ARS VETERINARIA, 17(3): ,

Tamanho: px
Começar a partir da página:

Download "ARS VETERINARIA, 17(3):218-223, 2001. 218"

Transcrição

1 ARS VETERINARIA, 17(3): , IDENTIFICAÇÃO PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) DE AMOSTRAS DE Escherichia coli ENTEROPATOGÊNICAS (EPEC) ISOLADAS DE CÃES COM DIARRÉIA E NORMAIS NO ESTADO DE SÃO PAULO, BRASIL (IDENTIFICATION BY THE POLYMERASE CHAIN REACTION (PCR) TECHNIQUE OF STRAINS OF ENTEROPATHOGENIC (EPEC) Escherichia coli ISOLATED FROM DIARRHEIC AND HEALTHY DOGS IN THE STATE OF SÃO PAULO, BRAZIL) G. NAKAZATO 1, L. OSUGUI 2, F. A. DE ÁVILA 3, A. F. P. DE CASTRO 4 RESUMO Foram examinadas fezes de 146 cães com diarréia e de 36 cães aparentemente normais. Utilizando a técnica de reação em cadeia da polimerase (PCR) foi verificada a presença do gene eae em 22 (11,82%) amostras de Escherichia coli de cães, sendo 19 oriundas de cães com diarréia e três de animais aparentemente sadios. O gene eae é responsável pela codificação de uma proteína de membrana externa, denominada intimina, um dos principais fatores de virulência envolvidos na formação da lesão attaching and effacing (A/E) encontrada no epitélio intestinal dos animais afetados e também em células HEp-2 e HeLa, experimentalmente infectadas por essas amostras de E. coli. Ainda pela técnica de PCR, destas 22 amostras eae positivas, duas amostras foram positivas para a presença do gene bfpa, que codifica para um tipo de adesina, denominada bundle-forming pilus. Todas as amostras foram negativas para genes produtores de shiga-toxinas (Stx1 e Stx2). Nossos achados demonstram de modo evidente a presença dessas amostras muito semelhantes às enteropathogenic E.coli (EPEC) humanas entre cães, bem como sugerem a habilidade destas bactérias causarem lesões A/E, podendo ser consideradas agentes etiológicos de diarréia em cães e eventualmente serem transmitidas para humanos. PALAVRAS- CHAVE: Escherichia coli enteropatogênica, attaching and effacing, gene eae, PCR SUMMARY Stools from 146 dogs with diarrhea and 36 from apparently healthy ones were examined. Using the polymerase chain reaction (PCR) the gene eae was detected in 22 (11.82%) strains of Escherichia coli, being 19 from animals with 1 Médico Veterinário e Mestrando do Programa de Biologia Molecular e Genética de Microrganismos, Departamento de Microbiologia e Imunologia, do Instituto de Biologia, Universidade Estadual de Campinas, Cidade Universitária Zeferino Vaz, s/nº, , Campinas, SP. 2 Biologista, Bolsista de Iniciação Científica do Pibic/USP, Departamento de Microbiologia, Instituto de Ciências Biomédicas-II, Universidade de São Paulo, Cidade Universitária Armando Sales de Oliveira, Av. Prof. Lineu Prestes, 1374, , São Paulo, SP. 3 Médico Veterinário, Pesquisador do CNPq, Professor Titular de Microbiologia, Departamento de Microbiologia e Imunologia, Faculdade de Ciências Agrárias e Veterinárias, Unesp, Campus de Jaboticabal, Rodovia Paulo Castelane Donato, Km5, Jaboticabal, SP, Brasil 4. Médico Veterinário, Pesquisador 1-A do CNPq, Professor Titular de Microbiologia, Departamento de Microbiologia, Instituto de Ciências Biomédicas-II, Universidade de São Paulo, Cidade Universitária Armando Sales de Oliveira, Av. Prof. Lineu Prestes, 1374, , São Paulo, SP. Autor para correspondência. Trabalho subsidiado pelo CNPq e pela Fapesp

2 219 ARS VETERINARIA, 17(3): , diarrhea and three strains from non-diarrheic dogs. The eae gene is responsible for encoding an outer membrane protein, named intimim, one of the main virulence factors involved in the formation of the attaching and effacing (A/E) lesions found in the intestinal epithelium of the affected animals and also in the HEp-2 and Hela cells experimentally infected by these E.coli strains. Yet, using the PCR technique two out of the 22 eae+ were positive for the presence of the bfpa gene, that codes for an adhesin, denominated bundle-forming pilus. All strains were negative for the genes that encode for shiga-toxins ( Stx1 and Stx2 ). Our findings demonstrate clear-cut that the presence of these strains among dog stools is very similar to the enteropathogenic E. coli (EPEC) responsible for diarrheal infection among children, as well suggest that these bacteria have the ability of causing A/E lesions, characterizing these strains as etiological agents of diarrhea among dogs and eventually transmitted to humans. KEY-WORDS: Enteropathogenic Escherichia coli, attaching and effacing, gene eae, PCR INTRODUÇÃO Escherichia coli é um dos maiores componentes da microbiota normal anaeróbia facultativa intestinal (DRASAR & HILL, 1974). Algumas amostras de E. coli têm sido reconhecidas como uma das causas de diarréia em humanos (LEVINE, 1987) e animais (PESTANA DE CASTRO et al., 1984; BLANCO et al., 1993; ROBINS- BROWNE et al., 1994). Uma variedade de amostras de E. coli, incluindo as attaching and effacing E. coli (AEEC), enterotoxigênicas (ETEC), necrotoxigênicas (NTEC) e verotoxigênicas (VTEC, hoje conhecidas como STEC), têm sido associadas com diarréia em cães (BEUTIN, 1999). Amostras de E. coli enteropatogênicas (EPEC) são responsáveis por causarem lesões características no epitélio intestinal denominadas de attaching and effacing (A/E). Essas lesões são caracterizadas pela destruição das microvilosidades e proliferação de filamentos de actina e outras proteínas do citoesqueleto, resultando na formação de estruturas semelhantes a pedestais (DONNENBERG & KAPER,1992). Em humanos as amostras de EPEC típicas são caracterizadas pela presença do gene eae e plasmídio EAF (EPEC adherence factor) e geralmente apresentam adesão do tipo localizada em cultura de células HEp-2 e HeLa (TRABULSI et al., 1996). As EPEC atípicas são caracterizadas somente pela presença do gene eae e geralmente apresentam adesão do tipo localizada-like (TRABULSI et al., 1996). Esse gene produz uma proteína de membrana conhecida como intimina, sendo responsável pelo contato íntimo entre a bactéria e a célula epitelial (JERSE et al., 1990). O plasmídio EAF contém uma seqüência de genes, genericamente denominados bfp, que codifica uma fímbria denominada de bundle-forming pilus (BFP) (SOHEL et al., 1996), envolvido na aderência localizada às células epiteliais (NATARO et al., 1985). Algumas amostras de E. coli, além de possuírem o gene eae, podem apresentar também toxinas semelhantes às da Shigella dysenteriae, conhecidas como shiga-toxinas (Stx1 e Stx2) (O BRIEN & HOLMES, 1984). Essas amostras são denominadas de shiga-toxins Escherichia coli ( STEC) ou entero-hemorrágicas (EHEC) (NATARO & KAPER, 1998), quando enquadradas em sorotipos responsáveis, em humanos, por colite hemorrágica e pela sindrome hemolítica urêmica (SHU), que também na sua maioria possui o gene eae. Portanto para identificar as EPEC, quer de origem humana quer animal, é importante verificar a ausência dessas citoxinas. A ocorrência de AEEC em cães não foi relatada ainda no Brasil, encontrando-se somente relatos em outros países (BROES et al., 1988 e DROLET et al., 1994) que verificaram a presença dessas bactérias em cães no Canadá). Alguns autores, como DROLET et al. (1994), denominam, atualmente, essas amostras de dog EPEC ou DEPEC. No Brasil, não existe nenhum relato sobre a ocorrência de amostras de A/E ou DEPEC isoladas de cães. Deste modo, o nosso objetivo principal nesta pesquisa foi verificar, técnica de reação em cadeia da polimerase (PCR), a presença desses marcadores de virulência (gene eae, bfpa e plasmídio EAF) em amostras de E. coli isoladas de cães com diarréia e normais. Essas amostras também foram testadas pela PCR em relação à possível ocorrência de genes produtores de shiga-toxinas (stx). MATERIAL E MÉTODOS Coleta e isolamento Neste trabalho foram examinadas fezes de 146 cães com diarréia e 36 cães normais. As fezes foram coletadas da região anal de animais de várias faixas etárias e de diferentes localidades. Parte desta coleta foi realizada em dois hospitais veterinários da cidade de Campinas e em clínicas veterinárias dos municípios de São Paulo, Valinhos e São Bernardo do Campo. Em virtude do número de amostras coletadas nos hospitais ter sido reduzido, depois

3 ARS VETERINARIA, 17(3): , de três a quatro meses do começo da pesquisa, iniciada em março de 1998, foi resolvido estender esta coleta à cidade de São Paulo, de modo mais amplo, contando para tal com o Canil da Sociedade Protetora dos Animais. Esta coleta, utilizando-se para esta conduta suabes estéreis, foi sempre acompanhada por um veterinário, escolhendo-se somente animais jovens, em sua maioria com menos de três meses de idade, e que apresentassem sinais de diarréia. Algumas destas amostras foram isoladas de cães com suspeitas clínicas de parvovirose, cinomose e outras infeções, reforçando a hipótese das DEPEC também poderem atuar como agentes em co-infecções. Em todas as coletas os materiais foram imediatamente encaminhados para os Laboratórios de Microbiologia do Instituto de Biologia na Unicamp e do Instituto de Ciências Biomédicas da USP para serem processados. O isolamento de E. coli foi realizado pela semeadura das fezes em placas contendo o meio ágar MacConkey e incubação destas por horas a 37 C. A identificação da espécie Escherichia coli foi feita utilizando métodos convencionais usados nesses laboratórios, baseados nos resultados das semeaduras em meios de EPM (Escola Paulista de Medicina), MILi- motilidade-indol-lisina (TOLEDO et al., 1982a; TOLEDO et al., 1982b) e citrato (EDWARDS & EWING, 1972). Reação em cadeia da polimerase ( PCR) Como triagem foi realizado o teste de PCR para o gene eae do material de um raspado da zona de crescimento confluente de cada placa de MacConkey. Para as placas que apresentaram resultado positivo para esse gene, foram selecionadas e identificadas entre 10 e 50 colônias de E. coli por meio de provas bioquímicas já citadas. Essas colônias foram novamente testadas para o gene eae pelo teste de PCR. As colônias positivas para esse gene foram testadas para a presença de bfpa e genes que codificam shiga-toxinas (stx1 e stx2), também pela técnica de PCR. Para o teste de PCR, 10μL de DNA molde foram misturados com 2,5 U de Taq polimerase (Gibco BRL), 50 ρmol de cada iniciador, 200 μm de deoxinucleosídeo trifosfato (dntps), 1,5 Mm de MgCl 2 e 1x PCR buffer (Gibco BRL), num volume final de 100μL. O DNA molde a ser amplificado foi extraído pela fervura, em banho por 10 minutos, das culturas oriundas das colônias acima citadas, suspensas em tubos eppendorf com 100μL de água Mili-Q Depois de uma desnaturação inicial a 94 C por 10 minutos, o material foi submetido a 30 ciclos térmicos de 94 C (desnaturação) por 1 minuto, X C (temperatura de anelamento variável de acordo com a porcentagem de CG dos iniciadores) por 1 minuto e 72 C (extensão) por 1minuto. As reações foram feitas num Termociclador, marca MJ Research, USA. Um volume de 10 μl de cada reação (fragmento amplificado) foi submetido a eletroforese em gel de agarose a 1% e em seguida corado em brometo etídio, sendo depois visualizado através de um transiluminador (Ultra Violet Products). Os produtos amplificados para os genes eae, bfpa, stx1 e stx2 corresponderam a bandas de 815 pb, 326 pb, 894 pb e 478 pb, respectivamente. Para a amplificação do gene eae foram usados dois iniciadores (GANNON et al., 1993): EAE1 5 ACGTTGCAGCATGGGTAACTC 3 e EAE2 5 GATCGGCAATTTCACCTG 3, com temperatura de anelamento de 56 C. Para o bfpa foram utilizados 2 iniciadores (GUNZBURG et al., 1995): BFP1 5 AATGGTGCTTGCGCTTGCTGC 3 e BFP2 5 GCCGCTTTATCCAACCTGGTA 3, com temperatura de anelamento de 63 C. E para stx1 e stx2, quatro iniciadores (BLANCO et al., 1994) : STx1-A 5 CAGTTAATGTGGTGGCGAAG 3, STx1-B 5 CTGCTAATAGTTCTGCGCATC 3, STx2-A 5 CTTCGGTATCCTATTCCCGG 3 e STx2-B 5 GGATGCATCTCTGGTCATTG 3, com temperatura de anelamento de 55 C. Para todos os testes foram utilizados controles positivo e negativo. A amostra de E. coli E2348/69 foi utilizada como controle positivo para o genes eae e bfpa. O sorotipo O157:H7 para stx1 e stx2, e o sorotipo K12C600, como padrão negativo para todos os testes. RESULTADOS Das 146 amostras de fezes de cães com diarréia e 36 de cães normais, apenas nove de cães com diarréia e duas de cães normais não apresentaram crescimento bacteriano em placas de ágar MacConkey. Entre as amostras isoladas, 22 apresentaram amplificação com iniciadores para o gene eae no raspado da zona de crescimento das placas de meio de cultura (triagem). Destas 22, três eram oriundas de cães sem diarréia. Para o isolamento das 22 amostras, de cada espécime fecal semeado em meio de MacConkey, cerca de 10 a 50 colônias de E. coli foram examinadas pela PCR, para detecção do gene eae. As amostras positivas na triagem apresentaram uma grande variação entre a relação do número de colônias eae positivas, comparadas com o total de colônias examinadas (Tabela 1). Algumas amostras apresentaram alta freqüência de colônias eae+, como a amostra 008 (100%), e outras apresentaram um freqüência de colônias eae+ bem baixa, como a amostra B17 (2%). Os resultados positivos para a amplificação do fragmento de 861pb, correspondente à detecção do gene eae, em várias amostras estudadas podem ser vistos na

4 221 ARS VETERINARIA, 17(3): , Tabela 1 Resultados das amostras de E. coli isoladas de cães. Presença dos genes eae, bfpa, das citoxinas STxs, diarréia e relação entre o número de colônias eae positivas e o número de colônias examinadas para cada amostra. AMOSTRAS eae bfpa Stx DIARRÉIA N DE COLÔNIAS POSITIVAS/ N DE COLÔNIAS TESTADAS /10 HE /10 HE /10 HE /10 HE /10 HE /10 SPA /10 SPA /10 B /10 B2N /30 B /40 B /10 B /50 S /50 S /50 BIO /10 BIO /10 BIO /50 C /10 C /10 SB /10 QSF /10 N O Número; eae- gene que codifica para a proteína de membrana externa, denominada intimina; bfpa- Um dos genes responsáveis pela codificação do bundle forming pilus ; Stx- Toxina de Shiga ou Shiga-toxina; + ou presença ou ausência do gene, fator de virulência, ou diarréia, respectivamente. Figura 1. Das 22 amostras, apenas culturas de duas colônias (S6 e C27) amplificaram com iniciadores para o gene bfpa, sendo ambas isoladas de cães com diarréia. Nenhuma das amostras estudadas apresentou amplificação com iniciadores para os genes stx1 e stx2. DISCUSSÃO A presença do gene eae e a ausência das toxinas Stxs em 22 amostras de E. coli isoladas de cães demonstram a presença de E. coli enteropatogênicas (EPEC) nesses animais, quer com diarréia quer aparentemente normais. Neste trabalho encontramos duas amostras eae positivas que também amplificaram com iniciadores para o gene bfpa. Portanto essas amostras se enquadrariam entre as DEPEC típicas. Apesar disso ocorreu uma grande predominância de amostras DEPEC atípicas (sem BFP e sem o plasmídio EAF) entre as amostras eae positivas. Como DEPEC foi encontrada tanto em cães com diarréia como em cães sem diarréia, isso nos leva a crer que esses cães, ainda que aparentemente sadios, possam atuar como portadores para outros animais e para humanos. Algumas amostras apresentaram elevada porcentagem de colônias de E. coli que eram portadoras do gene eae (número de colônias eae positivas/ total de colônias testadas), como as amostras SB2 (100%) e C32 (100%), em relação às quais se pode afirmar que possivelmente as mesmas eram na realidade agentes etiológicos primários dos casos de diarréia nesses cães. Outras apresentaram baixas porcentagens, como as amostras B17 (2%) e BIO12 (2%). Em relação a estas últimas, a baixa porcentagem de colônias eae+ dificultou muito o isolamento das DEPEC, sendo necessário selecionar muitas colônias, mais precisamente entre 40 e 50 por cultura, o que pode sugerir serem esses cães portadores, como resultado de doença ou infecção recente ou remota. A presença de marcadores de virulência nessas amostras nos leva a crer que as mesmas apresentem potencial genotípico para causarem a lesão A/E (DONNENBERG & KAPER, 1992 ) no epitélio intestinal desses cães, podendo conseqüentemente desenvolver diarréia nesses animais. Vale ressaltar que essas amostras apresentaram os genes necessários para a codificação e formação da lesão A/E. Todavia, a presença dos genes eae e bfpa só tem significado se for confirmada a sua expressão por outros métodos. No caso do gene eae, a produção de intimina foi confirmada por western blot (dados não mostrados), porém no que concerne ao gene bfpa, os experimentos estão em andamento para que se confirme a sua expressão, também por esta última técnica. Por outro lado, levando-se em conta que os

5 ARS VETERINARIA, 17(3): , Figura 1- Resultados da PCR para o gene eae de algumas amostras de Escherichia coli isoladas de cães, mostrando fragmentos amplificados de 815pb (canaletas 4 a 13); canaleta 1: (Ladder 1Kb, Gibco); canaleta 2 : Amostra de E.coli E2348/69 (controle positivo) e canaleta 3: E. coli K12 (controle negativo) marcadores de virulência de amostras DEPEC são muito semelhantes aos encontrados em amostras EPEC (humanos) (DROLET et al., 1994), principalmente quando presentes os genes que codificam para o BFP e o plasmídio EAF, podemos acreditar que esses animais possam servir como eventuais fontes de infeção para o homem, embora dados da literatura não relatem ainda esses fatos (TRABULSI, comunicação pessoal). REFERÊNCIAS BEUTIN, L. Escherichia coli as a pathogen in dogs and cats. Review. Veterinary Research, v.30, p , BLANCO, M., BLANCO, J.E., RAMOS, J. Enterotoxigenic, verotoxigenic and necrotoxigenic Escherichia coli isolated from cattle in Spain. American Journal of Veterinary Research, v. 54, p , BLANCO, M., BLANCO, J.E., GONZÁLEZ, E. A., GOMES, T.A.T., ZERBINI, L.F., YANO, T., PESTANA DE CASTRO, A.F. Genes coding for shiga-like toxins in bovine verotoxin producing Escherichia coli (VTEC) strains belonging to differents O:K:H serotypes. Veterinary Microbiology, v. 42, p , BROES, A., DROLET, R., JACQUES, M., FAIRBROTHER, J.M., JOHNSON, W.M. Natural infection with an attaching and effacing Escherichia coli in a diarrheic puppy. Canadian Journal of Veterinary Research, v.52, p , DONNENBERG, M.S., KAPER, J.B. Enteropathogenic Escherichia coli. Infection and Immunity, v.60, p , DRASAR, B.S., HILL, M.J. Human intestinal flora. London. Academic Press, Ltd., 1974, p DROLET, R., FAIRBROTHER, J.M., HAREL, J., HELIE, P. Attaching and effacing and enterotoxigenic Escherichia coli associated with enteric colibacillosis in dog. Canadian Journal of Veterinary Research, v. 58, p , EDWARDS, P.R., EWING, W.H. Identification of Enterobacteriaceae. Burgess Publishing CO. Mineapolis, GANNON, V.P.J., RASHED, M., KING, R.K., THOMAS, E.J.G. Detection and characterization of the eae gene of shiga-like toxin producing Escherichia coli using polymerase chain reaction. Journal of Clinical Microbiolology, v.31, p , GUNZBURG, S.T., TORNIEPORTH, N.G., RILEY, L.W. Identification of enteropathogenic Escherichia coli by PCR-bases detection of the bundle forming pilus gene. Journal of Clinical Microbiolology, v.33, p ,

6 223 ARS VETERINARIA, 17(3): , JERSE, A.E., YU, J., TALL, B.D., KAPER, J.B. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proceedings of National Academy of Science, v.87, p , LEVINE, M.M. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic and enteroadherent. Journal of Infectious Diseases, v.155, p , NATARO, J. P., KAPER, J.P. Diarrheagenic Escherichia coli. Clinical Microbiology Reviews, v.11, n.1, p , NATARO, J.P., SCALETSKY, I.C.A., KAPER, J.B., LEVINE, M.M., TRABULSI, L.R. Plasmid-mediaded factors confering diffuse and localized adherence of enteropathogenic E. coli. Infection and Immunity, v. 48, p , O BRIEN, A.D., HOLMES, R.K. Shiga and Shiga-like toxins. Revista de Microbiologia, v.51, p , PESTANA DE CASTRO, A.F., SERAFIM, M.B., BRITO, J.R.F., BARCELLOS, D.S.E.N., COLLI, I.A.G. Virulence factors present in cultures of Escherichia coli isolated from pigs in the region of Concordia, SC, Brasil. Pesquisa Veterinária Brasileira, v.4, p ,1984. ROBINS-BROWNE, R.M., ADAMS, L.M., WOOD, B.V., MOISIDIS, A.V., OKREJANY, E.O., O GORMAN, L.E. Adherence characteristics of attaching and effacing strains of Escherichia coli from rabbits. Infection and Immunity, v.62, p , SOHEL, I., PUENTE, J.L., RAMER, S..W., BIEBER, D., WU, C-Y., SCHOOLNIK, G.K. Enteropathogenic Escherichia coli: Identification of a gene cluster coding for bundle-forming pilus morphogenesis. Journal of Bacteriology, v.178, p , TOLEDO, M.R.F., FONTES, C.F., TRABULSI, L.R. EPM- Modificação do meio Rugai e Araújo para realização simultânea dos testes de produção de gás a partir de glicose, H 2 S, urease e triptofano desaminase. Revista de Microbiologia, v.13, p , 1982a. TOLEDO, M.R.F., FONTES, C.F., TRABULSI, L.R. Um meio para a realização dos testes de motilidade, indol e lisina descarboxilase. Revista de Microbiologia, v.13, p.230-5, 1982b. TRABULSI, L.R., CAMPOS, L.C., WHITTAN, T.S., GOMES, T.A.T., RODRIGUES, J., GONÇALVES, A.G. Traditional and non-traditional enteropathogenic Escherichia coli serogroups. Revista de Microbiologia, v.27, p.1-6, 1996.

PCR MULTIPLEX PARA DETERMINAÇÃO DE MARCADORES DE VIRULÊNCIA EM Escherichia coli ISOLADAS DE BOVINOS COM DIARRÉIA EM MINAS GERAIS

PCR MULTIPLEX PARA DETERMINAÇÃO DE MARCADORES DE VIRULÊNCIA EM Escherichia coli ISOLADAS DE BOVINOS COM DIARRÉIA EM MINAS GERAIS PCR MULTIPLEX PARA DETERMINAÇÃO DE MARCADORES DE VIRULÊNCIA EM Escherichia coli ISOLADAS DE BOVINOS COM DIARRÉIA EM MINAS GERAIS Giovanna Ivo Andrade 1, Ethiene Luiza de Souza Santos 2, Fernanda Morcatti

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

SEGURANÇA ALIMENTAR E DOENÇAS VEICULADAS POR ALIMENTOS: UTILIZAÇÃO DO GRUPO COLIFORME COMO UM DOS INDICADORES DE QUALIDADE DE ALIMENTOS

SEGURANÇA ALIMENTAR E DOENÇAS VEICULADAS POR ALIMENTOS: UTILIZAÇÃO DO GRUPO COLIFORME COMO UM DOS INDICADORES DE QUALIDADE DE ALIMENTOS SEGURANÇA ALIMENTAR E DOENÇAS VEICULADAS POR ALIMENTOS: UTILIZAÇÃO DO GRUPO COLIFORME COMO UM DOS INDICADORES DE QUALIDADE DE ALIMENTOS Food security and food-borne diseases: utilization of the coliform

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Anais da Semana Técnico-Científica Comemorativa aos 40 anos do Curso de Medicina Veterinária da Universidade Federal de Uberlândia e VIII Mostra de

Anais da Semana Técnico-Científica Comemorativa aos 40 anos do Curso de Medicina Veterinária da Universidade Federal de Uberlândia e VIII Mostra de UNIVERSIDADE FEDERAL DE UBERLÂNDIA FACULDADE DE MEDICINA VETERINÁRIA ANAIS DA SEMANA TÉCNICO-CIENTÍFICA COMEMORATIVA AOS 40 ANOS DO CURSO DE MEDICINA VETERINÁRIA VII MOSTRA DA PÓS-GRADUAÇÃO EM CIÊNCIAS

Leia mais

Laboratório de Microbiologia, Departamento de Patologia, Universidade Federal do Maranhão, São Luís, Brasil 2

Laboratório de Microbiologia, Departamento de Patologia, Universidade Federal do Maranhão, São Luís, Brasil 2 REVISTA PORTUGUESA DE CIÊNCIAS VETERINÁRIAS Ocorrência de Escherichia coli produtora de toxinas "Shiga" (STEC) na microbiota intestinal de bovinos destinados ao abate no município de São Luís - MA / Brasil

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Caracterização fenotípica e genotípica de Escherichia coli, potencialmente patogênicas oriundas de estação de tratamento de água

Caracterização fenotípica e genotípica de Escherichia coli, potencialmente patogênicas oriundas de estação de tratamento de água ARTIGO ORIGINAL Caracterização fenotípica e genotípica de Escherichia coli, potencialmente patogênicas oriundas de estação de tratamento de água Phenotypic and genotypic characterization of potentially

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Desenvolvimento de PCR multiplex para detecção e diferenciação de categorias de Escherichia coli diarreiogênicas

Desenvolvimento de PCR multiplex para detecção e diferenciação de categorias de Escherichia coli diarreiogênicas doi: 10.5123/S2176-62232010000200009 ARTIGO ORIGINAL ORIGINAL ARTICLE ARTÍCULO ORIGINAL Desenvolvimento de PCR multiplex para detecção e diferenciação de categorias de Escherichia coli diarreiogênicas

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

OCTAVIANA BACCIN FIALHO

OCTAVIANA BACCIN FIALHO OCTAVIANA BACCIN FIALHO IDENTIFICAÇÃO DE ESTIRPES DE Escherichia coli DIARREIOGÊNICAS POR PCR-MULTIPLEX Dissertação apresentada como requisito parcial à obtenção de grau de Mestre em Ciências Farmacêuticas,

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Detecção de fatores de virulência de Escherichia coli através da PCR em tempo real

Detecção de fatores de virulência de Escherichia coli através da PCR em tempo real Detecção de fatores de virulência de Escherichia coli através da PCR em tempo real FABRÍCIO ALVES CERVEIRA 1 JOANA BITTENCOURT MATHIAS 2 YARA SILVA CASANOVA 3 BEATRIZ MACHADO TERRA LOPES 4 FERNANDA KIELING

Leia mais

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia XVIII Congresso Mundial de Epidemiologia e VII Congresso Brasileiro de Epidemiologia Avaliação do desempenho da técnica de nested- PCR em amostras de sangue coletadas de pacientes pediátricos com suspeita

Leia mais

Escherichia coli Enterohemorrágica O157:H7

Escherichia coli Enterohemorrágica O157:H7 Escherichia coli Enterohemorrágica O157:H7 Nomes populares Diarreia sanguinolenta, Colite hemorrágica, Agente causador Bacilo Gram-negativo - Famíla Enterobacteriacea - Escherichia coli produtora de verotoxinas

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Fatores de virulência das amostras de Escherichia coli isoladas de bezerros com diarréia na região de Feira de Santana, Bahia*

Fatores de virulência das amostras de Escherichia coli isoladas de bezerros com diarréia na região de Feira de Santana, Bahia* Fatores de virulência das amostras de Escherichia coli isoladas de bezerros com diarréia na região de Feira de Santana, Bahia* Karine de Oliveira Costa 1, Fernando Alzamora Filho 2, Joselito Nunes Costa

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Quim. Nova, Vol. XY, No. 00, S1-S5, 200_ TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Pedro L. R. da Cruz a, Leila R. Giarola b, Suellen da Silva Moraes a, Déborah

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO

PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO SEARCH OF VIRULENCE GENES FROM PATHOGENIC EXTRAINTESTINAL Escherichia

Leia mais

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC. RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.) 1. IDENTIFICAÇÃO DO PROJETO (item a ser preenchido pela

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA UNIR PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL RENATA SANTOS RODRIGUES

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA UNIR PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL RENATA SANTOS RODRIGUES 0 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA UNIR PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL RENATA SANTOS RODRIGUES CARACTERIZAÇÃO DAS CEPAS DE Escherichia coli ENTEROPATOGÊNICA (EPEC) TÍPICA E

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Protocolos de Microbiologia Clínica. Coprocultura

Protocolos de Microbiologia Clínica. Coprocultura Coprocultura Parte 2 - Outros enteropatógenos Carlos Henrique Pessôa de Menezes e Silva Doutor em Microbiologia Microbiologista do Centro Tecnológico de Análises (CETAN), Vila Velha-ES Consultor em Microbiologia

Leia mais

OCORRÊNCIA DE Escherichia coli O157:H7 EM BOVINOS ABATIDOS EM ESTABELECIMENTO HABILITADO À EXPORTAÇÃO NA CIDADE DE BARRETOS SP, BRASIL.

OCORRÊNCIA DE Escherichia coli O157:H7 EM BOVINOS ABATIDOS EM ESTABELECIMENTO HABILITADO À EXPORTAÇÃO NA CIDADE DE BARRETOS SP, BRASIL. 1 UNIVERSIDADE ESTADUAL PAULISTA FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL OCORRÊNCIA DE Escherichia coli O157:H7 EM BOVINOS ABATIDOS EM ESTABELECIMENTO HABILITADO À EXPORTAÇÃO

Leia mais

Escherichia coli e o Surto de Colite na Europa

Escherichia coli e o Surto de Colite na Europa Escherichia coli e o Surto de Colite na Europa Generalidades Prof.Dr. Josias Rodrigues Laboratório de Bacteriologia Médica Departamento de Microbiologia e Imunologia IBB/UNESP Email: josias@ibb.unesp.br

Leia mais

O NÚMERO DE BACTÉRIAS

O NÚMERO DE BACTÉRIAS O NÚMERO DE BACTÉRIAS A CONTAGEM EM PLACAS A contagem em placas é um dos métodos mais utilizados para determinar qual o número de microrganismos viáveis em um meio líquido. Quando a concentração é baixa,

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO:

Leia mais

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático)

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) VIRUS CONCEITOS E DEFINIÇÕES Características: 1. Não têm estrutura celular, mas multiplicam-se»

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL e SAÚDE PÚBLICA

PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL e SAÚDE PÚBLICA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL e SAÚDE PÚBLICA ÁGUA e SAÚDE: ABORDAGENS DE UMA ÚNICA SAÚDE Responsável: Maria das Graças Cabral Pereira e André Kipnis Número de créditos e carga horária:

Leia mais

Visão geral da construção de uma célula recombinante e alguns exemplos de sua aplicação

Visão geral da construção de uma célula recombinante e alguns exemplos de sua aplicação Genética bacteriana Prof. Adj. Ary Fernandes Junior Departamento de Microbiologia e Imunologia Instituto de Biociências UNESP Tel. 14 3880.0412 ary@ibb.unesp.br Visão geral da construção de uma célula

Leia mais

NORMA INTERNA DIPOA/SDA Nº 01, DE 17 DE JUNHO DE 2015

NORMA INTERNA DIPOA/SDA Nº 01, DE 17 DE JUNHO DE 2015 NORMA INTERNA DIPOA/SDA Nº 01, DE 17 DE JUNHO DE 2015 O DIRETOR DO DEPARTAMENTO DE INPEÇÃO DE PRODUTOS DE ORIGEM ANIMAL da, do Ministério da Agricultura, Pecuária e Abastecimento, no uso das atribuições

Leia mais

Universidade Federal de Juiz de Fora Programa de pós-graduação em Ciências da Saúde

Universidade Federal de Juiz de Fora Programa de pós-graduação em Ciências da Saúde Universidade Federal de Juiz de Fora Programa de pós-graduação em Ciências da Saúde Patrícia Guedes Garcia Ocorrência de Escherichia coli comensal e diarreiogênica na microbiota fecal de crianças com e

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina

Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resistência de Bactérias a Antibióticos Catarina Pimenta, Patrícia Rosendo Departamento de Biologia, Colégio Valsassina Resumo O propósito deste trabalho é testar a resistência de bactérias (Escherichia

Leia mais

RESUMO - ARTIGO ORIGINAL - 42º CONGRESSO BRASILEIRO DE MEDICINA VETERINÁRIA

RESUMO - ARTIGO ORIGINAL - 42º CONGRESSO BRASILEIRO DE MEDICINA VETERINÁRIA 1 RESUMO - ARTIGO ORIGINAL - 42º CONGRESSO BRASILEIRO DE MEDICINA VETERINÁRIA FREQUÊNCIA DE ARRITMIAS E ANÁLISE DE VARIABILIDADE DE FREQUÊNCIA CARDÍACA EM CÃES COM EHRLIQUIOSE MONOCÍTICA CRÔNICA FREQUENCY

Leia mais

Faculdade de Ciências Médicas da Santa Casa de SP Curso de Graduação em Enfermagem Autorização em 04/12/00 Parecer No. 1115/00

Faculdade de Ciências Médicas da Santa Casa de SP Curso de Graduação em Enfermagem Autorização em 04/12/00 Parecer No. 1115/00 PROGRAMA DA DISCIPLINA DE MICROBIOLOGIA Plano de Ensino Ano Letivo 2012 1º Semestre CHEFE DA DISCIPLINA: Profª Dra. Lycia Mara Jenné Mímica COORDENADOR DO CURSO: CORPO DOCENTE: Profª. Alessandra Navarini

Leia mais

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO Cynthia Germoglio Farias de Melo cynthia_fariasm@hotmail.com Rayner Anderson Ferreira do Nascimento raynerbiomedicina@gmail.com

Leia mais

INDICAÇÕES BIOEASY. Segue em anexo algumas indicações e dicas quanto à utilização dos Kits de Diagnóstico Rápido Bioeasy Linha Veterinária

INDICAÇÕES BIOEASY. Segue em anexo algumas indicações e dicas quanto à utilização dos Kits de Diagnóstico Rápido Bioeasy Linha Veterinária INDICAÇÕES BIOEASY Segue em anexo algumas indicações e dicas quanto à utilização dos Kits de Diagnóstico Rápido Bioeasy Linha Veterinária 1- ANIGEN RAPID CPV AG TEST BIOEASY PARVOVIROSE Vendas de Filhotes:

Leia mais

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED Alâna Costa de Oliveira 1, Marisa Chesky 2 Farmacêutica do Laboratório de Diagnóstico de Doenças

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

CARACTERIZAÇÃO BIOQUÍMICA, SUSCEPTIBILIDADE A ANTIMICROBIANOS E PERFIL PLASMIDIAL DE Escherichia coli SHIGA TOXIGÊNICA

CARACTERIZAÇÃO BIOQUÍMICA, SUSCEPTIBILIDADE A ANTIMICROBIANOS E PERFIL PLASMIDIAL DE Escherichia coli SHIGA TOXIGÊNICA MARIO RENE SIBUT MARES DE SOUZA CARACTERIZAÇÃO BIOQUÍMICA, SUSCEPTIBILIDADE A ANTIMICROBIANOS E PERFIL PLASMIDIAL DE Escherichia coli SHIGA TOXIGÊNICA Dissertação apresentada como requisito parcial à obtenção

Leia mais

CAPÍTULO 5.1 Otimização de técnica de descontaminação seletiva para isolamento de micobactérias a partir de amostras de cama de suínos

CAPÍTULO 5.1 Otimização de técnica de descontaminação seletiva para isolamento de micobactérias a partir de amostras de cama de suínos CAPÍTULO 5.1 Otimização de técnica de descontaminação seletiva para isolamento de micobactérias a partir de amostras de cama de suínos Virgínia Santiago Silva Beatris Kramer Arlei Coldebella 83 Introdução

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

GISELE SPREA IDENTIFICAÇÃO DAS PRINCIPAIS BACTÉRIAS GRAM NEGATIVAS PREDOMINANTES EM FEZES DIARRÉICAS DE CÃES COM GASTROENTERITE INFECCIOSA E SUA

GISELE SPREA IDENTIFICAÇÃO DAS PRINCIPAIS BACTÉRIAS GRAM NEGATIVAS PREDOMINANTES EM FEZES DIARRÉICAS DE CÃES COM GASTROENTERITE INFECCIOSA E SUA GISELE SPREA IDENTIFICAÇÃO DAS PRINCIPAIS BACTÉRIAS GRAM NEGATIVAS PREDOMINANTES EM FEZES DIARRÉICAS DE CÃES COM GASTROENTERITE INFECCIOSA E SUA SENSIBILIDADE AOS ANTIMICROBIANOS Dissertação apresentada

Leia mais

UNIVERSIDADE ESTADUAL PAULISTA- UNESP FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS-FCAV CÂMPUS DE JABOTICABAL-SP

UNIVERSIDADE ESTADUAL PAULISTA- UNESP FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS-FCAV CÂMPUS DE JABOTICABAL-SP UNIVERSIDADE ESTADUAL PAULISTA- UNESP FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS-FCAV CÂMPUS DE JABOTICABAL-SP Análise de cepas de Escherichia coli Shiga toxigênica (STEC) e E. coli patogênica extraintestinal

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

KEYLA FONSECA DA CUNHA

KEYLA FONSECA DA CUNHA UNIVERSIDADE FEDERAL DO ESPÍRITO SANTO CENTRO DE CIENCIAS DA SAÚDE PROGRAMA DE PÓS GRADUAÇÃO EM DOENÇAS INFECCIOSAS KEYLA FONSECA DA CUNHA DETECÇÃO E CARACTERIZAÇÃO DE PATOTIPOS DIARREIOGÊNICOS DE Escherichia

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

UTILIZAÇÃO DA ANÁLISE DE DNA MITOCONDRIAL PARA CARACTERIZAR A BIODIVERSIDADE DE LEVEDURAS ISOLADAS DA FERMENTAÇÃO DA CACHAÇA.

UTILIZAÇÃO DA ANÁLISE DE DNA MITOCONDRIAL PARA CARACTERIZAR A BIODIVERSIDADE DE LEVEDURAS ISOLADAS DA FERMENTAÇÃO DA CACHAÇA. UTILIZAÇÃO DA ANÁLISE DE DNA MITOCONDRIAL PARA CARACTERIZAR A BIODIVERSIDADE DE LEVEDURAS ISOLADAS DA FERMENTAÇÃO DA CACHAÇA. Lucas Carvalho Santiago¹; Waldesse Piragé de Oliveira Júnior². ¹Aluno do Curso

Leia mais

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Vanessa Diniz Barcelos Vasconcelos 2, Newton Portilho Carneiro 3 1 Trabalho financiado pelo CNPq/Fapemig

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

FERNANDA BATISTA DE ANDRADE. PADRONIZAÇÃO E AVALIAÇÃO DE PCR MULTIPLEX PARA O DIAGNÓSTICO DE Escherichia coli ENTEROAGREGATIVA TÍPICA E ATÍPICA

FERNANDA BATISTA DE ANDRADE. PADRONIZAÇÃO E AVALIAÇÃO DE PCR MULTIPLEX PARA O DIAGNÓSTICO DE Escherichia coli ENTEROAGREGATIVA TÍPICA E ATÍPICA FERNANDA BATISTA DE ANDRADE PADRONIZAÇÃO E AVALIAÇÃO DE PCR MULTIPLEX PARA O DIAGNÓSTICO DE Escherichia coli ENTEROAGREGATIVA TÍPICA E ATÍPICA Dissertação apresentada ao Programa de Pós- Graduação Interunidades

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Área de Biologia Craniofacial e Biomateriais

Área de Biologia Craniofacial e Biomateriais Bibliografia e tópicos para a prova de seleção 2013 (Mestrado / Doutorado) Área de Biologia Craniofacial e Biomateriais Tópicos - Mestrado e Doutorado (prova teórica*) *O candidato poderá excluir um número

Leia mais

DETECÇÃO E GENOTIPAGEM DO PAPILOMAVÍRUS HUMANO (HPV) EM MULHERES DAS CIDADES DE MARINGÁ E MARIALVA - PR

DETECÇÃO E GENOTIPAGEM DO PAPILOMAVÍRUS HUMANO (HPV) EM MULHERES DAS CIDADES DE MARINGÁ E MARIALVA - PR 25 a 28 de Outubro de 2011 ISBN 978-85-8084-055-1 DETECÇÃO E GENOTIPAGEM DO PAPILOMAVÍRUS HUMANO (HPV) EM MULHERES DAS CIDADES DE MARINGÁ E MARIALVA - PR Kallyandra Padilha 1 ; Jessica Zirondi Caitano

Leia mais

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO CUNHA, Marielton dos Passos 1 ; OLIVEIRA, Bruno Francesco Rodrigues de 1 ; RESENDE, Isa Murielly

Leia mais

Exercícios de Monera e Principais Bacterioses

Exercícios de Monera e Principais Bacterioses Exercícios de Monera e Principais Bacterioses 1. (Fuvest) O organismo A é um parasita intracelular constituído por uma cápsula protéica que envolve a molécula de ácido nucléico. O organismo B tem uma membrana

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR 1 MARCELA BENEVENTE [1], LUCIANA MOURA CAMPOS PARDINI [2], ADRIANA CAMARGO FERRASI [1,3], MARIA INES DE MOURA CAMPOS PARDINI [3], ALINE FARIA GALVANI [3], JOSE JOAQUIM TITTON RANZANI [2] 1. Instituto de

Leia mais

Diagnóstico Microbiológico

Diagnóstico Microbiológico Diagnóstico Microbiológico Identificação e Tipagem Bacteriana Prof. Vânia Lúcia Diagnóstico clínico Sinais (mensuráveis) e sintomas (subjetivos) Origem Etiologia Natureza Diagnóstico laboratorial Identificação

Leia mais

Gráfico 1: Frequência das formas clínico-histopatológicas da hanseníase, representada em porcentagem de casos.

Gráfico 1: Frequência das formas clínico-histopatológicas da hanseníase, representada em porcentagem de casos. 37 5-RESULTADOS Do total de 128 amostras estudadas, obtidos de 128 pacientes, 66 casos (51,56%) foram do sexo masculino e 62 casos (48,48%) do sexo feminino. A idade dos pacientes variou de 03 anos a 88

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

RESUMOS COM RESULTADOS... 170 RESUMOS DE PROJETOS... 172 ARTIGOS COMPLETOS (RESUMOS)... 178

RESUMOS COM RESULTADOS... 170 RESUMOS DE PROJETOS... 172 ARTIGOS COMPLETOS (RESUMOS)... 178 169 RESUMOS COM RESULTADOS... 170 RESUMOS DE PROJETOS... 172 ARTIGOS COMPLETOS (RESUMOS)... 178 RESUMOS COM RESULTADOS 170 POTENCIAL NA TRANSMISSÃO DE BACTÉRIAS POR BARATAS BLATELLA GERMANICA CAPTURADAS

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

Bactérias de importância no TGI

Bactérias de importância no TGI Universidade Federal de Juiz de Fora Instituto de Ciências Biológicas Departamento de Parasitologia, Microbiologia e Imunologia Bactérias de importância no TGI Família Enterobacteriaceae Bacilos Gram negativos

Leia mais

DETECÇÃO DO GENE eae EM AMOSTRAS DE Escherichia coli (AEEC) ISOLADAS DE COELHOS DE CRIAÇÕES DO ESTADO DE SÃO PAULO, BRASIL

DETECÇÃO DO GENE eae EM AMOSTRAS DE Escherichia coli (AEEC) ISOLADAS DE COELHOS DE CRIAÇÕES DO ESTADO DE SÃO PAULO, BRASIL 207 ARS VETERINARIA, 17(3):207-212, 2001. DETECÇÃO DO GENE eae EM AMOSTRAS DE Escherichia coli (AEEC) ISOLADAS DE COELHOS DE CRIAÇÕES DO ESTADO DE SÃO PAULO, BRASIL (CHARACTERIZATION OF eae GENE IN Escherichia

Leia mais

PlanetaBio Resolução de Vestibulares UFRJ 2007 www.planetabio.com

PlanetaBio Resolução de Vestibulares UFRJ 2007 www.planetabio.com 1-O gráfico a seguir mostra como variou o percentual de cepas produtoras de penicilinase da bactéria Neisseria gonorrhoeae obtidas de indivíduos com gonorréia no período de 1980 a 1990. A penicilinase

Leia mais