade de A condicionada à ocorrência de. Como exemplo, suponha que existam 10 rótulos de papel que podem ser distinguidos pelo número e pela cor: por exemplo, os rótulos numerados por 1, 2 e 3 são amarelos e os restantes, brancos. Se todos forem colocados um uma urna e retirados ao acaso, a probabilidade de extrair um rótulo particular é 1/10. Se, porém, após retirar um rótulo ao acaso, ele for amarelo, como calcular a probabilidade de que um certo rótulo, por exemplo, aquele com número 1, seja extraído? Evidentemente, o número possível de acontecimentos favoráveis está agora reduzido de 10 para três; em outras palavras, o rótulo desejado deve ter o número 1 e ser amarelo. E Nemer 8 / 15

9 Neste momento, o cálculo da probabilidade condicionada é realizado da seguinte forma: o número de casos favoráveis ao evento : rótulo 1 e amarelo 1/10 rótulo n 1/ amarelo) número de casos favoráveis ao evento : amarelo 3/ De modo geral, dados dois eventos, A e B, que não são independentes, a probabilidade condicionada de A, dado B, é definida como: A / A A ou seja, como a razão entre a probabilidade do evento conjunto A e B ocorrer e a probabilidade da ocorrência de B. Como um outro exemplo, suponha que uma carta é retirada de um baralho. Qual é probabilidade de ser um rei preto, sabendo que a carta retirada foi uma figura (valete, dama ou rei)? Sejam A {rei preto} e B {figura}, e: i) como existem dois reis pretos no baralho, os quais são, também, figuras, logo: 2 P ( A 52 ii) como existem doze figuras em um baralho, temos que: Logo, o resultado é: P ( A A P ( A / 0,1666 ou ,67 % Então, a probabilidade de ocorrer um rei preto condicionada à ocorrência de uma figura é de 1/6 ou aproximadamente 17%. E Nemer 9 / 15

10 Como um outro exemplo, suponha que um dado foi jogado. Qual é probabilidade de ocorrido um 5? Como um dado tem seis faces, a probabilidade de ter ocorrido a face com o número 5 é: número de casos favoráveis ao evento : face 5 1 P ( 5) 0,1667 ou 6 16,67 % Imagine, agora, que o mesmo dado foi jogado e já se sabe que ocorreu face com número ímpar. Qual é a probabilidade de ter ocorrido a face 5? Note que a resposta a esta pergunta é diferente da resposta dada à pergunta anterior. Se saiu face com número ímpar, só podem ter ocorrido os números:1, 3 ou 5. Logo, a probabilidade de ter ocorrido 5 é: Sejam A {face 5} e B {número ímpar}, e: i) como existe somente uma face 5 no dado e que também é número ímpar, logo: 1 P ( A 6 ii) como existem três faces ímpares em um dado, temos que: Logo, o resultado é: P ( A A 6 1 P ( A / 0,3333 ou ,33 % Logo, observe que a probabilidade de ocorrer determinado evento pode ser modificada quando se impõe uma condição. Como mostra o exemplo, a probabilidade de ocorrer 5 no jogo de um dado é 16,67%, mas, sob a condição de ter ocorrido face com número ímpar, a probabilidade de ocorrer 5 é 33,33%. E Nemer 10 / 15

11 Tendo estudado probabilidade condicionada, e para entender melhor a idéia de eventos independentes, imagine que um dado e uma moeda são jogados ao mesmo tempo e se pergunte: a) Qual é a probabilidade de ocorrer cara na moeda? b) Qual é a probabilidade de ocorrer cara na moeda sabendo que ocorreu face 6 no dado? Na tabela abaixo estão os eventos que podem ocorrer quando se jogam um dado e uma moeda ao mesmo tempo. Dado Moeda Cara Coroa 1 Cara;1 Coroa;1 2 Cara;2 Coroa;2 3 Cara;3 Coroa;3 4 Cara;4 Coroa;4 5 Cara;5 Coroa;5 6 Cara;6 Coroa;6 Dos doze eventos possíveis e igualmente prováveis apresentados na tabela acima, seis correspondem à saída de cara na moeda. Então, a probabilidade de sair cara na moeda é: número de casos favoráveis ao evento cara 6 P ( cara) 0,5 ou 50 % 12 Para obter a probabilidade de sair cara na moeda, sabendo que saiu 6 no dado, observe a última linha da tabela anterior. Dos dois eventos que correspondem à saída de 6 no dado, um corresponde à saída de cara na moeda. Então, a probabilidade de sair cara na moeda, sabendo que ocorreu 6 no dado, é: número de casos favoráveis ao evento cara 1 P ( cara) 0,5 ou 50 % 2 Neste exemplo, a probabilidade de ocorrer um evento (sair cara na moeda) não foi modificada pela ocorrência de outro evento (sair 6 no dado). Diz-se, então, que esses eventos são independentes. Por definição, dois eventos são independentes quando a probabilidade de ocorrer um deles não é modificada pela ocorrência do outro. Quando se E Nemer 11 / 15

12 jogam um dado e uma moeda, o resultado que ocorre na moeda não depende do que ocorre no dado. Então, esses eventos são independentes. Na área biológica existem vários exemplos de eventos dependentes e de eventos independentes. Assim, olhos claros e cabelos claros são eventos dependentes porque a probabilidade de uma pessoa ter olhos claros é maior se a pessoa tem cabelos claros. Já olhos claros e idade avançada são eventos independentes, porque a probabilidade de uma pessoa ter olhos claros não aumenta (ou diminui) com a idade. ii. Regra geral da multiplicação de probabilidades A partir da definição de probabilidade condicionada, é possível enunciar a regra geral de multiplicação de probabilidades: a probabilidade da ocorrência simultânea de dois eventos, A e B, do mesmo espaço amostral, é igual ao produto da probabilidade de um deles pela probabilidade condicionada do outro, dado o primeiro. P ( A A B / A / A regra geral da multiplicação, estendida aos eventos A, B e C, é: A B C) B / C / A A probabilidade A B C) pode assumir seis diferentes formas, uma das quais foi dada acima. Uma outra forma é mostrada abaixo. Como exercício, você pode obter as outras quatro formas. A B C) C / B / A C) Como exemplo, imagine uma urna contendo três bolas brancas e oito pretas. Uma bola é retirada ao acaso e não reposta: então outra bola é retirada. Qual e probabilidade de ambas serem pretas? A primeira bola, sendo preta, influi sobre a probabilidade de obter uma segunda bola preta: os dois eventos não são estatisticamente independentes, logo: E Nemer 12 / 15

13 P ( ambas pretas) primeira preta) segunda preta / primeira preta) E temos que: P ( ambas pretas) 0,5090 ou ,9 % Em um outro exemplo, uma moeda e um dado são lançados simultaneamente. Se A for evento sair coroa e B for o evento ocorrer o 3, constatar que os eventos A e B são independentes. Ora, vamos calcular a probabilidade de A dado que B tenha ocorrido. Temos que: 1 A 12 1 P ( A / 0, ou 50 % 12 Se calculássemos somente a probabilidade de A ocorrer, teríamos: número de casos favoráveis ao evento coroa 1 P ( coroa) 0,5 ou 50 % 2 Neste exemplo, a probabilidade de ocorrer um evento (sair caroa na moeda) não foi modificada pela ocorrência de outro evento (sair 3 no dado). Diz-se, então, que esses eventos são independentes. Em outras palavras, como a probabilidade de A é igual à probabilidade de A dado que saiu B, isto significa que a ocorrência de um evento não interfere com o outro e os dois eventos são independentes. Em um outro exemplo, uma moeda será jogada duas vezes. Qual é a probabilidade de ocorrer cara nas duas jogadas? Ora, a probabilidade de ocorrer cara na primeira jogada é: número de casos favoráveis ao evento cara 1 P ( cara) 0,5 ou 50 % 2 A probabilidade de ocorrer cara na segunda jogada também é: número de casos favoráveis ao evento cara 1 P ( cara) 0,5 ou 50 % 2 E Nemer 13 / 15

14 Isto ocorre porque o fato de ocorrer cara na primeira jogada não modifica a probabilidade de ocorrer cara na segunda jogada (os eventos são independentes). E para obter a probabilidade de ocorrer cara nas duas jogadas (primeira e segunda), faz-se o produto: iii. Em resumo Em um exemplo, uma moeda será jogada duas vezes. Qual é a probabilidade de ocorrer cara nas duas jogadas? Ora, a probabilidade de ocorrer cara na primeira jogada é: número de casos favoráveis ao evento cara 1 P ( cara) 0,5 ou 50 % 2 A probabilidade de ocorrer cara na segunda jogada também é: número de casos favoráveis ao evento cara 1 P ( cara) 0,5 ou 50 % 2 Isto ocorre porque o fato de ocorrer cara na primeira jogada não modifica a probabilidade de ocorrer cara na segunda jogada (os eventos são independentes). E para obter a probabilidade de ocorrer cara nas duas jogadas (primeira e segunda), faz-se o produto: P ( KK) K K) K) K) 0,25 ou 25 % Em um outro exemplo, uma urna contém duas bolas brancas e uma vermelha. Retiram-se duas bolas da urna ao acaso, uma em seguida da outra e sem que a primeira tenha sido recolocada. Qual é a probabilidade das duas serem brancas? A probabilidade da primeira bola ser branca é: número de casos favoráveis ao evento bola branca 2 P ( bola branca) 0,6667 ou 66,67 % 3 A probabilidade da segunda bola ser branca vai depender do que ocorreu na primeira retirada. Se saiu bola branca, a probabilidade da segunda também ser branca é: E Nemer 14 / 15

15 número de casos favoráveis ao evento bola branca 1 P ( bola branca) 0,5 ou 50 % 2 Para obter, então, a probabilidade de duas bolas retiradas serem brancas, faz-se o produto: P ( 2 bolas brancas) 0,3333 ou 33,33 % Agora fica fácil entender o teorema do produto. Se A e B são eventos independentes, a probabilidade de ocorrer A e B é dada pela probabilidade de ocorrer A, multiplicada pela probabilidade de ocorrer B. P ( A. A Se A e B não são independentes, a probabilidade de ocorrer A e B é dada pela probabilidade de ocorrer A, multiplicada pela probabilidade (condicional) de ocorrer B, dado que A ocorreu. P ( A A B / A / E Nemer 15 / 15

INTRODUÇÃO À PROBABILIDADE

INTRODUÇÃO À PROBABILIDADE INTRODUÇÃO À PROBABILIDADE Foto extraída em http://www.alea.pt Profª Maria Eliane Universidade Estadual de Santa Cruz USO DE PROBABILIDADES EM SITUAÇÕES DO COTIDIANO Escolhas pessoais Previsão do tempo

Leia mais

Estatística Empresarial. Fundamentos de Probabilidade

Estatística Empresarial. Fundamentos de Probabilidade Fundamentos de Probabilidade A probabilidade de chuva é de 90% A probabilidade de eu sair é de 5% Conceitos Básicos Conceitos Básicos 1. Experiência Aleatória (E) Processo de obtenção de uma observação

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

T o e r o ia a da P oba ba i b lida d de

T o e r o ia a da P oba ba i b lida d de Teoria da Probabilidade Prof. Joni Fusinato Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso cotidiano. Usa o princípio básico do aprendizado humano que

Leia mais

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e):

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Adição de probabilidades O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Dois eventos A e B são ditos mutuamente exclusivos se, e somente se, A B

Leia mais

TEORIA DAS PROBABILIDADES

TEORIA DAS PROBABILIDADES TEORIA DAS PROBABILIDADES 1.1 Introdução Ao estudarmos um fenômeno coletivo, verificamos a necessidade de descrever o próprio fenômeno e o modelo matemático associado ao mesmo, que permita explicá-lo da

Leia mais

Prof. Luiz Alexandre Peternelli

Prof. Luiz Alexandre Peternelli Exercícios propostos 1. Numa prova há 7 questões do tipo verdadeiro-falso ( V ou F ). Calcule a probabilidade de acertarmos todas as 7 questões se: a) Escolhermos aleatoriamente as 7 respostas. b) Escolhermos

Leia mais

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S.

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S. PROBABILIDADE A história da teoria das probabilidades, teve início com os jogos de cartas, dados e de roleta. Esse é o motivo da grande existência de exemplos de jogos de azar no estudo da probabilidade.

Leia mais

Experiências Aleatórias. Espaço de Resultados. Acontecimentos

Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiência Aleatória É uma experiência em que: não se sabe exactamente o resultado que se virá a observar; conhece-se o universo dos resultados

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

Probabilidade. Experiências aleatórias

Probabilidade. Experiências aleatórias Probabilidade Experiências aleatórias 1 Experiências aleatórias Acontecimento: Qualquer colecção de resultados de uma experiência. Acontecimento elementar: Um resultado que não pode ser simplificado ou

Leia mais

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω.

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω. PROBABILIDADE 1.0 Conceitos Gerais No caso em que os possíveis resultados de um experimento aleatório podem ser listados (caso discreto), um modelo probabilístico pode ser entendido como a listagem desses

Leia mais

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1 Será que vai chover amanhã? Quantificando a incerteza Probabilidades Aula 1 Nosso dia-a-dia está cheio de incertezas Vai chover amanhã? Quanto tempo levarei de casa até a universidade? Em quanto tempo

Leia mais

Capítulo 2 Probabilidades

Capítulo 2 Probabilidades Capítulo 2 Probabilidades Slide 1 Definições Slide 2 Acontecimento Qualquer colecção de resultados de uma experiência. Acontecimento elementar Um resultado que não pode ser simplificado ou reduzido. Espaço

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Dois ou mais eventos são mutuamente exclusivos, ou disjuntos, se os mesmos não podem ocorrer simultaneamente. Isto é, a ocorrência de um

Leia mais

Processos Estocásticos

Processos Estocásticos Processos Estocásticos Primeira Lista de Exercícios de junho de 0 Quantos códigos de quatro letras podem ser construídos usando-se as letras a, b, c, d, e, f se: a nenhuma letra puder ser repetida? b qualquer

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

Experiência Aleatória

Experiência Aleatória Probabilidades Experiência Aleatória Experiência aleatória é uma experiência em que: não se sabe exactamente o resultado que se virá a observar, mas conhece-se o universo dos resultados possíveis. Exemplo

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA

UNIVERSIDADE FEDERAL DA PARAÍBA UNIVERSIDADE FEDERAL DA PARAÍBA Probabilidade Departamento de Estatística UFPB Luiz Medeiros Introdução Encontramos na natureza dois tipos de fenômenos Determinísticos: Os resultados são sempre os mesmos

Leia mais

MATEMÁTICA A - 12o Ano Probabilidades - Noções gerais

MATEMÁTICA A - 12o Ano Probabilidades - Noções gerais MATEMÁTICA A - 12o Ano Probabilidades - Noções gerais Exercícios de exames e testes intermédios 1. Considere um dado cúbico, com as faces numeradas de 1 a 6, e um saco que contém cinco bolas, indistinguíveis

Leia mais

1- INTRODUÇÃO 2. CONCEITOS BÁSICOS

1- INTRODUÇÃO 2. CONCEITOS BÁSICOS 1 1- INTRODUÇÃO O termo probabilidade é usado de modo muito amplo na conversação diária para sugerir um certo grau de incerteza sobre o que ocorreu no passado, o que ocorrerá no futuro ou o que está ocorrendo

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova 1 de Probabilidade I Prof.: Fabiano F. T. dos Santos Goiânia, 15 de setembro de 2014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

Probabilidade e Estatística Preparação para P1

Probabilidade e Estatística Preparação para P1 robabilidade e Estatística reparação para rof.: Duarte ) Uma TV que valia R$ 00,00, entrou em promoção e sofreu uma redução de 0% em seu preço. Qual é o novo preço da TV? ) Um produto foi vendido por R$

Leia mais

Se A =, o evento é impossível, por exemplo, obter 7 no lançamento de um dado.

Se A =, o evento é impossível, por exemplo, obter 7 no lançamento de um dado. PROBABILIDADE Espaço amostral Espaço amostral é o conjunto universo U de todos os resultados possíveis de um experimento aleatório. O número de elementos desse conjunto é indicado por n(u). Exemplos: No

Leia mais

Disciplina de Estatística Prof. Msc Quintiliano Siqueira Schroden Nomelini LISTA DE PROBABILIDADES

Disciplina de Estatística Prof. Msc Quintiliano Siqueira Schroden Nomelini LISTA DE PROBABILIDADES Disciplina de Estatística Prof. Msc Quintiliano Siqueira Schroden Nomelini LISTA DE PROBABILIDADES 1) Determine a probabilidade de cada evento: a) Um nº par aparece no lançamento de um dado; b) Uma figura

Leia mais

3. A probabilidade do evento de números pares. 4. O evento formado por número menor que três. 5. A probabilidade do evento número menor que três.

3. A probabilidade do evento de números pares. 4. O evento formado por número menor que três. 5. A probabilidade do evento número menor que três. 1 a Lista de Exercício - Estatística (Probabilidade) Profa. Ms. Ulcilea A. Severino Leal Algumas considerações importantes sobre a resolução dos exercícios. (i) Normas da língua culta, sequência lógica

Leia mais

Coordenadoria de Matemática. Apostila de Probabilidade

Coordenadoria de Matemática. Apostila de Probabilidade Coordenadoria de Matemática Apostila de Probabilidade Vitória ES 1. INTRODUÇÃO CAPÍTULO 03 Quando investigamos algum fenômeno, verificamos a necessidade de descrevê-lo por um modelo matemático que permite

Leia mais

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS CENTRO UNIVERSITÁRIO FRANCISCANO Curso de Administração Disciplina: Estatística I Professora: Stefane L. Gaffuri RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS Sessão 1 Experimentos Aleatórios e

Leia mais

Bem Explicado Centro de Explicações Lda. Matemática 9º Ano Probabilidades

Bem Explicado Centro de Explicações Lda. Matemática 9º Ano Probabilidades Bem Explicado Centro de Explicações Lda. Matemática 9º Ano Probabilidades Nome: Data: / / 1. Das seguintes experiências diz, justificando, quais são as aleatórias: 1.1. Deitar um berlinde num copo de água

Leia mais

MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos

MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos MATEMÁTICA A - 12o Ano Probabilidades - Teoremas e operações com conjuntos Exercícios de exames e testes intermédios 1. Seja Ω, conjunto finito, o espaço de resultados associado a uma certa experiência

Leia mais

Definição de Probabilidade

Definição de Probabilidade INTRODUÇÃO A TEORIA DAS PROBABILIDADES A teoria das probabilidade nada mais é do que o bom senso transformado em cálculo A probabilidade é uma medida da incerteza dos fenômenos. Traduz-se por um número

Leia mais

Abertura Ver ângulo. Abreviar Significa valer-se de métodos que facilitem as operações. Exemplos: 1) = ( ) + 25 = = 125

Abertura Ver ângulo. Abreviar Significa valer-se de métodos que facilitem as operações. Exemplos: 1) = ( ) + 25 = = 125 A Abertura Ver ângulo. Abreviar Significa valer-se de métodos que facilitem as operações. Exemplos: 1) 24 + 25 + 76 = (24 + 76) + 25 = 100 + 25 = 125 2) 192 + 65 = (200 8) + 65 = 200 + 65 8 = 200 + 57

Leia mais

Probabilidade. Definições e Conceitos

Probabilidade. Definições e Conceitos Probabilidade Definições e Conceitos Definições Probabilidade Medida das incertezas relacionadas a um evento chances de ocorrência de um evento Exemplos: Probabilidade de jogar um dado e cair o número

Leia mais

Escola Secundária/2,3 da Sé-Lamego Ficha de Trabalho de Matemática A Ano Lectivo 2011/12 Distribuição de probabilidades 12.º Ano

Escola Secundária/2,3 da Sé-Lamego Ficha de Trabalho de Matemática A Ano Lectivo 2011/12 Distribuição de probabilidades 12.º Ano Escola Secundária/, da Sé-Lamego Ficha de Trabalho de Matemática A Ano Lectivo 0/ Distribuição de probabilidades.º Ano Nome: N.º: Turma:. Numa turma do.º ano, a distribuição dos alunos por idade e sexo

Leia mais

Cap. 4 - Probabilidade

Cap. 4 - Probabilidade Estatística para Cursos de Engenharia e Informática Pedro Alberto Barbetta / Marcelo Menezes Reis / Antonio Cezar Bornia São Paulo: Atlas, 2004 Cap. 4 - Probabilidade APOIO: Fundação de Apoio à Pesquisa

Leia mais

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues Unidade III ESTATÍSTICA Prof. Fernando Rodrigues Medidas de dispersão Estudamos na unidade anterior as medidas de tendência central, que fornecem importantes informações sobre uma sequência numérica. Entretanto,

Leia mais

12.º Ano de Escolaridade

12.º Ano de Escolaridade gabinete de avaliação educacional T E S T E I N T E R M É D I O D E M A T E M Á T I C A 12.º Ano de Escolaridade (Decreto-Lei n.º 286/89, de 29 de Agosto) (Dec.-Lei n.º 286/89, de 29 de Agosto, para alunos

Leia mais

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência Prof. Clécio da Silva Ferreira Depto Estatística - UFJF 1 Perguntas 1. Um novo aparelho para detectar um certo tipo de

Leia mais

Aula - Introdução a Teoria da Probabilidade

Aula - Introdução a Teoria da Probabilidade Introdução a Teoria da Probabilidade Prof. Magnos Martinello Aula - Introdução a Teoria da Probabilidade Universidade Federal do Espírito Santo - UFES Departamento de Informática - DI 5 de dezembro de

Leia mais

PROBABILIDADE PROPRIEDADES E AXIOMAS

PROBABILIDADE PROPRIEDADES E AXIOMAS PROBABILIDADE ESPAÇO AMOSTRAL É o conjunto de todos os possíveis resultados de um experimento aleatório. A este conjunto de elementos denominamos de espaço amostral ou conjunto universo, simbolizado por

Leia mais

O conceito de probabilidade

O conceito de probabilidade A UA UL LA O conceito de probabilidade Introdução Nesta aula daremos início ao estudo da probabilidades. Quando usamos probabilidades? Ouvimos falar desse assunto em situações como: a probabilidade de

Leia mais

PROBABILIDADE. Numero de Resultados Desejado Numero de Resultados Possiveis EXERCÍCIOS DE AULA

PROBABILIDADE. Numero de Resultados Desejado Numero de Resultados Possiveis EXERCÍCIOS DE AULA PROBABILIDADE São duas as questões pertinentes na resolução de um problema envolvendo probabilidades. Primeiro, é preciso quantificar o conjunto de todos os resultados possíveis, que será chamado de espaço

Leia mais

Probabilidade e Estatística

Probabilidade e Estatística Aula 3 Professora: Rosa M. M. Leão Probabilidade e Estatística Conteúdo: 1.1 Por que estudar? 1.2 O que é? 1.3 População e Amostra 1.4 Um exemplo 1.5 Teoria da Probabilidade 1.6 Análise Combinatória 3

Leia mais

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos:

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos: Eisencraft e Loiola 2.1 Probabilidade 37 Modelo matemático de experimentos Para resolver problemas de probabilidades são necessários 3 passos: a Estabelecimento do espaço das amostras b Definição dos eventos

Leia mais

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS INTRODUÇÃO O que é uma variável aleatória? Um tipo de variável que depende do resultado aleatório de um experimento aleatório. Diz-se que um experimento é

Leia mais

DEPARTAMENTO DE MATEMÁTICA

DEPARTAMENTO DE MATEMÁTICA FACULDADE DE CIÊNCIAS NATURAIS E MATEMÁTICA DEPARTAMENTO DE MATEMÁTICA Campus de Lhanguene, Av. de Moçambique, km 1, Tel: +258 21401078, Fax: +258 21401082, Maputo Cursos de Licenciatura em Ensino de Matemática

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova de Probabilidade Prof.: Fabiano F. T. dos Santos Goiânia, 31 de outubro de 014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Probabilidade. Evento (E) é o acontecimento que deve ser analisado.

Probabilidade. Evento (E) é o acontecimento que deve ser analisado. Probabilidade Definição: Probabilidade é uma razão(divisão) entre a quantidade de eventos e a quantidade de amostras. Amostra ou espaço amostral é o conjunto formado por todos os elementos que estão incluídos

Leia mais

BANCO DE QUESTÕES TURMA PM-PE PROBABILIDADE

BANCO DE QUESTÕES TURMA PM-PE PROBABILIDADE 01. (UNICAMP 016) Uma moeda balanceada é lançada quatro vezes, obtendo-se cara exatamente três vezes. A probabilidade de que as caras tenham saído consecutivamente é igual a A) 1. B). 8 C) 1. D). 0. (UNESP

Leia mais

Experiências aleatórias e probabilidade

Experiências aleatórias e probabilidade Experiências aleatórias e probabilidade L.J. Amoreira UBI Novembro 2010 Experiências aleatórias Experiências aleatórias são aquelas cujos resultados não são conhecidos de antemão. Espaço de resultados

Leia mais

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos Processos Estocásticos Luiz ffonso Guedes Sumário Probabilidade Variáveis leatórias Funções de Uma Variável leatória Funções de Várias Variáveis leatórias Momentos e Estatística Condicional Teorema do

Leia mais

1) Calcular a probabilidade de se obter 2 prêmios ao abrirem-se 2 círculos de uma mesa com 25 círculos dos quais 5 são premiados.

1) Calcular a probabilidade de se obter 2 prêmios ao abrirem-se 2 círculos de uma mesa com 25 círculos dos quais 5 são premiados. COLÉGIO SANTA MARIA Matemática I / II - Professor: Flávio Verdugo Ferreira Lista de exercícios: Probabilidades 1) Calcular a probabilidade de se obter 2 prêmios ao abrirem-se 2 círculos de uma mesa com

Leia mais

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos Primeira Lista de Exercícios Introdução à probabilidade e à estatística Prof Patrícia Lusié Assunto: Probabilidade. 1. (Apostila 1 - ex.1.1) Lançam-se três moedas. Enumerar o espaço amostral e os eventos

Leia mais

ESTATÍSTICA I PROBABILIDADE. Aulas 3 e 4 Professor Regina Meyer Branski

ESTATÍSTICA I PROBABILIDADE. Aulas 3 e 4 Professor Regina Meyer Branski ESTATÍSTICA I PROBABILIDADE Aulas 3 e 4 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade Condicional 3. Eventos Dependentes e Independentes 4. Regra da

Leia mais

1.4.2 Probabilidade condicional

1.4.2 Probabilidade condicional M. Eisencraft 1.4 Probabilidades condicionais e conjuntas 9 Portanto, P(A B) = P(A)+P(B) P(A B) (1.2) Para eventos mutuamente exclusivos, P(A B) = e P(A)+P(B) = P(A B). 1.4.2 Probabilidade condicional

Leia mais

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR)

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Fernando de Pol Mayer Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Este conteúdo está disponível por meio da Licença Creative

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

CE Estatística I

CE Estatística I CE 002 - Estatística I Agronomia - Turma B Professor Walmes Marques Zeviani Laboratório de Estatística e Geoinformação Departamento de Estatística Universidade Federal do Paraná 1º semestre de 2012 Zeviani,

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais

ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO

ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO ESTATÍSTICA I LISTA DE EXERCÍCIOS 2 GABARITO 1. (Magalhães e Lima, pg 40) Para cada um dos casos abaixo, escreva o espaço amostral correspondente e conte seus elementos: (a) Uma moeda é lançada duas vezes

Leia mais

Probabilidade Básica. Capítulo 1 EXPERIMENTOS ALEATÓRIOS ESPAÇOS AMOSTRAIS

Probabilidade Básica. Capítulo 1 EXPERIMENTOS ALEATÓRIOS ESPAÇOS AMOSTRAIS Capítulo 1 Probabilidade Básica EXPERIMENTOS ALEATÓRIOS Todos estão familiarizados com a importância dos experimentos na ciência e na engenharia. A experimentação é útil porque podemos presumir que, se

Leia mais

Lista de Exercícios 4

Lista de Exercícios 4 Introdução à Teoria de Probabilidade. Informática Biomédica. Departamento de Física e Matemática. USP-RP. Prof. Rafael A. Rosales 30 de maio de 2007. Lista de Exercícios 4 são difíceis, são bem mais difíceis.

Leia mais

Variável Aleatória. Gilson Barbosa Dourado 6 de agosto de 2008

Variável Aleatória. Gilson Barbosa Dourado 6 de agosto de 2008 Variável Aleatória Gilson Barbosa Dourado gdourado@uneb.br 6 de agosto de 2008 Denição de Variável Aleatória Considere um experimento E e seu espaço amostral Ω = {a 1, a 2,..., a n }. Variável aleatória

Leia mais

Módulo de Introdução à Probabilidade. Ferramentas Básicas. 2 a série E.M.

Módulo de Introdução à Probabilidade. Ferramentas Básicas. 2 a série E.M. Módulo de Introdução à Probabilidade Ferramentas Básicas. a série E.M. Probabilidade Ferramentas Básicas Exercícios Introdutórios Exercício. Uma prova é composta por 5 questões de múltipla escolha com

Leia mais

Probabilidade. Luiz Carlos Terra

Probabilidade. Luiz Carlos Terra Luiz Carlos Terra Nesta aula, você conhecerá os conceitos básicos de probabilidade que é a base de toda inferência estatística, ou seja, a estimativa de parâmetros populacionais com base em dados amostrais.

Leia mais

PROBABILIDADE PROFESSOR: ANDRÉ LUIS

PROBABILIDADE PROFESSOR: ANDRÉ LUIS PROBABILIDADE PROFESSOR: ANDRÉ LUIS 1. Experimentos Experimento determinístico: são aqueles em que o resultados são os mesmos, qualquer que seja o número de ocorrência dos mesmos. Exemplo: Um determinado

Leia mais

Matemática. Alex Amaral (Allan Pinho) Probabilidade

Matemática. Alex Amaral (Allan Pinho) Probabilidade Probabilidade Probabilidade 1. Observe a figura que mostra um desses baralhos, no qual as cartas representadas pelas letras A, J, Q e K são denominadas, respectivamente, ás, valete, dama e rei. Uma criança

Leia mais

CAIXA ECONOMICA FEDERAL. Prof. Sérgio Altenfelder

CAIXA ECONOMICA FEDERAL. Prof. Sérgio Altenfelder 14.) (ICMS-MG/05) Um empréstimo contraído no início de abril, no valor de R$ 15.000,00 deve ser pago em dezoito prestações mensais iguais, a uma taxa de juros compostos de 2% ao mês, vencendo a primeira

Leia mais

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES

LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES LISTA DE EXERCÍCIOS 1 ESTATÍSTICA E PROBABILIDADES 1- Ordene os dados indicando o 1º, 2º e 3º quartil 45, 56, 62, 67, 48, 51, 64, 71, 66, 52, 44, 58, 55, 61, 48, 50, 62, 51, 61, 55 2- Faça a análise da

Leia mais

Módulo VIII. Probabilidade: Espaço Amostral e Evento

Módulo VIII. Probabilidade: Espaço Amostral e Evento 1 Módulo VIII Probabilidade: Espaço Amostral e Evento Suponha que em uma urna existam cinco bolas vermelhas e uma branca. Extraindo-se, ao acaso, uma das bolas, é mais provável que esta seja vermelha.

Leia mais

Probabilidade. Capítulo 8

Probabilidade. Capítulo 8 Capítulo 8 Probabilidade Desenvolvimento: 8.1 Introdução. 8.2 Experimento aleatório. 8.3 Espaço Amostral 8.4 Eventos 8.5 Probabilidade 8.6 Exercícios 8.7 Eventos Complementares 8.8 Eventos Independentes

Leia mais

AULA 07 Distribuições Discretas de Probabilidade

AULA 07 Distribuições Discretas de Probabilidade 1 AULA 07 Distribuições Discretas de Probabilidade Ernesto F. L. Amaral 31 de agosto de 2010 Metodologia de Pesquisa (DCP 854B) Fonte: Triola, Mario F. 2008. Introdução à estatística. 10 ª ed. Rio de Janeiro:

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Espaço Amostral, Eventos, Álgebra de eventos Aula de hoje Probabilidade Análise Combinatória Independência Probabilidade Experimentos

Leia mais

8 - PROBABILIDADE. 8.1 - Introdução

8 - PROBABILIDADE. 8.1 - Introdução INE 7002 - Probabilidade 1 8 - PROBABILIDADE 8.1 - Introdução No capítulo anterior foi utilizado um raciocínio predominantemente indutivo: os dados eram coletados, e através da sua organização em distribuições

Leia mais

Se o número máximo de laranjas estragadas é 4, então temos, no mínimo, 140 laranjas não estragadas.

Se o número máximo de laranjas estragadas é 4, então temos, no mínimo, 140 laranjas não estragadas. 26. (IBGE 2016/FGV) Em uma caixa há doze dúzias de laranjas, sobre as quais sabe-se que: I - há pelo menos duas laranjas estragadas; II - dadas seis quaisquer dessas laranjas, há pelo menos duas não estragadas.

Leia mais

Teste de Avaliação Escrita

Teste de Avaliação Escrita Teste de Avaliação Escrita Duração: 9 minutos 8 de outubro de Escola E.B., Eng. Nuno Mergulhão Portimão Ano Letivo /4 Matemática 9.º B Nome: N.º Classificação: Fraco (% 9%) Insuficiente (% 49%) Suficiente

Leia mais

Tópicos. Conjuntos Fatorial Combinações Permutações Probabilidade Binômio de Newton triângulo de Pascal

Tópicos. Conjuntos Fatorial Combinações Permutações Probabilidade Binômio de Newton triângulo de Pascal Probabilidade Tópicos Conjuntos Fatorial Combinações Permutações Probabilidade Binômio de Newton triângulo de Pascal Conjuntos Conjunto: Na matemática, um conjunto é uma coleção de elementos com características

Leia mais

5) Qual a probabilidade de sair um ás de ouros quando retiramos uma carta de um baralho de 52 cartas?

5) Qual a probabilidade de sair um ás de ouros quando retiramos uma carta de um baralho de 52 cartas? TERCEIRA LISTA DE EXERCÍCIOS DE PROBABILIDADE CURSO: MATEMÁTICA PROF. LUIZ CELONI 1) Dê um espaço amostral para cada experimento abaixo. a) Uma urna contém bolas vermelhas (V), bolas brancas (B) e bolas

Leia mais

DRUIDAS DO SABER CENTRO DE EXPLICAÇÕES. Matemática - 9º Ano

DRUIDAS DO SABER CENTRO DE EXPLICAÇÕES. Matemática - 9º Ano DRUIDAS DO SABER CENTRO DE EXLICAÇÕES Matemática - 9º Ano Em todas as questões apresenta o teu raciocínio de forma clara, indicando todos os cálculos que tiveres de efectuar e todas as justificações que

Leia mais

Ficha de Avaliação. Matemática A. Duração do Teste: 90 minutos. 12.º Ano de Escolaridade. Teste de Matemática A 12.º Ano Página 1

Ficha de Avaliação. Matemática A. Duração do Teste: 90 minutos. 12.º Ano de Escolaridade. Teste de Matemática A 12.º Ano Página 1 Ficha de Avaliação Matemática A Duração do Teste: 90 minutos 12.º Ano de Escolaridade Teste de Matemática A 12.º Ano Página 1 1. Colocaram-se numa urna 12 bolas, indistinguíveis pelo tato, numeradas de

Leia mais

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto

Estatística. Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas. Professor Fernando Porto Estatística Capítulo 3 - Parte 1: Variáveis Aleatórias Discretas Professor Fernando Porto Lançam-se 3 moedas. Seja X o número de ocorrências da face cara. O espaço amostral do experimento é: W = {(c,c,c),(c,c,r),(c,r,c),(c,r,r),(r,c,c),(r,c,r),(r,r,c),(r,r,r)}

Leia mais

PROBABILIDADES Disciplina de Pós-Graduação Departamento de Matemática

PROBABILIDADES Disciplina de Pós-Graduação Departamento de Matemática PROBABILIDADES Disciplina de Pós-Graduação Departamento de Matemática (Apostila #1) INTRODUÇÃO À PROBABILIDADE A Teoria de Probabilidades nada mais é que senso comum transformado em cálculo Laplace Exemplos

Leia mais

Estatística - aulasestdistrnormal.doc 13/10/05

Estatística - aulasestdistrnormal.doc 13/10/05 Distribuição Normal Introdução O pesquisador estuda variáveis. O estatístico diz que essas variáveis são aleatórias porque elas têm um componente que varia ao acaso. Por exemplo, a variabilidade dos pesos

Leia mais

PROBABILIDADE 1. INTRODUÇÃO

PROBABILIDADE 1. INTRODUÇÃO proporção de caras Revisões PROBABILIDADE 1. INTRODUÇÃO As experiências aleatórias apresentam as seguintes características:.o resultado individual é imprevisível.são conhecidos todos os possíveis resultados.a

Leia mais

Definição: É uma coleção bem definida de

Definição: É uma coleção bem definida de EST029 Cálculo de Probabilidade I Cap. 1: Introdução à Probabilidade Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Conjuntos: Definição e notação Definição: É uma coleção bem definida de objetos,

Leia mais

Professor Mauricio Lutz PROBABILIDADE

Professor Mauricio Lutz PROBABILIDADE PROBABILIDADE Todas as vezes que se estudam fenômenos de observação, cumpre-se distinguir o próprio fenômeno e o modelo matemático (determinístico ou probabilístico) que melhor o explique. Os fenômenos

Leia mais

1) Qual a probabilidade de obtermos face 5 no arremesso de um dado?

1) Qual a probabilidade de obtermos face 5 no arremesso de um dado? Porém sabemos que nem todas as características genéticas são desejáveis por produzirem fenótipos com baixa viabilidade ou produzirem deformações ou bloqueios em rotas importantes do metabolismo. Então,

Leia mais

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade Magnos Martinello Universidade Federal do Espírito Santo - UFES Departamento de Informática DI Laboratório de Pesquisas em Redes Multimidia LPRM Objetivos 1. Definições: Experimento Espaço Amostral Evento

Leia mais

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17)

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17) Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 016/17) 1- Modelos de probabilidade(136) 1.1) Introdução.(36) (Vídeo: 33) 1.) Fenómenos aleatórios(138) Experiência determinística-produz

Leia mais

DNIT RACIOCÍNIO LÓGICO. 5ª parte: Probabilidade

DNIT RACIOCÍNIO LÓGICO. 5ª parte: Probabilidade DNIT RACIOCÍNIO LÓGICO 5ª parte: Probabilidade (webercampos@gmail.com) PROBABILIDADE 1. CONCEITOS INICIAIS Ocorre que a Teoria da Probabilidade faz uso de uma nomenclatura própria, de modo que há três

Leia mais

QUESTÕES DE CONCURSOS PÚBLICOS ENVOLVENDO PROBABILIDADE

QUESTÕES DE CONCURSOS PÚBLICOS ENVOLVENDO PROBABILIDADE QUESTÕES DE CONCURSOS PÚBLICOS ENVOLVENDO PROBABILIDADE 1) Uma moeda não tendenciosa é lançada quatro vezes. A probabilidade de que sejam obtidas duas caras e duas coroas é: (A) 3/8 (B) ½ (C) 5/8 (D) 2/3

Leia mais

MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade

MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade MAT 461 Tópicos de Matemática II Aula 5: Resumo de Probabilidade Edson de Faria Departamento de Matemática IME-USP 26 de Agosto, 2013 Probabilidade: uma Introdução / Aula 5 1 Variáveis aleatórias Definição

Leia mais

Resolução da Prova de Raciocínio Lógico da Agente Penitenciário/MA, aplicada em 24/04/2016.

Resolução da Prova de Raciocínio Lógico da Agente Penitenciário/MA, aplicada em 24/04/2016. de Raciocínio Lógico da gente Penitenciário/M, aplicada em 24/04/206. - sentença Se Maria é médica, então Silvio é engenheiro. é logicamente equivalente a () se Maria é médica, então Silvio é engenheiro.

Leia mais

Exercícios resolvidos sobre Teoremas de Probabilidade

Exercícios resolvidos sobre Teoremas de Probabilidade Exercícios resolvidos sobre Teoremas de Probabilidade Aqui você tem mais uma oportunidade de estudar os teoremas da probabilidade, por meio de um conjunto de exercícios resolvidos. Observe como as propriedades

Leia mais

Matemática Ficha de Apoio Modelos de Probabilidade - Introdução

Matemática Ficha de Apoio Modelos de Probabilidade - Introdução Matemática Ficha de Apoio Modelos de Probabilidade - Introdução 12ºano Introdução às probabilidades No final desta unidade, cada aluno deverá ser capaz de: - Identificar acontecimentos com conjuntos e

Leia mais

REVISÃO DO CONTEÚDO ATÉ HOJE. Conhecendo o cálculo da probabilidade

REVISÃO DO CONTEÚDO ATÉ HOJE. Conhecendo o cálculo da probabilidade REVISÃO DO CONTEÚDO ATÉ HOJE Conhecendo o cálculo da probabilidade BERTOLO OBJETIVOS Definir probabilidade; Identificar situações práticas às quais se aplica a probabilidade; Definir experimento, espaço

Leia mais

Leon: Oi Lara, a primeira aula de probabilidade foi muito legal, né?

Leon: Oi Lara, a primeira aula de probabilidade foi muito legal, né? Módulo 04 Aula 04 TÍTULO: Probabilidade Parte 2. Para início de conversa... Fazer quadrinhos do seguinte diálogo: Leon: Oi Lara, a primeira aula de probabilidade foi muito legal, né? Lara: É mesmo Leon,

Leia mais

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado.

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado. Sistema Real Determinístico Probabilístico Causas Efeito X Causas Efeito Eperiência para o qual o modelo probabilístico é adequado. ❶ Não é possível prever um resultado particular, mas pode-se enumerar

Leia mais