Universidade Técnica de Lisboa Instituto Superior de Agronomia

Transcrição

1 Universidade Técnica de Lisboa Instituto Superior de Agronomia Influência das raças bovinas Ibéricas na estrutura genética das populações de bovinos Crioulos da América Latina Catarina Jorge Ginja Orientador: Doutor Luís Lavadinho Telo da Gama Co-orientador: Doutora Maria Cecília Torres Penedo Júri: Presidente: Reitor da Universidade Técnica de Lisboa Vogais: Doutora Maria Teresa Rangel de Figueiredo, Professora Catedrática da Universidade de Trás-os-Montes e Alto Douro Doutor João Pedro Bengala Freire, Professor Catedrático do Instituto Superior de Agronomia da Universidade Técnica de Lisboa Doutor Luís Lavadinho Telo da Gama, Professor Catedrático Convidado da Faculdade de Medicina Veterinária da Universidade Técnica de Lisboa Doutor José António dos Santos Pereira Matos, Investigador Auxiliar do Instituto Nacional de Engenharia, Tecnologia e Inovação, l.p. Doutor Albano Gonçalo Beja-Pereira, Investigador do Centro de Investigação em Biodiversidade e Recursos Genéticos da Universidade do Porto, na qualidade de especialista Doutora Maria Cecília Torres Penedo, Associate Director of Veterinary Genetics Laboratory of University of California, Estados Unidos da América Doutoramento em Engenharia Zootécnica Lisboa 2009

2

3 Universidade Técnica de Lisboa Instituto Superior de Agronomia Influência das raças bovinas Ibéricas na estrutura genética das populações de bovinos Crioulos da América Latina Catarina Jorge Ginja Tese apresentada neste Instituto para a obtenção do grau de Doutor Orientador: Doutor Luís Lavadinho Telo da Gama Co-orientador: Doutora Maria Cecília Torres Penedo Júri: Presidente: Reitor da Universidade Técnica de Lisboa Vogais: Doutora Maria Teresa Rangel de Figueiredo, Professora Catedrática da Universidade de Trás-os-Montes e Alto Douro Doutor João Pedro Bengala Freire, Professor Catedrático do Instituto Superior de Agronomia da Universidade Técnica de Lisboa Doutor Luís Lavadinho Telo da Gama, Professor Catedrático Convidado da Faculdade de Medicina Veterinária da Universidade Técnica de Lisboa Doutor José António dos Santos Pereira Matos, Investigador Auxiliar do Instituto Nacional de Engenharia, Tecnologia e Inovação, l.p. Doutor Albano Gonçalo Beja-Pereira, Investigador do Centro de Investigação em Biodiversidade e Recursos Genéticos da Universidade do Porto, na qualidade de especialista Doutora Maria Cecília Torres Penedo, Associate Director of Veterinary Genetics Laboratory of University of California, Estados Unidos da América Doutoramento em Engenharia Zootécnica Lisboa 2009

4

5 O presente trabalho foi realizado na Estação Zootécnica Nacional, em Vale de Santarém, e no Laboratório de Genética Veterinária da Universidade da Califórnia, em Davis, tendo sido financiado pela Fundação para a Ciência e a Tecnologia através de uma bolsa de doutoramento (SFRH/BD/13502/2003). Complementarmente obteve, também, financiamento da Direcção Geral de Veterinária, da Sociedade Portuguesa de Recursos Genéticos Animais e do Laboratório de Genética Veterinária da Universidade da Califórnia.

6

7 De início, o fim não é visível. Heródoto

8

9 À minha avó materna

10

11 AGRADECIMENTOS No final deste percurso de cinco anos de investigação houve espaço para motivação, desânimo, alegrias e infelicidades. Foram muitos os que de alguma forma contribuíram para a concretização deste estudo e por isso lhes quero deixar aqui o meu mais profundo agradecimento. Ao Professor Doutor Luís Lavadinho Telo da Gama, Director do Departamento de Genética e Melhoramento Animal da Estação Zootécnica Nacional, pelo desafio que me colocou, pela confiança que sempre depositou em mim, pela orientação, revisão e correcção do trabalho. À Fundação para a Ciência e a Tecnologia por ter providenciado a ajuda financeira necessária ao desenvolvimento deste trabalho no âmbito da bolsa de Doutoramento que me foi atribuída. Ao Professor Doutor João Manuel Ramalho Ribeiro, Director da Estação Zootécnica Nacional, por ter disponibilizado as instalações necessárias à realização deste trabalho, nomeadamente para o estabelecimento de um Banco de DNA das raças bovinas autóctones de Portugal. Aos meus colegas do Departamento de Genética e Melhoramento Animal da Estação Zootécnica Nacional, Dr. Nuno Carolino, Engenheira Inês Carolino, Engenheira Fátima Santos Silva, Dr. Conceição Oliveira e Sousa, e Dr. Rosário Marques pelo apoio que me deram, à D. Elisa pela prontidão com que sempre tratou dos assuntos burocráticos, à D. Esperança que é uma excelente técnica e companheira de laboratório, à D. Isabelina pelos doces com que me presenteou. Ao Dr. Mário Costa e à Dr. Filomena Afonso, da Direcção de Serviços de Produção e Melhoramento Animal da Direcção Geral de Veterinária, e à Sociedade Portuguesa de Recursos Genéticos Animais pelo apoio financeiro fornecido para a implementação do Banco de DNA das raças bovinas autóctones de Portugal. Às Associações de Produtores de bovinos que apoiaram o extenuante mas, também, gratificante processo de recolha de amostras, e em particular ao Engenheiro Pedro Espadinha, ao Engenheiro Carlos Bigares, ao Engenheiro Cirnes, ao Engenheiro Manuel Machado, ao Dr. José Vieira Leite, ao Engenheiro Rui Dantas, ao Dr. Vasco Almeida, ao Dr. Joaquim Grave, ao Engenheiro Samuel Pinto, ao Dr. Carlos Bettencourt, Engenheiro Jaime Bento, ao Engenheiro Vaz, ao Professor Doutor Virgílio Alves, ao Engenheiro José Pais, ao Engenheiro Nuno Henriques, ao Engenheiro Humberto Machado, ao Engenheiro Fernando Sousa, ao Dr. Canas Simões, à Engenheira Filomena Ferreira, à Engenheira Ana Luísa Pavão. Ao Dr. Manuel Abreu do Matadouro Regional do Alto Alentejo, em Sousel, bem como à Dr. Cristina do Matadouro Regional do Ribatejo Norte, em Santarém, pela ajuda na recolha de amostras de animais da raça Brava de Lide. Ao meu primo Dr. Mário Ginja pela ajuda imprescindível na recolha de amostras e pela boa disposição durante longas horas de trabalho de campo. À Rede Iberoamericana para a Conservação da Biodiversidade de Animais Domésticos Locais e para o Desenvolvimento Rural Sustentável (Rede CYTED XII-H), nomeadamente ao coordenador Dr. Juan Vicente Delgado, à Dr. Amparo Martínez e ao Dr. José Luís Vega Pla pelo incentivo, xi

12 Agradecimentos pelo interesse neste projecto, pelo carinho com que me acolheram em Córdova, e por toda a colaboração na realização deste estudo. Um agradecimento muito especial aos Colegas da América Latina que contribuíram com amostras de bovinos Crioulos e cuja ajuda foi fundamental para a elaboração deste trabalho de investigação, nomeadamente à Dr. Lilia Melluci (Argentina), à Engenheira Maria Antónia Revidatti (Argentina), ao Dr. Jorge Quiróz (México), e ao Dr. Roberto Martínez López (Paraguay). À Dr. Amparo Martínez pelo envio de amostras das raças de Espanha e ao Dr. Vincenzo Landi pela ajuda na revisão dos genótipos de microssatélites nestas raças. Aos colegas e amigos do Instituto Nacional de Engenharia, Tecnologia e Inovação, Dr. José Matos, Dr. Fernanda Simões e Dr. Elisabete Pires pela motivação que sempre demonstram, apesar de todas as dificuldades inerentes à realização de trabalhos de investigação em Portugal, pelo exemplo que constituem. Ao Professor Doutor Raul Bruno de Sousa do Instituto Superior de Agronomia pela sua disponibilidade e apoio. Às minhas amigas Íris e Carolina pelo apoio emocional, pelos sorrisos, pela sua integridade, enfim pela amizade que retribuo com gratidão. À minha amiga Elisabete pelo companheirismo, por rever cuidadosamente os artigos científicos inerentes a este estudo e o texto final desta tese, pela persistência, o meu mais sincero obrigada. Aos meus amigos Zélia Carvalhais e ao Francisco Vasconcelos, que são a minha família adoptiva, pelo abrigo carinhoso que sempre me deram. Ao Sr. Joaquim, à D. Isabel, ao Armando e à Paula, pela ajuda nas três mudanças de casa, pelo carinho com que me recebem, por todo o apoio moral, financeiro e pessoal. Ao meu irmão porque apesar de resmungar disponibiliza-se sempre para ajudar e porque me transmitiu o gosto pelos animais e pela natureza. A ele e à Ana Pinto um agradecimento especial por cuidarem dos meus gatos durante a minha já longa ausência. Aos meus pais por tudo o que me ensinaram! À minha mãe pela força e coragem com que enfrenta a vida, pelos mimos que encurtaram a distância entre Portugal e a Califórnia, pelas longas horas de desabafos, e acima de tudo pelo amor incondicional. Ao meu pai, pela determinação, pelo rigor, pelo gosto pela Cultura, ele que é o responsável pelos livros que fui lendo com imenso prazer ao longo destes últimos três anos na Califórnia e que me ajudaram a manter o contacto com a Língua Portuguesa, alargaram os meus horizontes, e reforçaram a minha vontade de conhecer o Mundo. Ao Joaquim por estar sempre ao meu lado, mesmo quando este percurso pareceu demasiado longo, pelo apoio incondicional, pelo companheirismo e algo mais que é difícil descrever por palavras. Aos meus gatos porque foram abandonados por mim sem perceberem porquê! xii

13 ACKNOWLEDGMENTS I thank Dr. Niels Pedersen, Director of the Veterinary Genetics Laboratory at the University of California, in Davis, for giving me the opportunity to visit and work in this laboratory. The technical and financial support obtained from the Veterinary Genetics Laboratory was essential to accomplish this study. I thank Dr. Cecília Penedo for the strong support she always gave me during the time spent in the Veterinary Genetics Laboratory, for her guidance and mentorship, for carefully revising the scientific manuscripts, and for her friendship throughout the years. I am grateful for the support provided by all members of the Veterinary Genetics Laboratory, particularly by my colleagues Angel Del Valle, Thea Ward, Stephanie Bricker and Leah Brault for their help in the laboratory. I also thank the Service Unit of the Veterinary Genetics Laboratory for their technical support, namely Larry Gordon, Glen Byrns, Mona Christiansen and Julia Malvick. I thank Ben Sacks, Sarah Brown and Mark Statham for useful discussions and comments regarding my research. I wish to leave a special thank to Angel Del Valle for his friendship, encouragement, and interesting discussions during our funny lunch times. I thank Beth, Dennis and Olivia Greenwood for being such a nice family and providing a pleasant environment during my stay at their house. I am also grateful to Robert Murphey for his friendship, for interesting trips around California, for preparing pleasant dinners and the best Caipirinhas which were a relief after long working hours. A special thank to my friends in Davis, whom contributed to make my stay really pleasant and funny, namely my housemate Helena, Diego, Joana, Donatella, Maria, Rosa and Mario, Aura and Pepe, Michael, Marina, Giuseppe, Sandra and Jeff, Jerome, Mari Paz, Marco, Daniel, and many other members of this rich international community! xiii

14

15 RESUMO A diversidade, estrutura genética e as origens dos bovinos Iberoamericanos foram investigadas através de polimorfismos de DNA mitocondrial, cromossoma Y e microssatélites. Os bovinos Ibéricos apresentaram elevada diversidade e estrutura genética e alguma influência de raças exóticas. A contribuição de bovinos Africanos para as raças Ibéricas foi inferida pelos haplotipos maternos T1a e pelo alelo paterno INRA As linhagens Y1 Ibéricas podem reflectir influência de auroques. A proximidade genética entre raças Crioulas e Ibéricas reflectiu-se na partilha de haplotipos maternos e paternos. A linhagem materna Europeia foi a mais comum entre Crioulos, seguida das linhagens Africanas T1a e AA. O Caracú apresentou uma linhagem paterna distinta que sugere a introdução directa de bovinos Africanos. A variação genética está estruturada geograficamente, com 62% da variação genética paterna explicada pelas diferenças entre raças, enquanto as diferenças entre indivíduos justificaram >88% da variação materna e de microssatélites. As análises Bayesianas demonstraram que os Crioulos retêm sinais da influência Ibérica, principalmente o Argentino e Caracú, mas apresentam heterogeneidade devida a cruzamentos com zebu e Hereford. As raças Palmera, Mirandesa e Caracú foram as que mais influenciaram a diversidade genética global. Estudos que incluam raças Africanas podem ajudar a elucidar sobre as origens dos Crioulos. Palavras-chave: bovinos Crioulos; raças autóctones Ibéricas; marcadores moleculares; caracterização genética; conservação xv

16

17 INFLUENCE OF IBERIAN CATTLE BREEDS ON THE GENETIC STRUCTURE OF EXTANT CREOLE CATTLE ABSTRACT POPULATIONS OF LATIN AMERICA The genetic diversity, structure and origins of Iberian and Creole cattle from the Americas were investigated with mitochondrial, Y chromosome, and microsatellite polymorphisms. Iberian cattle showed high genetic diversity and breed structuring, although influence of imported breeds was also detected. Influence of African cattle in Iberia was inferred from the presence of T1a matrilines and INRA Y-allele. Iberian Y1 patrilines could reflect ancient influence of aurochs. Among Creole matrilines, the European T3 was prevalent, followed by the African T1a and AA lineages. Genetic proximity among Creoles and Iberian breeds was reflected through their sharing of mtdna and Y chromosome haplotypes. Caracú had a distinct patriline, which suggested direct introduction of cattle from Africa. Genetic variation was geographically structured, with breed differences explaining 62% of patriline variation, whereas individual differences accounted for >88% of mtdna and microsatellite variation. Bayesian clustering showed that Creoles retain signatures of Iberian ancestry, mainly Argentinean and Caracú, and disclosed genetic heterogeneity from admixture with zebu and Hereford. The breeds Palmera, Mirandesa and Caracú were genetically distinct and had the highest contribution to overall genetic diversity. Additional studies of African breeds can further elucidate the origins of Creoles and help identifying the source of the African lineages. Keywords: Creole cattle; Iberian native breeds; molecular markers; genetic characterization; conservation xvii

18

19 Índice Índice AGRADECIMENTOS XI ACKNOWLEDGMENTS XIII RESUMO XV ABSTRACT XVII CAPÍTULO 1. INTRODUÇÃO GERAL ORIGENS E DOMESTICAÇÃO DOS BOVINOS OS BOVINOS DO VELHO E DO NOVO MUNDO MARCADORES GENÉTICOS E O ESTUDO DAS ORIGENS, DA DIVERSIDADE E DA ESTRUTURA GENÉTICA DE POPULAÇÕES Microssatélites autossómicos DNA mitocondrial Cromossoma Y OBJECTIVOS 21 CAPÍTULO 2. Y CHROMOSOME HAPLOTYPE ANALYSIS IN PORTUGUESE CATTLE BREEDS USING SNPS AND STRS INTRODUCTION MATERIAL AND METHODS Sampling and DNA extraction Sequencing and SNP detection through Pyrosequencing Microsatellite genotyping Statistical Analysis RESULTS Genetic diversity Differentiation and AMOVA Phylogenetic Analysis DISCUSSION FUTURE PERSPECTIVES 46 CAPÍTULO 3. ORIGINS AND GENETIC DIVERSITY OF NEW WORLD CREOLE CATTLE: INFERENCES FROM MITOCHONDRIAL AND Y CHROMOSOME POLYMORPHISMS INTRODUCTION MATERIALS AND METHODS Sample collection and DNA extraction PCR amplification and mtdna sequencing Statistical Analysis of mtdna data Analysis of Y chromosome SNPs and STRs RESULTS mtdna haplotype diversity mtdna differentiation and AMOVA mtdna phylogenetics Y chromosome diversity Y chromosome differentiation and AMOVA Y chromosome phylogenetics DISCUSSION 70 xix

20 CAPÍTULO 4. ANALYSIS OF STR MARKERS REVEALS HIGH GENETIC STRUCTURE IN PORTUGUESE NATIVE CATTLE INTRODUCTION MATERIAL AND METHODS Sampling and DNA extraction STR genotyping Statistical Analysis RESULTS Molecular markers Within-breed genetic diversity Genetic relationship between breeds Genetic structure and admixture analysis DISCUSSION 89 CAPÍTULO 5. GENETIC DIVERSITY AND STRUCTURE OF CREOLE CATTLE BASED ON STRS: A CONSERVATION PERSPECTIVE INTRODUCTION MATERIAL AND METHODS Sampling and DNA extraction STR genotyping Statistical analysis RESULTS Molecular markers Genetic diversity Genetic relationships among Old and New World cattle Genetic structure and admixture in Creoles Conservation perspective DISCUSSION 114 CAPÍTULO 6. CONSIDERAÇÕES FINAIS E PERSPECTIVAS FUTURAS CONSIDERAÇÕES FINAIS PERSPECTIVAS FUTURAS 125 DIVULGAÇÃO DO CONHECIMENTO 129 REFERÊNCIAS BIBLIOGRÁFICAS 133 ANEXOS 149 ANEXO I. FIGURAS E TABELAS SUPLEMENTARES AO CAPÍTULO ANEXO II. FIGURAS E TABELAS SUPLEMENTARES AO CAPÍTULO ANEXO III. FIGURAS E TABELAS SUPLEMENTARES AO CAPÍTULO ANEXO IV. FIGURAS E TABELAS SUPLEMENTARES AO CAPÍTULO 5 227

21 Capítulo 1 INTRODUÇÃO GERAL

22

23 CAPÍTULO 1. INTRODUÇÃO GERAL 1.1. Origens e domesticação dos bovinos Investigações recentes têm demonstrado que a domesticação animal foi um processo gradual extremamente complexo e que não está ainda completamente esclarecido (Zeder 2008). A domesticação dos bovinos remonta à data da revolução agrícola do Neolítico e ocorreu há aproximadamente anos atrás, primariamente na região do Crescente Fértil (Geigl 2008). A combinação de informação arqueológica e molecular constitui a base de uma nova disciplina, a arqueogenética (Renfrew 2001), que tem contribuído para um melhor entendimento sobre as origens das várias espécies de animais domésticos e sobre a sua dispersão pelo globo, em paralelo com as diversas comunidades humanas (Zeder et al 2006). O DNA ancestral (adna) permite estudar a constituição genética de bovinos selvagens e, também, dos pré-domésticos, para investigar as origens evolutivas das raças domésticas modernas (Zeder et al. 2006). No entanto, existem limitações associadas à qualidade do adna que se consegue obter a partir de material biológico antigo e à dificuldade em replicar os resultados, e que estão intimamente ligadas às condições de humidade e temperatura dos locais onde estas amostras são recolhidas (Cooper & Poinar 2000; Geigl 2008). O auroque (Bos primigenius) é considerado o ancestral selvagem dos bovinos domésticos cujo último exemplar desapareceu na Polónia em 1627 (http: Felius 1985). Estes animais encontravam-se dispersos por uma vasta área do globo, que abrangia as Ilhas Britânicas, uma grande parte do território Europeu, o norte de África, o Médio Oriente, a Ásia Central e a Índia, e deram origem à maioria das populações de bovinos domésticos hoje existentes na Europa continental (Troy et al. 2001; Geigl 2008). A dispersão das populações de bovinos domésticos a partir do Médio Oriente parece ter seguido duas rotas principais: Danúbio e Mediterrâneo (Cymbron et al. 2005). Os bovinos da região do Mediterrâneo e da Península Ibérica têm origem em animais que se dispersaram a partir do Médio Oriente através de uma via continental, mas também em animais introduzidos por mar, nomeadamente a partir do Norte de África (Zilhão 2001; Beja- Pereira et al. 2006; Pellecchia et al. 2007), pelo que a contribuição do auroque para a 3

24 Capítulo1 Introdução geral composição genética de raças bovinas modernas é hoje amplamente discutida (Beja-Pereira et al. 2006). Informação obtida a partir de adna da Europa do Norte e Central parece indicar que os bovinos domésticos dessas regiões constituem uma reminiscência dos seus ancestrais selvagens, e representam apenas uma pequena parte da variabilidade genética inicialmente existente nos auroques, mas também que a hibridação entre fêmeas selvagens e touros já domesticados foi um acontecimento raro (Edwards et al. 2007b; Geigl 2008). Por outro lado, a análise de marcadores moleculares específicos do cromossoma Y sugeriu a contribuição de touros selvagens para as populações bovinas actualmente existentes na Europa (Gotherstrom et al. 2005). O estudo de amostras de adna provenientes do Sul da Europa confirmou a presença de material genético de fêmeas auroques em bovinos domésticos modernos, o que parece indicar que, pelo menos em alguns locais, existiram processos de hibridação entre populações de animais selvagens e domésticos, mas também que no Norte e no Sul da Europa havia formas distintas de criação de animais domésticos (Anderung et al. 2005; Beja-Pereira et al. 2006; Achilli et al. 2008). As raças taurinas Africanas têm origem num processo de domesticação independente, a partir do B. p. opisthonomous e que terá ocorrido há anos atrás na região Nordeste do continente Africano (Wendorf & Schild 1994; Bradley et al. 1996; Hanotte et al. 2002). Os primeiros bovinos Africanos terão sido B. taurus existentes no deserto do Sahara e na Abissínia, tendo-se expandido ate à costa Oeste, e também para Sul (Hanotte et al. 2000; Hanotte et al. 2002). A maioria das raças autóctones taurinas Africanas sofreu introgressão com gado zebu, excepto os bovinos da costa Oeste do continente (e.g. raças N Dama e Baoulé), pois são resistentes à tripanossomíase, cuja incidência é elevada nestas regiões, o que lhes confere uma vantagem grande em termos de adaptação (Bradley et al. 1994; Hanotte et al. 2000). Os bovinos com bossa denominados zebu (B. indicus) foram domesticados há cerca de anos no vale do Indo, na região do actual Paquistão, a partir da subespécie B. p. nomadicus (Loftus et al. 1994). Análises moleculares demonstraram uma enorme divergência genética entre B. taurus e B. indicus, e que as duas (sub)espécies divergiram há mais de anos, o que é consistente com a ocorrência de processos independentes de domesticação (Loftus et al. 1994). O gado zebu terá surgido inicialmente na Índia e só mais tarde foi introduzido em África (Bradley et al. 1996). Um estudo exaustivo de várias 4

25 Capítulo1 Introdução geral populações de bovinos Africanos demonstrou que a influência de zebu se concentra na costa Este de África, e resulta maioritariamente da introdução de animais por via marítima, através de rotas comerciais pelo Oceano Índico (Hanotte et al. 2002; Zeder et al. 2006). Foi sugerida a ocorrência de um quarto processo de domesticação independente de bovinos na região Nordeste da Ásia (Mannen et al. 2004), mas este não foi comprovado, podendo estar apenas relacionado com a hibridação entre auroques da Eurásia e bovinos domésticos locais com origem no Médio Oriente (FAO 2007). A área de dispersão dos auroques era tão vasta que não é improvável terem ocorrido processos de domesticação em diversos locais e em épocas distintas (Diamond 2002). Ao longo dos tempos os animais domésticos foram sendo moldados pelas mais diversas civilizações humanas, que os seleccionaram em função das suas conveniências de tal forma que, juntamente com a deriva genética e a adaptação a ambientes específicos, foram originadas as inúmeras populações que hoje existem. As raças de animais domésticos constituem grupos de animais com características distintas, seleccionadas pelo Homem, e que são herdadas entre gerações (Clutton-Brock 1999). A importância dos bovinos enquanto animais domésticos é inegável, tendo o processo de domesticação e subsequente fragmentação e selecção originado um número considerável de raças (> 800), que representam aproximadamente 22 % das raças de mamíferos do Mundo (FAO 2007). No entanto, e de acordo com a Food and Agriculture Organization (FAO), estes recursos genéticos estão ameaçados, e estima-se que nos últimos seis anos se perderam 62 raças domésticas, à escala de uma por mês, e que aproximadamente 20 % das raças documentadas estão em risco de extinção (FAO 2007). Acresce ainda o facto de, para muitas das raças, não existir informação detalhada sobre os efectivos ou a sua diversidade genética. As inúmeras raças locais, que são o resultado de vários anos de evolução, têm vindo a ser gradualmente substituídas por um número reduzido de raças comerciais altamente produtivas. Globalmente, existem dois grupos de raças que se distribuíram a nível Mundial: as de origem Europeia e as do Sul da Ásia (FAO 2007). No primeiro grupo, a raça mais difundida foi a Holstein-Friesian, mas também raças como a Jersey e a Charolesa. No segundo grupo incluem-se as raças Brahman e Gir, tendo a primeira sido desenvolvida nos 5

26 Capítulo1 Introdução geral Estados Unidos da América (E.U.A.), a partir de animais importados da Índia. O cruzamento indiscriminado de bovinos comerciais com raças locais, com o objectivo de maximizar a produção, tem provocado a erosão e consequente desintegração das raças autóctones. Por outro lado, as raças comerciais tendem a ter níveis de consanguinidade elevados e têm um tamanho efectivo reduzido (< 50), apesar do número total de animais ser elevado, pelo que a sua diversidade genética está também ameaçada (Taberlet et al. 2008). A manutenção da diversidade genética inerente às raças domésticas é essencial para poder continuar a seleccionar animais em função das necessidades da população humana, assegurando a exploração sustentada e a longo prazo destes recursos. A preservação das raças de animais domésticos é, também, importante pelo valor histórico e sociocultural que lhes está associado. É unânime a necessidade de caracterizar os recursos genéticos de animais domésticos (AnGr), para poder implementar medidas de conservação adequadas, e identificar as raças prioritárias a preservar (FAO 2007). É fundamental analisar a estrutura demográfica destas populações e estimar parâmetros demográficos, tais como o tamanho efectivo da população, a contribuição genética de animais fundadores e ascendentes, e a evolução da consanguinidade, para poder implementar programas de conservação e melhoramento (Carolino & Gama 2008). As técnicas moleculares constituem um instrumento essencial para a caracterização da diversidade genética destas raças, para estudar as suas origens, para esclarecer as possíveis relações evolutivas entre populações de animais domésticos, e também para auxiliar na definição de medidas de conservação (Bruford et al. 2003). O desafio que se coloca em termos da preservação dos AnGr é enorme, pois implica considerar vários factores, como sejam as peculiaridades de cada raça, a sua contribuição para a diversidade genética global, o seu valor cultural e económico (nomeadamente em regiões marginais), estando no entanto condicionada pela disponibilidade de recursos financeiros e implicando o envolvimento de autoridades internacionais e locais. 6

27 Capítulo1 Introdução geral 1.2. Os bovinos do Velho e do Novo Mundo Os bovinos foram introduzidos no continente Americano pelos colonizadores Europeus após a primeira viagem de Cristóvão Colombo, em 1492, ao serviço do reino de Castela (Espanha). Os primeiros animais foram transportados apenas na segunda expedição de Colombo, no ano de 1493, que se destinava à colonização do território que se julgava ser o das Índias (Primo 2004). Durante as primeiras duas décadas o número de animais transportado para o Novo Mundo foi pequeno e concentrou-se nas ilhas das actuais Caraíbas (Rouse 1977). A informação sobre o tipo e o aspecto dos animais transportados desde a Península Ibérica para as Américas é escassa, e supõe-se que os bovinos existentes em Espanha e Portugal na época dos Descobrimentos eram idênticos (Rouse 1977). Bishko (1952) refere que na época Medieval os bovinos domésticos da Península Ibérica se encontravam nas zonas húmidas do Norte, desde a região centro de Portugal, atravessando a Galiza em direcção à Cantábria e ao vale dos Pirenéus, até a Catalunha. Estes animais eram criados em efectivos pequenos, para trabalho e produção de carne e leite, e pertenciam às raças autóctones Ibéricas que persistiram nestas regiões até aos dias de hoje: Galega/Minhota, Barrosã, Arouquesa, Mirandesa, Asturiana e Pirenaica (Bishko 1952). Nas regiões mais áridas do Sul da Península Ibérica e à medida que a conquista do território aos Mouros foi avançando, estabeleceu-se a exploração de bovinos em regime de pastoreio extensivo, sendo os animais extremamente heterogéneos, de pelagem castanha escura, vermelha ou preta, supostamente resultantes de cruzamentos entre as raças das zonas húmidas e de bovinos selvagens da Península Ibérica (Bishko 1952). Estes animais eram famosos pela sua corpulência e bravura, eram mantidos num estado semi-selvagem, e deram origem ao denominado gado bravo (Bishko 1952; Cortes et al. 2008). Existem, também, registos da introdução de bovinos provenientes do Norte de África durante a ocupação Árabe, provavelmente ancestrais das raças que hoje existem em Marrocos, e que eram substancialmente diferentes do gado Ibérico (Bishko 1952; Rouse 1977). Se por um lado os bovinos do Sul da Ibéria constituíram a principal fonte de animais introduzidos no Novo Mundo, por outro também há registos de bovinos transportados desde o Norte de Portugal e da Galiza (Primo 1992; Rodero et al. 1992). 7

28 Capítulo1 Introdução geral Os colonizadores Espanhóis introduziram animais maioritariamente nas Grandes Antilhas e destas ilhas para o continente (Figura 1.1), à medida que foram avançando desde Española (República Dominicana) para Porto Rico, Jamaica e Cuba (Rouse 1977). O porto de Sevilha foi o ponto de partida da maior parte das expedições Espanholas, sendo frequente efectuar paragem nas Ilhas Canárias para abastecimento (Rodero et al. 1992). Os primeiros bovinos foram transportados desde as Antilhas para o continente Americano, para a região do Istmo do Panamá ( ), para o território denominado de Nova Espanha (1521) que corresponde ao actual México, para a Colômbia (1525), e para a Venezuela (1527) (Rouse 1977; Primo 2004). Os Portugueses transportaram animais para o Brasil após a sua descoberta, em 1500, por Pedro Álvares Cabral (Primo 2004). Os primeiros bovinos chegaram ao Brasil, juntamente com outros animais domésticos, apenas em 1533, na expedição de Martín Afonso de Sousa que resultou na fundação da primeira Capitania Portuguesa na ilha de São Vicente (Primo 2004). No final do século XVI havia já uma grande abundância de bovinos na região do litoral Brasileiro e em todas as Capitanias Portuguesas (Primo 2004). De forma análoga à dos conquistadores Espanhóis, os Portugueses partiam maioritariamente do Sul de Portugal, do Cabo de São Vicente no Algarve, e efectuavam paragens para abastecimento nas Ilhas Atlânticas sob o seu domínio, nomeadamente na Madeira e em Cabo Verde (Figura 1.1.) (Primo 1992; Rodero et al. 1992; Primo 2004). Os Portugueses governaram o Brasil até à altura da independência do país em A dispersão dos bovinos de origem Ibérica acompanhou o processo de colonização à medida que os conquistadores foram avançando pelo continente Americano. Estes bovinos constituíram o denominado gado Crioulo, que se adaptou aos mais diversos ambientes: aos climas semi-árido (México), sub-húmido (Colômbia, Venezuela, e região centro do Brasil) e húmido dos trópicos (América central, Caraíbas e Brasil); às regiões de montanha (Andes, América Central e México); e às zonas áridas (Patagonia, Nordeste Argentino, deserto de Atacama, Nordeste Brasileiro) (Rodero et al. 1992; FAO/UNEP 2000). 8

29 Capítulo1 Introdução geral Figura 1.1. Ilustração das principais rotas de colonização das Américas por Espanhóis (linha a cheio) e Portugueses (linha picotada) na época dos Descobrimentos (séculos XV a XVII). Do pequeno grupo de animais inicialmente introduzido (< 1.000) constituíram-se diversos tipos de bovinos Crioulos, que se diferenciaram entre si, e que têm uma variabilidade fenotípica enorme (Rouse 1977). No entanto, as semelhanças entre estes animais e os bovinos da Península Ibérica são ainda hoje notórias (Figura 1.2), e a excelente adaptação dos bovinos domésticos do Velho ao Novo Mundo representa uma faceta de sucesso do processo de colonização. 9

30 Capítulo1 Introdução geral Figura 1.2. Bovinos Ibéricos das raças Preta (canto inferior esquerdo) e Mertolenga (canto inferior direito) e bovinos Crioulos da Argentina. A partir de meados do século XIX os bovinos Crioulos sofreram a influência de raças comerciais Europeias (Shorthorn, Hereford e Angus) e, também, de bovinos zebu importados da Índia (Rouse 1977). As raças com aptidão para a produção de leite, tais como as Jersey, Ayrshire e Holandesa (hoje denominada Holstein-Friesian) também foram introduzidas, mas tiveram menor impacto na diluição genética dos Crioulos (Rouse 1977). Os bovinos zebu, oriundos da Índia, foram transportados inicialmente para o Brasil (1870) e eram, maioritariamente, machos ( 7.000) que foram utilizados em cruzamentos com fêmeas Crioulas (Meirelles et al. 1999). As raças Nellore e Gir são as mais comuns na América do Sul, enquanto na América do Norte predomina a raça Brahman, oriunda dos E.U.A. (Meirelles et al. 1999). No Brasil foi desenvolvido ( ) o zebu Indo-Brasileiro a partir das raças Gir, Guzerat e Nellore, que se difundiu amplamente, chegando mesmo a ser importado para os E.U.A. 10

31 Capítulo1 Introdução geral (1946) e a contribuir para os bovinos da raça Brahman (Felius 1985). As Américas do Norte, Centro e Sul acomodam aproximadamente 40 % da população mundial de bovinos, sendo que a América Latina, por si só, contabiliza 28 % e o Brasil é o país com o maior efectivo bovino comercial do mundo (FAO 2007). Estes bovinos correspondem a raças do tipo Europeu, Zebu, ou a cruzamentos, enquanto os Crioulos persistiram apenas em regiões localizadas e em núcleos semi-isolados (Rouse 1977; Giovambattista et al. 2001). Na América do Norte, o gado de origem Ibérica foi introduzido na região da Flórida (1565) a partir de animais transportados desde as Antilhas e, também, no Novo México (1598), Texas (1717) e na Califórnia (1769) a partir de animais provenientes do México (Rouse 1977; Sponenberg & Olson 1992). Estes bovinos deram origem às raças Florida Cracker e Texas Longhorn, respectivamente, sendo que estas sofreram a diluição por cruzamento com raças da Europa do Norte desde o final do século XIX e estão actualmente ameaçadas (Sponenberg & Olson 1992). O México constitui um dos primeiros pontos de entrada de bovinos Ibéricos no continente Americano, transportados desde as Antilhas por Villalobos, em 1521, para o local de Tampico (Rouse 1977). A primeira região a ser abastecida com gado foi a dos vales e das planícies a sul da cidade do México e, à posteriori, os planaltos do Norte (Rouse 1977). No final do século XVIII, a região de Guadalajara desempenhava um papel importante no comércio de gado bovino (Quiroz 2007). Os bovinos Crioulos adaptaram-se às diversas condições ambientais, mas não se diferenciaram substancialmente (Rouse 1977). No final do século XIX foram importados os primeiros zebus provenientes dos E.U.A. e do Brasil, e que praticamente substituíram as populações de bovinos Crioulos das regiões costeiras do país (Rouse 1977) e, a Norte da cidade do México, as populações de Crioulos sofreram influência das raças Shorthorn, Hereford, Angus e Charolesa. Presentemente, as populações de bovinos Crioulos reconhecidas no México são as seguintes: Baja Califórnia (Chinampo), Chihuahua, Chiapas, Nayarit (Coreño) e Poblano (Mixteco) (Quiroz 2007). Os bovinos do Paraguai, supostamente, têm origem nas sete vacas e um touro de Gaete que foram transportadas (1555) desde São Vicente (Brasil) até Assunção, sem o consentimento da Coroa Portuguesa, por dois Espanhóis (Salazar e Melgrejo) e pelos irmãos 11

32 Capítulo1 Introdução geral Góis (Primo 2004). Há, também, registo da introdução, em 1569, de animais provenientes do Perú. No início do século XVII registou-se um grande progresso agrícola no sul do país, instituído por padres Jesuítas que se dedicavam também à criação de bovinos (Rouse 1977). O gado Crioulo do Paraguai provavelmente sofreu influência de animais vindos do Norte, da Argentina, do Uruguai e, em menor escala, do Brasil. A introdução, já no século XX, de bovinos Hereford e Brahman ameaçou seriamente os Crioulos (Rouse 1977), existindo actualmente no Paraguai quatro populações de bovinos Crioulos: Pampa Chaqueño, Pilcomaio, Neembucú e Arrovense (Blaires 2004). Na Argentina, os bovinos foram introduzidos na região norte (Tucumán) por colonizadores Espanhóis ( ), e eram provenientes do Peru e do Chile (Rouse 1977; Primo 2004). O primeiro registo de bovinos na região das pampas remonta a 1580 e corresponde a animais transportados do Paraguai (Assunção) para Buenos Aires, havendo no final do século XIX grande abundância de gado Crioulo na região de pastagem das pampas Argentinas (Rouse 1977). As raças de origem Britânica introduzidas na Argentina foram a Shorthorn, Hereford e Angus, que eram utilizadas em cruzamentos com bovinos Crioulos. Mais recentemente, foram importados alguns zebus do Brasil, que parecem não ter tido grande influência nos Crioulos (Rouse 1977), à excepção possivelmente na zona de fronteira entre a Argentina e o Brasil. O gado Crioulo persistiu em regiões marginais, existindo presentemente três populações distintas: Chaqueño, Patagónico e Crioulo Argentino ( No Brasil existe uma grande variedade de populações de bovinos denominados autóctones, e há alguma tradição na sua classificação e preservação enquanto raças, considerando-se a existência de sete raças de bovinos Crioulos, das quais cinco estão ameaçadas: Caracú, Curraleiro, Franqueiro, Crioulo Lageano, Crioulo Pantaneiro, Mocho Nacional, Crioulo Mocho Pereira Camargo ( Os Crioulos Caracú, Franqueiro e Curraleiro são considerados descendentes dos bovinos introduzidos pelos Portugueses, enquanto o Lageano e o Pantaneiro têm influência de raças Espanholas (Primo 1992; Egito et al. 2002). Os bovinos zebu tiveram uma forte influência no Brasil e foram mantidos em raças bem definidas e correspondentes às originalmente importadas da Índia, mas também foram 12

33 Capítulo1 Introdução geral desenvolvidos vários tipos de cruzamentos com raças Crioulas e comerciais (Mariante et al. 2003), de tal forma que o zebu e seus cruzamentos representam actualmente mais de 80% do efectivo bovino brasileiro (Mariante et al. 2003). Os bovinos Crioulos do continente Americano constituem resquícios do gado Ibérico transportado para o Novo Mundo e que, ao longo dos anos, se adaptaram a condições ambientais diversificadas e sofreram, em maior ou menor escala, influência de várias raças, nomeadamente das raças de origem Britânica e de zebus importados da Índia em finais do séc. XIX. Os Crioulos são considerados recursos genéticos valiosos e que importa preservar, no entanto a informação inerente à estrutura genética e demográfica destas populações é escassa (FAO 2007). Tanto quanto sabemos, não existe nenhum estudo genético exaustivo das várias populações de bovinos Crioulos, em que se proceda a uma comparação entre estes animais e as raças que contribuíram para o seu pool genético. Um estudo à escala global, incorporando a informação disponibilizada por vários tipos de marcadores moleculares, poderia fornecer informação importante sobre as origens e a evolução do gado Crioulo, contribuindo assim para um melhor conhecimento destes bovinos, que representam um valiosíssimo recurso genético, de importância económica, social, histórica e cultural, em todos os países da América Latina Marcadores genéticos e o estudo das origens, da diversidade e da estrutura genética de populações As tecnologias moleculares e bioinformáticas estão hoje amplamente desenvolvidas e deram origem às novas disciplinas denominadas ómicas. A genómica, proteómica e metabolómica complementam-se e permitem processar, analisar e integrar uma grande quantidade de informação, de forma a obter uma perspectiva global desde a variação genética, às funções metabólicas, e às interacções entre processos biológicos e factores ambientais (FAO 2007). Neste contexto e após a publicação recente do genoma completo dos bovinos (Elsik et al. 2009), abrem-se novas perspectivas para o estudo da biologia e evolução dos animais domésticos. A diversidade genética entre indivíduos é enorme, e resulta de variações ao nível das sequências de DNA e da interacção com o ambiente. Estas alterações, ou mutações, podem 13

34 Capítulo1 Introdução geral ser funcionais e ter consequências a nível fisiológico ou do fenótipo dos indivíduos, quando ocorrem ou interferem com regiões codificantes (exões), ou ser neutras, quando não produzem efeitos ao nível da transmissão da informação genética. As mutações podem resultar da substituição de um único nucleótido (single nucleotide polymorphisms, SNPs), da inserção ou deleção de um ou vários nucleótidos (indel), ou da duplicação ou inversão de fragmentos de DNA. A informação inerente a estas variações pode ser analisada através de marcadores moleculares distintos e que permitem caracterizar a diversidade genética e identificar polimorfismos associados a características funcionais. A genética de populações baseia-se no estudo de processos demográficos e de dinâmica das populações, e da sua relação com a distribuição da variabilidade genética (Sunnucks 2000). Os marcadores moleculares têm sido extremamente úteis para investigar as origens e a evolução dos animais domésticos e, também, para analisar a relação genética entre diferentes raças. É difícil identificar o marcador ideal para estudos de populações de animais domésticos, mas as características gerais podem ser definidas de acordo com o seguinte: ser suficientemente conservado, para poder identificar ancestrais de populações actuais; ser suficientemente variável e estruturado geograficamente, para poder estudar os processos de domesticação; ter uma taxa de mutação relativamente elevada, mas constante ao longo do tempo, para poder datar a ocorrência dos polimorfismos (Bruford et al. 2003). Existem vários tipos de marcadores moleculares, que fornecem informações igualmente distintas sobre a biologia das espécies, pelo que é desejável complementar a informação genética associada aos diferentes marcadores, de forma a fazer inferências mais precisas. Neste estudo utilizaram-se três tipos de marcadores moleculares úteis em análises de genética de populações, nomeadamente: marcadores nucleares autossómicos (microssatélites); variação nas sequências de DNA mitocondrial (mtdna); e marcadores específicos do cromossoma Y. No texto que se segue descrevem-se as características e o tipo de informação associadas a cada um destes marcadores. 14

35 Capítulo1 Introdução geral Microssatélites autossómicos Os microssatélites são sequências de 2-6 nucleótidos repetidas em série (short tandem repeats, STRs) que se encontram distribuídas por todo o genoma eucariota e que são herdados de forma codominante (Schlotterer 2004). Microssatélites autossómicos são STRs que se localizam nos autossomas. Estes marcadores são altamente polimórficos (hipervariáveis), pois durante o processo de transmissão da informação genética o número de repetições em série pode alterar-se por mutação, gerando variabilidade genética. Este processo de mutação foi denominado de DNA slippage e consiste no desalinhamento das cadeias de DNA durante a replicação, com a consequente alteração no número de pares de bases (bp) repetidas em série, sendo a taxa de mutação destes marcadores extremamente elevada ( por geração), apesar de existirem mecanismos de correcção (mismatch repair) destas alterações (Schlotterer 2000). A possibilidade de amplificar STRs através da reacção em cadeia pela Taq polimerase (PCR) e de analisar os fragmentos amplificados em sequenciadores automáticos, que permitem processar um número elevado de marcadores e de amostras, facilitou a sua utilização. Os STRs tornaram-se nos marcadores de escolha em estudos de caracterização da diversidade genética intra e inter-populacional, na identificação de indivíduos/populações cruzados (admixture), e na classificação de indivíduos em grupos populacionais geneticamente próximos (Bruford et al. 2003). Estes marcadores são, também, utilizados em testes de parentesco, estudos de diferenciação genética de populações (F statistics), e estimativas de distâncias genéticas (FAO 2007). O grau de variabilidade genética associada a estes marcadores (vários alelos em cada locus), o facto de serem herdados de forma Mendeliana (para cada locus um indíviduo possui dois alelos, provenientes de cada um dos progenitores), e de ser possível diferenciar indivíduos homozigóticos (duas cópias do mesmo alelo num locus) de heterozigóticos (dois alelos distintos num locus) permite utilizar estes marcadores em análises de discriminação, estrutura genética, grau de relacionamento e classificação ao nível do indivíduo e das populações (Wan et al. 2004). Por outro lado, a variabilidade genética inerente aos STRs resulta essencialmente dos processos de deriva genética e mutação, já que a maioria dos STRs são considerados neutros face à selecção (Charlesworth et al. 1994). 15

36 Capítulo1 Introdução geral No entanto existem, também, desvantagens inerentes ao uso de STRs em análises genéticas e que se descrevem de seguida. A presença de homoplasia, em que as diferenças nos tamanhos dos alelos podem não estar associadas a processos de divergência evolutiva, pois é difícil determinar se dois alelos são idênticos porque foram herdados de um ancestral comum (identical by descent) ou porque ocorreu uma alteração análoga do número de repetições (identical by state) (Zhang & Hewitt 2003; Wan et al. 2004). Este problema pode conduzir a interpretações incorrectas em análises de diferenciação e estrutura genética de populações. A ocorrência de alelos nulos, que pode estar associada a mutações ao nível das zonas de emparelhamento dos oligonucleótidos iniciadores (primers) utilizados na amplificação pela PCR, e que resultam num aumento do número de indivíduos homozigóticos (Chapuis & Estoup 2007). O principal efeito da presença de alelos nulos é a diminuição da variabilidade genética intra-populacional e o aumento artificial do grau de diferenciação entre populações (Chapuis & Estoup 2007). A identificação de desvios à situação de Equilíbrio Hardy-Weinberg poderá assim indiciar a presença de alelos nulos, e não necessariamente resultar de alterações na estrutura genética da população. A falta de neutralidade, ou seja existe evidência de que alguns STRs poderão estar sujeitos a pressões de selecção por se encontrarem associados a regiões codificantes, pelo que a interpretação dos resultados da análise destes loci em estudos de genética de populações pode ser complicada (Zhang & Hewitt 2003; Wan et al. 2004). Neste caso, estes marcadores podem reflectir os resultados da selecção (adaptação) em vez de processos de deriva genética, como é esperado e requisito de muitos programas de análise deste tipo de informação genética. A utilização de STRs polimórficos e de métodos estatísticos apropriados para diagnosticar alguns destes problemas em estudos de diversidade e estrutura genética das populações permite contornar algumas das limitações destes marcadores, mas é necessário ter consciência de que as inferências evolutivas elaboradas com base em dados de microssatélites podem, por vezes, ser ambíguas. A FAO produziu uma serie de recomendações relativamente à utilização de STRs em estudos de genética de populações de animais domésticos, das quais se destacam o uso de um painel de marcadores recomendado e de amostras standard para ajuste dos tamanhos dos alelos, de forma a possibilitar estudos comparativos futuros (FAO 2004a). Os resultados do balanço realizado pela FAO (2004a) indicam que os STRs foram os marcadores mais 16

37 Capítulo1 Introdução geral utilizados em estudos de caracterização genética de bovinos (88%). Uma breve revisão da literatura confirma a ampla aplicação de STRs no estudo de raças bovinas das mais diversas origens (MacHugh et al. 1997; MacHugh et al. 1998; Loftus et al. 1999; Martin-Burriel et al. 1999; Edwards et al. 2000a; Kantanen et al. 2000; Cañon et al. 2001; Ginja 2002; Hanotte et al. 2002; Kim et al. 2002; Maudet et al. 2002; Beja-Pereira et al. 2003; Jordana et al. 2003; Kumar et al. 2003; Chikhi et al. 2004; Freeman et al. 2004; Mateus et al. 2004a; Mateus et al. 2004b; Moioli et al. 2004; Cymbron et al. 2005; Ciampolini et al. 2006; Econogene 2006; Liron et al. 2006b; Cañon et al. 2008). A importância de uniformizar os resultados de investigações que recorrem à utilização de STRs está relacionada com a necessidade de estabelecer estudos a escalas geográficas amplas, que permitam obter uma perspectiva global sobre a diversidade das espécies domésticas, para implementação de medidas de conservação DNA mitocondrial O DNA mitocondrial (mtdna) é um pequeno plasmídeo (molécula de DNA circular) que nos bovinos tem aproximadamente 17 Kilobases (Kb), possui 13 genes codificantes, 45 RNAs estruturais, e localiza-se no interior das mitocôndrias ( Existe ainda uma região não codificante, denominada região controlo (control region), que abrange aproximadamente 1 Kb do genoma mitocondrial, e que contém o local de iniciação da replicação e transcrição (displacement loop, D-loop). A primeira sequência completa do genoma mitocondrial de B. taurus foi produzida por Anderson et al. (1982) e é utilizada como referência (número de acesso na base de dados do GenBank V00654) para anotar polimorfismos em sequências de mtdna de bovinos. O mtdna é herdado via materna, tem uma taxa de mutação elevada, que é de aproximadamente 3x10-7 e, portanto, superior à do DNA nuclear cuja taxa de mutação se estima ser de por nucleótido e por geração (no entanto o mtdna apresenta heterogeneidade na taxa de substituição), e não sofre recombinação (troca de material genético entre moléculas de DNA durante o processo de divisão celular), ou seja, em princípio qualquer alteração da sequência de nucleótidos do mtdna resulta de mutações 17

38 Capítulo1 Introdução geral (Bruford et al. 2003; Tapio & Grigaliunaite 2003; White et al. 2008). Devido ao facto de evoluir rapidamente, o mtdna é extremamente útil em estudos filogenéticos intraespecíficos e permite detectar processos demográficos relativamente recentes (< anos), inerentes à história evolutiva das populações (Bruford et al. 2003; Wan et al. 2004). A definição de haplotipos (combinações de um conjunto de loci ligados ou de polimorfismos que são herdados em simultâneo) para cada indivíduo simplifica a interpretação dos resultados. Apesar do mtdna ser considerado o marcador ideal para estudos de domesticação e das origens dos animais domésticos (Bruford et al. 2003), existem limitações inerentes à sua utilização como marcador molecular e que se descrevem em seguida. O mtdna representa apenas linhas maternas e um único locus, pelo que fornece uma perspectiva simplificada do complexo processo evolutivo que deu origem às diferentes populações animais, subestima a diversidade genética total e possui dinâmicas evolutivas específicas (Bruford et al. 2003; Zhang & Hewitt 2003). A existência de um elevado número de cópias nucleares de sequências de mtdna (numtdna) pode confundir a interpretação de resultados (Zhang & Hewitt 2003), pois as cópias nucleares são, geralmente, mais conservadas e, portanto, mais semelhantes ao genoma mitocondrial ancestral do que o mtdna (Bensasson et al. 2001). Um outro problema é a presença de heteroplasmia, ou seja indivíduos que não possuem apenas um único haplotipo, o que pode estar associado a taxas de mutação elevadas e à inexistência de processos eficientes de reparação de erros durante o processo de divisão celular (White et al. 2008). A introdução acidental de mtdna paterno no citoplasma do ovo materno durante a fertilização (paternal leakage) pode, também, estar associada à presença de duas moléculas de mtdna distintas num indivíduo (White et al. 2008). A ocorrência de recombinação, embora a informação relativamente à presença de mtdna recombinante em espécies animais seja ainda escassa (White et al. 2008). Algumas destas limitações podem ser contornadas através de procedimentos experimentais adequados, ou ter um efeito relativamente reduzido nas análises filogenéticas e de genética de populações realizadas com base em polimorfismos do mtdna. No entanto, é importante ter consciência de que existem excepções inerentes ao processo de herança genética do mtdna e que podem conduzir a interpretações erróneas da biologia evolutiva das espécies. 18

39 Capítulo1 Introdução geral A análise da variabilidade de sequências de mtdna tem sido amplamente utilizada em estudos sobre as origens, domesticação e dispersão de várias espécies animais (Giuffra et al. 2000; Luikart et al. 2001; Bruford et al. 2003; Beja-Pereira et al. 2004; Tapio et al. 2006b; Zeder et al. 2006; Driscoll et al. 2007; Larson et al. 2007). Este tipo de marcador tem sido útil para identificar ancestrais selvagens, caracterizar a diversidade de linhas maternas e analisar a variação genética do mtdna entre regiões geográficas distintas (FAO 2007). No que respeita ao estudo genético dos bovinos domésticos, o mtdna foi utilizado para identificar sequências de ancestrais selvagens ou pré-domésticos (Bailey et al. 1996; MacHugh et al. 1999; Anderung et al. 2005; Beja-Pereira et al. 2006; Bollongino et al. 2006; Edwards et al. 2007b; Pellecchia et al. 2007; Achilli et al. 2008), detectar potenciais centros de domesticação (Loftus et al. 1994; Bradley et al. 1996; Troy et al. 2001; Mannen et al. 2004; Hiendleder et al. 2008), analisar processos de hibridação e estudar as origens e dispersão das diferentes raças (Cymbron et al. 1999; Magee et al. 2002; Miretti et al. 2002; Carvajal-Carmona et al. 2003; Mirol et al. 2003; Miretti et al. 2004; Lai et al. 2006; Liron et al. 2006a; Cai et al. 2007; Cortes et al. 2008; Dadi et al. 2009) Cromossoma Y Os bovinos possuem 60 cromossomas: 58 autossomas e dois cromossomas sexuais (Fries & Popescu 1999). Nos bovinos, bem como nos restantes mamíferos, os machos são heterogaméticos e possuem dois cromossomas sexuais distintos, o cromossoma X e o Y (Liu et al. 2002). Este último é transmitido apenas pelas linhas paternas, pelo que pais e filhos partilham a mesma informação genética associada ao cromossoma Y. Este cromossoma é um dos mais pequenos do cariótipo bovino e contém uma zona que não troca informação genética com o cromossoma X durante a meiose, pelo que é específica de machos, que é denominada de região não-recombinante (NRY). Esta zona constitui aproximadamente 95% do cromossoma Y e os restantes 5 % correspondem à região pseudo-autossómica (PAR) e que troca informação genética com o cromossoma X (Liu et al. 2002). O mapeamento genético do cromossoma Y tem sido dificultado pelas suas peculiaridades, nomeadamente a ausência de recombinação na região NRY, e a complexidade de regiões repetitivas que existem ao longo do cromossoma (Skaletsky et al. 2003). 19

40 Capítulo1 Introdução geral Liu et al. (2002) produziram um mapa do cromossoma Y de bovinos (radiation hybrid map) e identificaram 13 genes localizados na PAR e 46 marcadores genéticos associados à região NRY, incluindo os genes SRY (sex determining) e TSPY (testis-specific protein). Nos mamíferos, os genes localizados no cromossoma Y são responsáveis pela determinação sexual (SRY) e intervêm nos processos de espermatógenese, podendo estar associados a problemas de fertilidade masculina (Lahn et al. 2001). Os genes específicos da região NRY, de forma análoga ao que acontece para o mtdna, são herdados em bloco e permitem a definição de haplotipos. A taxa de mutação do cromossoma Y é considerada superior à dos autossomas e à do cromossoma X (Hellborg & Ellegren 2003). A análise de polimorfismos específicos do cromossoma Y, nomeadamente STRs e SNPs, tem sido aplicada ao estudo das origens e da história de populações humanas (Jorde et al. 2000; Hammer et al. 2001; Kayser et al. 2001; Roewer et al. 2005; Kayser et al. 2008) e na resolução de casos forenses (Kayser et al. 1997), estando já constituída uma base de dados para utilizar como referência na definição de haplotipos do cromossoma Y em humanos ( Roewer et al. 2001). Nas espécies de animais domésticos, a informação relativa a marcadores específicos do cromossoma Y é escassa e estudos recentes têm demonstrado que a variabilidade genética é relativamente reduzida (Hellborg & Ellegren 2004; Lindgren et al. 2004; Bannasch et al. 2005; Meadows et al. 2006; Li et al. 2007). A diversidade do cromossoma Y é inferior à dos autossomas (Jobling & Tyler-Smith 2003) e, no caso de animais domésticos, o número efectivo de machos tende a ser ainda menor devido aos esquemas de acasalamento em que vários machos produzem um número elevado de descendentes (Hellborg & Ellegren 2004). Nos bovinos foram identificados alguns marcadores específicos do cromossoma Y, em particular STRs (Bishop et al. 1994; Vaiman et al. 1994; Kappes et al. 1997; Liu et al. 2003) e, também, SNPs (Gotherstrom et al. 2005). Apesar do número limitado de marcadores disponíveis, e de algumas dificuldades na amplificação pela PCR e na análise dos perfis obtidos (bandas múltiplas, amplificação inespecífica, nomeadamente em fêmeas), os marcadores específicos do cromossoma Y têm sido úteis para identificar o fluxo de genes entre populações mediado por machos (Hanotte et al. 2000; Verkaar et al. 2003) e 20

41 Capítulo1 Introdução geral para complementar a informação genética de linhas maternas (Verkaar et al. 2004; Anderung et al. 2007; Edwards et al. 2007a). Alguns dos STRs do cromossoma Y têm sido amplamente utilizados na detecção de hibridação entre B. taurus e B. indicus (Edwards et al. 2000b; Giovambattista et al. 2000; Li et al. 2007). Recentemente, a utilização de SNPs específicos do cromossoma Y em análises de adna de bovinos tem fornecido informação importante sobre a variação genética de ancestrais selvagens e a detecção de hibridação entre fêmeas domésticas e auroques (Gotherstrom et al. 2005; Svensson et al. 2007; Bollongino et al. 2008) Objectivos O objectivo geral deste estudo é contribuir para a caracterização genética dos bovinos domésticos, em particular das raças da Iberoamerica, através da análise de três tipos de marcadores moleculares: marcadores específicos do cromossoma Y, sequências de mtdna e microssatélites autossómicos. Pretende-se: Caracterizar a diversidade e a estrutura genética das raças bovinas autóctones de Portugal; Investigar as origens dos bovinos Crioulos e analisar a influência de várias raças, incluindo raças zebuínas, para a sua formação. Este constitui um estudo molecular global de bovinos Ibéricos e Crioulos, cuja história está intimamente associada à da colonização das Américas pelos navegadores Portugueses e Espanhóis. 21

42 Capítulo1 Introdução geral Os principais objectivos específicos deste trabalho são os seguintes: Analisar a variação genética para marcadores específicos do cromossoma Y em raças bovinas Portuguesas, através da combinação de STRs e SNPs para a definição de haplotipos. Pretende-se neste estudo utilizar a informação genética de linhagens paternas, para investigar as relações genéticas entre as diferentes raças autóctones e analisar o grau de introdução nestas de raças comerciais importadas. Nesta perspectiva, o estudo do cromossoma Y pode fornecer informação importante relativamente às origens dos bovinos Ibéricos, e permitir identificar linhagens ancestrais em raças modernas, que podem estar associadas à ocorrência de processos locais de hibridação entre auroques e animais domésticos. Estudar as origens dos bovinos Crioulos através da análise conjunta de haplotipos maternos (mtdna) e paternos (cromossoma Y) e analisar a contribuição genética de raças autóctones Ibéricas e das Ilhas Atlânticas, bem como de raças comerciais Europeias (Britânicas e da Europa continental) e zebuínas. O objectivo é caracterizar os haplotipos maternos e paternos de bovinos Crioulos e analisar a sua origem, nomeadamente no que respeita à presença de linhagens Ibéricas. Determinar o grau de introgressão de machos zebu em populações de bovinos Crioulos a partir da análise de marcadores específicos do cromossoma Y é, também, uma questão importante. Analisar a estrutura genética das raças bovinas autóctones Portuguesas com marcadores moleculares autossómicos polimórficos (STRs). O principal objectivo é averiguar se a estrutura molecular determinada a partir das frequências alélicas de STRs reflecte a classificação destas raças enquanto entidades independentes e, também, determinar se existe subestrutura dentro de cada raça. A investigação do grau de diferenciação, assim como das relações genéticas entre as diversas raças, constituem objectivos paralelos. 22

43 Capítulo1 Introdução geral Caracterizar a diversidade genética dos bovinos Crioulos através de STRs autossómicos, bem como analisar a sua estrutura genética. Atendendo à história destes animais domésticos, é de esperar que este seja um grupo bastante heterogéneo, pelo que é interessante investigar se é possível identificar a nível molecular os grupos de raças que contribuíram para o pool genético dos Crioulos. Por outro lado, é importante analisar o grau de diferenciação entre populações de gado Crioulo, bem como a diluição por cruzamento com outras raças, tendo em vista a aplicação de medidas de conservação destes recursos genéticos. Um outro objectivo é avaliar a contribuição de cada raça para a diversidade genética global de bovinos Crioulos e Ibéricos, numa perspectiva de conservação de recursos genéticos animais. As análises genéticas elaboradas no âmbito deste trabalho de investigação são apresentadas em quatro capítulos, redigidos sob a forma de artigos científicos e que consolidam os objectivos acima descritos. O capítulo 2 corresponde à definição de haplotipos paternos em raças autóctones Portuguesas, inclui uma breve introdução à análise da variação genética do cromossoma Y e a descrição detalhada das técnicas utilizadas, nomeadamente para a detecção de SNPs, e a pesquisa de variação adicional para além da descrita na literatura. No final do capítulo apresentam-se e discutem-se os resultados da diversidade genética encontrada e das análises filogenéticas efectuadas. Este artigo foi publicado no Journal of Heredity. No capítulo 3 descreve-se a investigação sobre as origens dos bovinos Crioulos através da análise de mtdna e do cromossoma Y. Faz-se uma breve introdução à história dos Crioulos e à utilidade deste tipo de marcadores moleculares para estudar a origem e dispersão das raças de animais domésticos. Os resultados são apresentados e discutidos com o objectivo de descrever detalhadamente a diversidade genética e os haplotipos identificados, bem como de analisar as origens Ibéricas do gado Crioulo. A contribuição de raças comerciais Europeias e zebu também é discutida. Este artigo foi submetido para publicação na revista Animal Genetics. 23

44 Capítulo1 Introdução geral Os capítulos 4 e 5 respeitam à análise de STRs em raças autóctones Portuguesas e Crioulas, respectivamente. No estudo dos bovinos Crioulos utilizou-se um subgrupo de 24 loci de um total de 40 STRs utilizados na caracterização genética das raças autóctones Portuguesas, pois este projecto foi realizado em colaboração com o Departamento de Genética da Universidade de Córdova, que cedeu os genótipos das raças seguintes: Mostrenca, Canaria, Palmera, Crioulos Mexicanos e Pampa Chaqueño. No final de cada um destes capítulos discutem-se os resultados focando essencialmente aspectos de diferenciação das raças, e fazendo a separação entre populações geneticamente distintas e as mais heterogéneas, com evidência de diluição por cruzamento. No capítulo 5 destaca-se, ainda, a contribuição de cada raça para a diversidade genética global. O artigo inerente à análise genética das raças Portuguesas foi submetido no Journal of Heredity, enquanto o artigo dos Crioulos está ainda a ser preparado, pois, optou-se pela combinação destes resultados com os de grupos de investigação de Espanha, para publicar um estudo que abranja todas as raças bovinas da Península Ibérica e que inclua populações adicionais de bovinos Crioulos. No Capítulo 6 são apresentadas as conclusões finais deste estudo e tecem-se algumas considerações sobre as perspectivas futuras de investigação. As referências bibliográficas figuram no final da tese. 24

45 Capítulo 2 Y CHROMOSOME HAPLOTYPE ANALYSIS IN PORTUGUESE CATTLE BREEDS USING SNPS AND STRS

46

47 CAPÍTULO 2. Y CHROMOSOME HAPLOTYPE ANALYSIS IN PORTUGUESE CATTLE BREEDS USING SNPS AND STRS Catarina Ginja 1,2,3, Luís Telo da Gama 2, Maria Cecília T. Penedo 3 1 Instituto Superior de Agronomia, Tapada da Ajuda, Lisboa, Portugal 2 Departamento de Genética e Melhoramento Animal, Instituto Nacional dos Recursos Biológicos, Fonte Boa, Vale de Santarém, Portugal 3 Veterinary Genetics Laboratory, University of California, One Shields Av., Davis, CA Abstract DNA samples from 307 males of 13 Portuguese native cattle breeds, 57 males of the three major exotic breeds in Portugal (Charolais, Friesian and Limousin) and 5 Brahman (Bos indicus) were tested for 5 SNPs, one indel and 7 STRs specific to the Y chromosome. The 13 Y-haplotypes defined included three previously described patrilines (Y1, Y2 and Y3) and 10 new haplotypes within B. taurus. Native cattle contained most of the diversity, with 7 haplotypes (H2Y1, H3Y1, H5Y1, H7Y2, H8Y2, H10Y2 and H12Y2) found only in these breeds. H6Y2 and H11Y2 occurred in high frequency across breeds including the exotics. Introgression of Friesian cattle into Ramo Grande was inferred through their sharing of haplotype H4Y1. Among the native breeds, Mertolenga had the highest haplotype diversity ( ), Brava de Lide was the least differentiated. The AMOVA analysis showed significant (P<0.0001) differences between breeds with over 64% of the total genetic variation found among breeds within groups and 33-35% within breeds. The detection of INRA allele in 8 native breeds suggested influence of African cattle in breeds of the Iberian Peninsula. The presence in Portuguese breeds of Y1 patrilines, also found in aurochs, could represent more ancient local haplotypes. Keywords: cattle, haplotypes, Y chromosome Journal of Heredity (2009) 100(2):

48

49 Capítulo 2 Y Chromosome Analysis in Portuguese Cattle 2.1. Introduction Y chromosome specific markers have been widely used in studies of human origins because the frequency and geographical distribution of Y-haplotypes provide powerful information about migration, sex-specific gene flow and population relationships (Jorde et al. 2000; Su et al. 2000; Underhill et al. 2000; Hammer et al. 2001; Kayser et al. 2001; Jobling & Tyler-Smith 2003). Relatively low levels of genetic diversity in the Y chromosome have been found in several mammalian species including cattle (Hellborg & Ellegren 2004; Lindgren et al. 2004; Bannasch et al. 2005; Meadows et al. 2006; Li et al. 2007). Y chromosome diversity is lower than for autosomes (The International SNP Map Working Group 2001; Jobling & Tyler-Smith 2003; Hellborg & Ellegren 2004). In the case of domestic animals, the effective Y chromosome contribution tends to be reduced because of common use in breeding schemes of a few selected males that produce a large number of offspring (Hellborg & Ellegren 2004). For example, a demographic analysis of the native Portuguese cattle breed Alentejana indicates that, from an original number of 671 founder sires, only 24 Y chromosomes are currently represented with an effective number of 2.73 males (Carolino & Gama 2008). Despite limitations, studies of male lineages contribute to a better understanding of the origin and relationships among domestic breeds (Edwards et al. 2000b; Lindgren et al. 2004; Anderung et al. 2005; Gotherstrom et al. 2005; Li et al. 2007). Even though information on cattle Y chromosome sequence and polymorphism is limited, microsatellites (STRs) mapped to the non-recombining region (Bishop et al. 1994; Vaiman et al. 1994; Kappes et al. 1997; Liu et al. 2003) have been used to study domestication and differentiation among bovid species. Some of these markers are useful to detect introgression and to distinguish between B. taurus and B. indicus patrilines (Edwards et al. 2000b; Giovambattista et al. 2000; Hanotte et al. 2000; Li et al. 2007). Gotherstrom et al. (2005) used Y chromosome single nucleotide polymorphisms (SNPs) with ancient DNA specimens to investigate cattle evolution by comparing this information with that obtained from mtdna data. This study showed that Y-haplotypes of North European cattle were similar to those found in aurochs, and suggested possible hybridization between domestic cattle and male aurochs. 29

50 Capítulo 2 Y chromosome analysis in Portuguese cattle The Iberian Peninsula has numerous breeds of native domestic cattle of which 13 are found in Portugal and are at some level of risk of extinction (FAO 2004b). Studies of genetic diversity in Portuguese native cattle based on autosomal STRs (Mateus et al. 2004b) showed that these breeds were more diverse (average expected heterozygosity 0.7) than other European cattle raised under more intensive breeding schemes (Cañon et al. 2001; Ginja 2002; Cymbron et al. 2005). It has been postulated that genetic diversity might have accumulated in the Iberian Peninsula (Hewitt 2001) as a result of human and livestock migrations from Central Europe and Northern Africa (Beja-Pereira et al. 2003; Beja-Pereira et al. 2006). Characterization and conservation of domestic animal genetic resources is a priority and efforts are being made to take into account information from nuclear, mitochondrial and Y chromosome markers to define conservation priorities (Econogene 2006). The analysis of Y chromosome haplotypes can thus provide additional information for inferring the origins and genetic relationships of Iberian cattle. To our knowledge, extended Y chromosome haplotypes that combine information from STRs and SNPs have not been used to study genetic relationships among cattle breeds. The aim of this work was to investigate haplotype diversity in Portuguese native cattle breeds using a combination of SNPs and STRs specific to the non-recombinant region of the Y chromosome. We also analysed breed relationships taking into account geographical distribution and phenotypic characterization Material and methods Sampling and DNA extraction Blood samples were collected from 307 males of 13 native Portuguese cattle breeds: Alentejana (31), Arouquesa (31), Barrosã (33), Brava de Lide (26), Cachena (25), Garvonesa (6), Marinhoa (17), Maronesa (23), Mertolenga (17), Minhota (28), Mirandesa (23), Preta (29) and Ramo Grande (18), and 57 males of the three major exotic breeds raised in Portugal: Charolais (13), Friesian (27) and Limousin (17). Semen samples from 5 Brahman (B. indicus) bulls were obtained from a commercial source (Bovine Elite, Llc., USA). 30

51 Capítulo 2 Y Chromosome Analysis in Portuguese Cattle To minimize the degree of relationship among individuals, pedigree records were used for selection of nonrelated animals back to the second generation whenever possible. DNA was extracted using the Gentra kit (PUREGENE manufacturer recommendations., Gentra Systems, Inc.) according to Sequencing and SNP detection through Pyrosequencing The Multalign interface was used to align Y chromosome sequences ( for B. taurus, B. indicus, B. gaurus, Bison bison and Bubalus bubalis deposited in the NCBI database and which contained SNPs (Gotherstrom et al. 2005). The alignments were done for DDX3Y gene (intron 1, previously DBY1 GenBank accession numbers AY928811, AY928812, AY928814, AY928815, AY928816; and intron 7, previously DBY7, GenBank accession numbers AY928817, AY928818, AY928819, AY928820, AY928821, AY928822), UTY gene (intron 19, GenBank accession numbers AY936539, AY936540, AY936541, AY936542, AY936543) and ZFY gene (intron 9 in human, previously ZFY4, GenBank accession numbers AY928823, AY928824, AY928825, AY928826, AY928827, AY928828; and intron 10 in human, previously ZFY5, GenBank accession numbers AF241271, AF465181, AF032366, AY079138). PCR primers were designed with Primer3 software ( Y chromosome regions, primer sequences, fragment sizes and annealing temperatures are shown in Table 2.1.To confirm specificity of amplicons, 100 ng of genomic DNA from one Mirandesa (Northern brown breed group), one Mertolenga (Southern red breed group) and two Brahmans were amplified in 25 µl reactions containing 1x PCR buffer II (ABgene, Rochester, NY, USA), 1.5 mm MgCl 2, 200 µm dntps, 10 ρmoles of each primer and 1 U Taq DNA polymerase (ABgene). DNA and the primers were incubated at 95ºC for 5 min after which the temperature was lowered and held at 80ºC for addition of the remaining reagents. The cycling program continued with 30 cycles at 95ºC for 30 s, 45 s at specific annealing temperatures (T a ) (see Table 2.1), 1 min at 72ºC and finished with a final extension at 72ºC for 10 min. In this and all other assays, a negative (no template) and a female DNA were used to control possible PCR contamination and non-specific amplification. 31

52 Capítulo 2 Y chromosome analysis in Portuguese cattle Table 2.1. Locus names, target regions, fragment sizes, annealing temperatures (T a ) and primer sequences for cattle Y chromosome. Locus Region Size (bp) T a (ºC) Primer sequences (5-3 ) DDX3Y_1 Intron DDX3Y_7 Intron UTY_19 Intron ZFY_9 ZFY_10 1 Corresponding intron in human 1 Intron Intron F TGAACCACTAGGGAGGTCATC R TTCCAATTTAGCTGTGGTTATCTG F TTGAAAGCTGTGAAGGTAGGG R GATACTGTTTACGGCGTCCA F TGATGCCTATATTAGCCATTGACA R AAAATTCTTTATGATGTTCCATCC F TCACATTGCAGCTTTAGGATTG R CCTTCACTTGGCAGATGGAT F CCAAAATGGTTGAGCTTTATGA R GGAGCATAAGTGATCCAATGAA PCR products were cloned with the Topo TA cloning Kit for sequencing (Invitrogen, Carlsbad, CA, USA) according to the manufacturer s instructions. For each animal and amplified region, 12 colonies were selected for amplification with the universal M13 primers included in the kit. The 50 µl PCR reactions contained 1x PCR buffer II (ABgene), 2.0 mm MgCl 2, 200 µm dntps, 2.5 ρmoles of each primer and 2.5 U Taq DNA polymerase (ABgene). PCR amplifications were done with two cycles of 2 min at 95ºC, 45 s at 55ºC and 30 s at 72ºC; 30 cycles of 45 s at 95ºC, 45 s at 50ºC and 45 s at 72ºC and a final extension at 72ºC for 10 min. For each individual, a minimum of four clones per region were sequenced with BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and separated by capillary electrophoresis on an ABI 3730 instrument (Applied Biosystems). Sequences were analyzed using the Seqman II software v6.1 (DNASTAR Inc., Madison, WI, USA). Their identities were confirmed by BLAST comparison to sequences in GenBank. Pyrosequencing assays for SNP detection were designed for the PSQ 96MA 2.1 instrument (Biotage AB, Uppsala, Sweden) with Biotage s Assay Design Software, v according to the manufacturer s recommendations. Sequencing primers and the target SNPs 32

53 Capítulo 2 Y Chromosome Analysis in Portuguese Cattle are shown in Table 2.2. PCR fragments were amplified with the primers listed in Table 2.1 except that one of the primers (indicated in Table 2.2) was tailed (5 AGCGCATAACAATTTCACACAGG 3 ), and a third biotinylated primer corresponding to the tail was included in each reaction. Table 2.2. Pyrosequencing primers, SNPs detected and positions in reference sequences for the cattle Y chromosome. Locus Pyrosequencing primer (5-3 ) Tailed primer 1 SNPs Genbank accession number DDX3Y_1 F TTTCTTGACATTAATGTT DDX3Y_1-R 425>C/T AY DDX3Y_7 R TTCTATGCATTTCTAAAGTT DDX3Y_7-F 123>C/T AY UTY_19 F TGAAGCAGTCTTGAGGA UTY_19-R 423>C/A AY ZFY_9 R TAGACTATTATCATTTTTCT ZFY_9-F 120>C/T AY ZFY_10 F ATTTTAATTGGTACAGTCA ZFY_10-R 655>C/T AF ZFY_10indel F CACTTTATTACTATGGTAAC ZFY_10-R 704>--/GT AF Mutation position in reference to the GenBank sequences listed. PCRs were carried out in a total volume of 50 µl containing 200 ng of template, 1x PCR buffer II (ABgene), 2 mm of MgSO 4, 200 µm dntps, 0.7 M of Betaine (Sigma), 10 ρmoles of the biotinylated primer, 2 ρmoles of the tailed primer, 13 ρmoles of the non-tailed primer and 2 U Taq DNA polymerase (ABgene). DNA and primers were incubated at 95ºC for 5 min and the temperature lowered and held at 80ºC for addition of the remaining reagents. Amplification continued with 40 cycles at 94ºC for 30 s, specific T a (see Table 2.1) for 45 s and 72ºC for 45 s with a final extension step at 72ºC for 10 min. The PCR products were immobilized on streptavidin-coated Sepharose beads (Amersham Pharmacia Biotech, Uppsala, Sweden) according to the manufacturer s instructions. The assays were done using the reagents kit from Biotage and pyrograms were analysed with the SNP software. Only high quality sequence peaks (>130 intensity signal) were considered for SNP genotyping. 33

54 Capítulo 2 Y chromosome analysis in Portuguese cattle Microsatellite genotyping Thirteen STR loci (BM861; DDX3Y1STR; INRA124; INRA126; INRA189; UMN0103; UMN0307; UMN0504; UMN0920; UMN2001; UMN2303; UMN2404; UMN3008) located on the non-recombining region of the Y chromosome were selected from the literature. Primer sequences, repeat structure, T a and references for these markers are shown in supplementary Table S2.1. The forward primers were synthesized with tails that matched one of three different, fluorescence-labelled M13 primers (Fam-TTTCCCAGTCACGACGTTG, Ned-TAAAACGACGGCCAGTGC, Vic-GCGGATAACAATTTCACACAGG). The QIAGEN multiplex PCR kit (QIAGEN Inc., USA) was used to set up 12.5 µl PCR reactions that contained 60 ng of genomic DNA, 6.25 µl of the QIAGEN PCR master mix, 3.5 µl of the primer mix (0.63 ρmoles of the tailed forward primer, 6.26 ρmoles of the reverse primer, 1-2 ρmoles of the M13 labelled primer). The PCR program included an activation step at 95ºC for 15 min; 35 cycles at 94ºC for 30 s, 55/58ºC for 90 s and 72ºC for 60 s followed by a final extension at 72ºC for 30 min. A negative and a female DNA controls were included in all STR assays. PCR fragments were separated by capillary electrophoresis on ABI 3730 instruments (Applied Biosystems, Foster City, CA) according to the manufacturer recommendations. Allele sizes were determined with STRAND software (Hughes 2000) and whenever possible adjusted to match published data (Edwards et al. 2000b; Gotherstrom et al. 2005) Statistical Analysis SNP and STR alleles were combined into haplotypes. ARLEQUIN v2.0 (Schneider et al. 2000) was used to determine haplotype frequency and diversity (H) for each population, number of shared haplotypes between breeds, pairwise F ST values with 10,000 permutations and significance at the 5% level. The same program was used for analyses of molecular variance (AMOVA) to estimate the partitioning of the total genetic variation by grouping the native breeds by geographic region as Northern (Arouquesa; Barrosã; Cachena; Marinhoa; Maronesa; Minhota; Mirandesa), Southern (Alentejana; Brava de Lide; Garvonesa; Mertolenga; Preta) and Island (Ramo Grande), and by phenotypic characteristics as Red Convex (Alentejana; Garvonesa; Mertolenga; Minhota), Brown Concave (Arouquesa; Barrosã; Cachena; Marinhoa; Maronesa; Mirandesa) and Black Orthoid (Brava de Lide; 34

55 Capítulo 2 Y Chromosome Analysis in Portuguese Cattle Preta). The exotic and Brahman individuals were excluded from AMOVA because we were more interested in analyzing the population structure of the native breeds. This allowed for a hierarchical analysis considering three components of the genetic variation as due to differences (i) among haplotypes within populations; (ii) among haplotypes in different populations within groups; and (iii) among groups (Excoffier et al. 1992). Significance levels for the estimated fixation indices were obtained with 10,000 permutations. Phylogenetic relationships among haplotypes were investigated using the medianjoining network (MJ) program (Bandelt et al. 1995) implemented in NETWORK v (Fluxus Technology Ltd, ). The output from the reduced MJ run (RM) was used for the MJ analysis with parameters r=2 (reduction threshold) and ε=0 (Bandelt et al. 1999). Haplotype components were weighted (w) as dinucleotide repeats w=2; imperfect repeats w=5; SNP transitions w=10; indel w=20; SNP transversion w=30 so that the component with the lowest expected mutation rate was assigned the highest weight (Bandelt et al. 2000) Results The sequences obtained for the 5 intronic Y chromosome regions (Genbank accession numbers EU to EU547277) confirmed the SNPs described by Götherström et al. (2005) but we note that the motif for the ZFY_10indel is GT and not the reported AG. Sequence alignments and SNP positions for each gene region are shown in Supplementary Figure S2.1. Of the 13 STRs screened, INRA126 and UMN2001 were excluded because they amplified alleles with the same size range in females and thus lacked Y-specificity. UMN0920, UMN2303, UMN2404 and UMN3008 were also discarded because they showed ladder-like banding pattern which made allele sizing impracticable. This amplification profile is most probably related to the characteristics of the Y chromosome sequence such as highly repetitive palindromic structure, where multiple copies of each gene/sequence might exist along the chromosome (Skaletsky et al. 2003). Among the 7 STRs that were combined with the 6 SNP loci for haplotyping, UMN0504 (monomorphic in our samples) and BM861 amplified female DNA but with different size ranges that did not interfere with the identification of Y-specific alleles. For 35

56 Capítulo 2 Y chromosome analysis in Portuguese cattle UMN0103, only one fragment was present in all B. taurus samples whereas two fragments (116 and 122 bp) were amplified in the 5 B. indicus. A total of 13 haplotypes were identified from the analysis of 369 individuals (Table 2.3). To facilitate comparison with published data (Gotherstrom et al. 2005), the nomenclature of Y1, Y2 and Y3 was included in our haplotype notation. The addition of STRs INRA189, UMN0103, UMN0307 in the analyses allowed detection of additional variability and resulted in the split of Y1 into four and of Y2 into 8 distinct haplotypes Genetic diversity Distributions of haplotype frequencies and diversities are shown in Table 2.4, respectively. Overall, H6Y2 and H11Y2 were the most common and were shared among several breeds. H6Y2 was found in 154 individuals; it was fixed in Garvonesa, Marinhoa, Minhota and Mirandesa and present with some frequency in the other breeds except Alentejana, Friesian, Maronesa and Ramo Grande. H11Y2 was found in 103 animals; it was fixed in Alentejana and Maronesa but also detected in Arouquesa, Barrosã, Brava de Lide, Cachena, Mertolenga and Preta. H4Y1 was fixed in Friesian but also present in 13 Ramo Grande individuals. H9Y3 was found only in the B. indicus animals. The haplotype diversity within breeds was extremely low and among the breeds where variation was present, Mertolenga was the most diverse ( ) and had four haplotypes, followed by Barrosã and Ramo Grande ( each) with three and two haplotypes, respectively. Brava de Lide had the highest number of haplotypes (5) overall but three of these were represented only once, as reflected by the lower haplotype diversity of Among the B. taurus breeds, exclusive haplotypes were found in Arouquesa (H7Y2) and Preta (H8Y2) with frequencies of 0.19 and 0.76, respectively. 36

57 Table 2.3. Y chromosome haplotypes defined by 13 loci and their overall frequency across breeds. Haplotype Freq. SNPs Indel STRs DDX3Y_1 DDX3Y_7 UTY_19 ZFY_9 ZFY_10 ZFY_10 DDX3Y_1 BM861 INRA124 INRA189 UMN0103 UMN0307 UMN0504 H1Y C C A C C GT H2Y C C C C C H3Y C C C C C H4Y C C C C C H5Y C C C C C H6Y C C A C C GT H7Y C C A C C GT H8Y C C A C C GT H9Y T T A T T GT /122* H10Y C C A C C GT H11Y C C A C C GT H12Y C C A C C GT H13Y C C A C C GT * Two fragments amplified only in the 5 B. indicus.

58 Table 2.4. Frequency and diversity (H SD) of Y chromosome haplotypes per breed. Breed Haplotype H SD H2Y1 H3Y1 H4Y1 H5Y1 H1Y2 H6Y2 H7Y2 H8Y2 H10Y2 H11Y2 H12Y2 H13Y2 H9Y3 Northern Arouquesa Northern Barrosa Northern Cachena Northern Marinhoa Northern Maronesa Northern Minhota Northern Mirandesa Group mean Southern Alentejana Southern Brava de Lide Southern Garvonesa Southern Mertolenga Southern Preta Group mean Azores Arch. Ramo Grande Exotics Charolais Exotics Limousin Exotics Friesian Group mean India Brahman Overall mean

59 Capítulo 2 Y chromosome analysis in Portuguese cattle Differentiation and AMOVA Pairwise F ST values are shown in Table 2.5 and ranged from nearly zero to 1. The B. taurus breeds were significantly (P < 0.05) differentiated from the B. indicus. For Barrosã, Friesian, Mertolenga, Preta and Ramo Grande, all pairwise F ST values were statistically significant (P < 0.05). Friesian was the most, and Brava de Lide the least, differentiated from all other breeds, with average F ST values ( SD) of and , respectively. Among the Northern native breeds, Maronesa was the most differentiated with an average F ST value of and Arouquesa showed the lowest average F ST value ( ). Among the Southern native breeds, Alentejana was the most differentiated (average F ST of ) and Garvonesa the least (average F ST of ). Among the native cattle, Ramo Grande was significantly differentiated from all other breeds with an average F ST value of (Table 2.5). The average F ST value over all B. taurus breeds was , indicating that a considerable amount of the variation is explained by breed differences. 39

60 Table 2.5. Pairwise F st values (below diagonal, values in bold font are statistically significant at the 5% level) and average pairwise F st per breed (F st SD). Breed Alentejana (31) 2. Arouquesa (31) Barrosã (33) Brahman (5) Brava de Lide (26) Cachena (25) Charolais (13) Friesian (27) Garvonesa (6) Limousin (17) Marinhoa (17) Maronesa (23) Mertolenga (17) Minhota (28) Mirandesa (23) Preta (29) Ramo Grande (18) Average

61 Capítulo 2 Y chromosome analysis in Portuguese cattle The AMOVA analysis (Table 2.6) showed significant (P<0.0001) differences between breeds with over 64% of the total genetic variation found among breeds within groups and 33-35% within breeds. Geographic distribution of breeds had no significant effect and accounted for only 2% of the total variability. Breed grouping based on traditional phenotypic types had no significant effect, with a negative component of variance. Table 2.6. AMOVA for cattle Y chromosome haplotypes. Groups N Among groups Variance Components (%) Among breeds within groups Within breeds Geographic Region Northern 7 Southern 5 Azores Archipelago 1 Overall (>0.05) Breed Group Brown Concave 5 Red Convex 4 Black Orthoid 3 Overall (>0.05) F statistics F CT (P) F ST (P) F SC (P) (<0.0001) (<0.0001) (<0.0001) (<0.0001) Phylogenetic Analysis The MJ network for Y chromosome haplotypes shows a conservative representation of relationships among haplotypes (Figure 2.1). B. indicus and B. taurus haplotypes were clearly separated by their well defined differences, as well as by postulated differences implied by two median vectors needed to connect the two clusters. The inclusion of Brahman individuals helped confirm previous results for Y chromosome data. Haplotypes H2Y1, H3Y1, H4Y1 and H5Y1 formed one cluster separated by one median vector from the cluster of H6Y2, H7Y2, H8Y2, H10Y2, H11Y2, H12Y2 and H13Y2. The Y1 cluster contained southern native breeds (Brava de Lide, Mertolenga and Preta), Ramo Grande and the exotic Friesian. H4Y1 was shared only by Ramo Grande and Friesian. Five of the Y2 haplotypes were connected to the two most central and frequent H6Y2 and H11Y2 and both Northern and Southern native breeds clustered within the Y2 group. 41

62 Capítulo 2 Y chromosome analysis in Portuguese cattle The French breeds Limousin and Charolais shared H6Y2 with several native breeds. H1Y2 found in three Brava and one Charolais was placed in an intermediate position in the network between B. taurus and B. indicus. Figure 2.1. Median-joining network constructed using Y chromosome haplotype data from 369 animals and representing 17 breeds of cattle. Circle sizes are proportional to the haplotype frequency. The black dots represent theoretical median vectors introduced by the network software. Breed groups are represented according to the following: Northern native (hatched), Southern native (white), exotics (light grey), Azores Archipelago (dark grey) and B. indicus (black). 42

63 Capítulo 2 Y chromosome analysis in Portuguese cattle 2.4. Discussion The combination of 5 SNPs, one indel and 7 STRs identified 13 Y chromosome haplotypes, one of which (H9Y3) was restricted to B. indicus. Several B. taurus breeds showed two haplotypes (H6Y2 and H11Y2) in high frequency and thus had a common genetic signature. Because homoplasy is not expected to be common in the nonrecombining region of the Y chromosome (Underhill et al. 2000), this signature likely represents shared ancestry. A similar pattern of frequency distribution in which a few haplotypes are represented in higher frequency across breeds has been described in African cattle based on 5 Y-STRs (Li et al. 2007) and in worldwide sheep breeds based on combined SNP-STR Y-haplotypes (Meadows et al. 2006). Compared with humans in which Y-haplotype diversity levels are >0.89 (Kayser et al. 2001), the low level detected in our breeds (average H of 0.2) is most probably related to the reduced effective male population size characteristic of domestic animal species. In horses, the small number of males used for breeding has been associated with the limited number of patrilines detected based on Y chromosome polymorphisms (Lindgren et al. 2004). This is also the case for our cattle breeds with more intensive breeding programs, such as Charolais, Friesian and Limousin, and the native Alentejana where artificial insemination is a regular practice. However, in the case of other native breeds such as Cachena, Garvonesa, Marinhoa, Maronesa, Minhota and Mirandesa, the lack of Y chromosome diversity might also be a consequence of genetic bottlenecks. In contrast to the low within-breed variation, Y-haplotype diversity was much higher among breeds within groups (64-78% and an overall F ST value of ) than has been reported for autosomal STRs (average F ST = ) (Mateus et al. 2004b). Geographical clustering of Y chromosome variability has been described for several species that have male-mediated dispersal and in which differences among population groups are further augmented by genetic drift (Kayser et al. 2001; Jobling & Tyler-Smith 2003; Bannasch et al. 2005; Meadows et al. 2006). The variance explained by geographical groups of native breeds (2%) was not significant and much lower than that found in dogs (11,5%, Bannasch et al. 2005), sheep (12,9%, Meadows et al. 2006) and humans (16,8%, Kayser et al. 2001). Most of these studies considered dispersal across wider regions such as continents, whereas in our case breeds are dispersed throughout a much smaller territory. Overall, Southern cattle 43

64 Capítulo 2 Y chromosome analysis in Portuguese cattle breeds presented higher diversity, as the number of haplotypes detected was twice that observed for the Northern group. Although traditional breed groups could be identified through clustering using genetic distances for autosomal STRs (Mateus et al. 2004b), this was not the case for Y-haplotypes in which no variation could be attributed to such population grouping. This is consistent with the results obtained for North Ethiopian cattle with similar molecular markers and where traditional breed classification could not explain the substructure of Y chromosome variation (Li et al. 2007). Among the three polymorphic STRs, the amount of variation found for INRA189 was unexpected when three alleles (86, 102, 106) were found in Portuguese cattle that had not been described previously in other B. taurus breeds (Edwards et al. 2000b; Li et al. 2007). The network results suggested that H1Y2 with the unusual INRA allele could represent a more ancestral haplotype of the B. taurus haplogroups. H1Y2 appears to be more related to H6Y2 with at least two intermediate theoretical haplotypes separating them. In addition, INRA allele, which was found in the West African taurine N Dama breed (Edwards et al. 2000b), was present in 8 native breeds and in four haplotypes of the Y2 group. This allele could be the result of an independent mutation event, and thus H11Y2 could have derived from the common H6Y2 by gain of a 2 bp repeat, and then have given origin to H10Y2 and H12Y2 through additional mutation events. The MJ network suggests that H7Y2, which also has the 104 allele, is derived from H6Y2 but it might be related to the H11Y2 group and have diverged by one mutation event occurring in UMN0103. Alternatively, the haplotypes bearing this allele could be considered further evidence of African cattle influence in breeds of the Iberian Peninsula, as has been suggested by the analysis of nuclear and mtdna (Cymbron et al. 1999; Cymbron et al. 2005). The presence of this allele in haplotypes of Southern and Northern breeds would also be consistent with a more complex pattern of introduction of African cattle that could even pre-date the traditional route associated with the Moorish invasions and occupation (Beja- Pereira et al. 2006; Davis 2008). This is supported by the detection of the 123 bp West African allele at the autosomal STR locus BM2113 in the Southern Portuguese Alentejana and Mertolenga breeds, and in the Northern Barrosã breed (Ginja 2002). 44

65 Capítulo 2 Y chromosome analysis in Portuguese cattle A more extensive survey of cattle Y-haplotypes with the markers used here and including North African breeds is needed to clarify the origin and patterns of male-mediated dispersion of cattle Y chromosome across the Iberian Peninsula. The Y-haplotypes that we identified incorporate the Y1 and Y2 patrilines described by Gotherstrom et al. (2005), which are predominant in Northern and Southern European breeds, respectively. While Y2 haplogroups were the most common among the native breeds, Y1 haplogroups were detected in three breeds from the Southern region, i.e., Brava de Lide (2 animals), Mertolenga (7 animals) and Preta (1 animal), and in the Ramo Grande (18 animals). Recent introgression of Northern European cattle could explain the presence of Y1 haplotypes in Portuguese breeds, but the most common exotic beef breeds used for crossbreeding, Limousin and Charolais, did not show these haplotypes. The other common exotic breed is Friesian, which appears to be fixed for H4Y1. Among the native breeds this haplotype was found only in Ramo Grande in high frequency (13 out of 18 animals). Considering that Friesian is the major exotic breed present in the Azores Archipelago, as well as the history of the native breed, which has suffered significant reduction in population size, we interpret this finding as evidence of male-mediated introgression of Friesian into the Ramo Grande. The presence of three distinct Y1 patrilines (H2Y1, H3Y1 and H5Y1) in continental native cattle could represent more ancient haplotypes which might have been derived from aurochs. The analysis of ancient bovid remains showed that the Y1 haplotype was present among aurochs from Germany, Italy and Sweden and in early domesticates (Gotherstrom et al. 2005). Analyses of mtdna have also suggested hybridization between wild and domestic cattle (Anderung et al. 2005). However, the process of cattle domestication and differentiation is complex and this hypothesis needs to be confirmed by the analysis of ancient specimens from the Iberian Peninsula and a more thorough survey of worldwide breeds. 45

66 Capítulo 2 Y chromosome analysis in Portuguese cattle 2.5. Future perspectives The establishment of a reference database and a common nomenclature for Y chromosome haplotypes in cattle, similar to that available for humans (Jobling & Tyler-Smith 2003), is important in order to standardize results and implement future comparison studies. Complementing our Y chromosome study with information from ancient cattle remains of the Iberian Peninsula, with worldwide breed surveys and with mtdna data would enhance our understanding of evolution and origins of domestic cattle. The Y- haplotypes described here can be used to investigate the demographic expansion of Iberian breeds which were spread throughout different countries during colonial periods and which are considered the ancestors of the Creole cattle of the Western Hemisphere. 46

67 Capítulo 3 ORIGINS AND GENETIC DIVERSITY OF NEW WORLD CREOLE CATTLE: INFERENCES FROM MITOCHONDRIAL AND Y CHROMOSOME POLYMORPHISMS

68

69 CAPÍTULO 3. ORIGINS AND GENETIC DIVERSITY OF NEW WORLD CREOLE CATTLE: INFERENCES FROM MITOCHONDRIAL AND Y CHROMOSOME POLYMORPHISMS C. Ginja 1,2,3, M. C. T. Penedo 3, L. Melucci 4, J. Quiróz 5, O. R. Martínez López 6, M. A. Revidatti 7, A, Martínez-Martínez 8, J. V. Delgado 8, L. T. Gama 2 1 Instituto Superior de Agronomia, Tapada da Ajuda, Lisboa, Portugal 2 Departamento de Genética e Melhoramento Animal, Instituto Nacional dos Recursos Biológicos, Fonte Boa, Vale de Santarém, Portugal 3 Veterinary Genetics Laboratory, University of California, One Shields Av., Davis, CA Instituto Nacional de Tecnología Agropecuaria, Balcarce, Argentina 5 Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, México 6 Facultad de Ciencias Agrarias, Universidad Nacional de Asunción, Paraguay 7 Universidad Nacional del Nordeste, Argentina 8 Departamento de Genética, Universidad de Córdoba, Córdoba, Spain Abstract The ancestry of New World cattle was investigated through the analysis of mitochondrial and Y chromosome variation in Creoles from Argentina, Brazil, Mexico, Paraguay and the United States of America. Breeds that influenced the Creoles, such as Iberian native, British and Zebu, were also studied. Creoles showed high mtdna diversity (H= ) with a total of 78 haplotypes, and the European T3 matriline was the most common (72.1%). The African T1a haplogroup was detected (14.6%), as well as the ancestral African-derived AA matriline (11.9%) which was absent in the Iberian breeds. Genetic proximity among Creoles, Iberian and Atlantic Islands breeds was inferred through their sharing of mtdna haplotypes. Y-haplotype diversity in Creoles was high (H = 0.779±0.019), with several Y1, Y2 and Y3 haplotypes represented. Iberian patrilines in Creoles were more difficult to infer and were reflected by the presence of H3Y1 and H6Y2. Y-haplotypes confirmed crossbreeding with British cattle, mainly of Hereford with Pampa Chaqueño and Texas Longhorn. Male-mediated Bos indicus introgression into Creoles was found in all populations, except Argentino1 (herdbook registered) and Pampa Chaqueño. The detection of the distinct H22Y3 patriline with the INRA allele in Caracú suggests introduction of bulls directly from West Africa. Further studies of Spanish and African breeds are necessary to elucidate the origins of Creole cattle, and determine the exact source of their African lineages. Keywords: Creole cattle; native breeds; genetic diversity; mitochondrial DNA; Y chromosome Animal Genetics (doi: /j x) 49

70

71 Capítulo 3 Origins and Genetic Diversity of Creole Cattle 3.1. Introduction Cattle were introduced in the Americas after the first trip of Columbus in The Spanish introduced animals primarily through the Caribbean Islands, whereas the Portuguese route occurred for the most part through Brazil (Rouse 1977). The Atlantic Islands such as Canary and Cape Verde were important intermediate ports between the Iberian Peninsula and the Western Hemisphere and were used as livestock depositories by the Spanish and the Portuguese, respectively (Rouse 1977; Rodero et al. 1992). Information regarding the appearance and types of cattle brought to the Americas is scarce. Even though cattle brought from southern Iberia are thought to be the main source, some authors refer to animals being transported from other regions, such as the north of Portugal and Galicia (Primo 1992; Rodero et al. 1992). Cattle spread throughout the American continent, became well adapted to a wide range of environmental conditions, and formed the so called Creoles (Rouse 1977). The introduction of Northern European breeds such as Angus, Hereford and Shorthorn, as well as zebu cattle (Bos indicus) during the 19 th century, threatened the Creole cattle which remained in isolated regions (Rouse 1977; Giovambattista et al. 2001). Iberian cattle share a common Middle Eastern ancestry with other European breeds and it is believed that the flow of livestock to the Peninsula occurred through the mainland and the Mediterranean region (Cortes et al. 2008). Another source of cattle are African animals thought to have arrived in Iberia during the Bronze Age (Anderung et al. 2005; Beja- Pereira et al. 2006), but also introduced later during the Moorish occupation from the 8 th to the 13 th century (Cymbron et al. 1999). The contribution of aurochs to the ancestry of Iberian cattle breeds is debated (Beja-Pereira et al. 2006). The analysis of mitochondrial DNA (mtdna) sequence variation has been widely used to study the origins of domestic cattle and breed relationships (Bruford et al. 2003). Ten major mtdna haplogroups were identified in cattle, corresponding to the ancient B. primigenius matriline (P), the indicine I1 and I2, and the taurine T, T1, T2, T3, T4, T5 and Q (Loftus et al. 1994; Troy et al. 2001; Mannen et al. 2004; Lai et al. 2006; Achilli et al. 2008). These haplogroups are geographically structured with predominance of T1 and T1a in Africa (Troy et al. 2001; Achilli et al. 2008), T2 in Western Asia (Lai et al. 2006), T3 in Europe (Troy et al. 2001), T4 in East Asia (Mannen et al. 2004). 51

72 Capítulo 3 Origins and Genetic Diversity of Creole Cattle T5 was found in a few animals from Italy and Iraq (Achilli et al. 2008). Haplogroup Q was detected in native Italian breeds and appears to represent auroch mtdna (Achilli et al. 2008). A new African-derived lineage (AA) was found in Creole cattle (Miretti et al. 2002). One limitation of mtdna analysis is that it retrieves an incomplete history as it reflects exclusively the genetic relationship through matrilines. Y chromosome markers complement this information, and are useful to study the origins and evolution of domestic animals (Gotherstrom et al. 2005; Meadows et al. 2006; Anderung et al. 2007; Bollongino et al. 2008). In cattle, Y chromosome microsatellites (STRs) were used to distinguish between B. taurus and B. indicus ancestry (Bradley et al. 1994). Gotherstrom et al. (2005) used single nucleotide polymorphisms (SNPs) to define three cattle Y-haplogroups (Y1 and Y2 in B. taurus and Y3 in B. indicus), and to investigate auroch contributions to the genetic composition of modern breeds. Recently, Ginja et al. (2009) used a combination of SNPs and STRs specific to the nonrecombining region of the Y chromosome to describe 13 haplotypes in Portuguese cattle. The first study of mtdna lineages in Creole cattle was reported by Miretti et al. (2002) in one Argentinean and four Brazilian breeds. Other mtdna studies corroborated the European ancestry of Creoles, but also detected the influence of African cattle (Magee et al. 2002; Carvajal-Carmona et al. 2003; Mirol et al. 2003; Miretti et al. 2004). However, none of these studies included North American Creoles. Information on Creole patrilines is also very scarce and, to our knowledge, limited to one report in which the STR INRA124 was used to detect male-mediated B. indicus introgression (Giovambattista et al. 2000). We analysed the genetic diversity of Creole cattle using mtdna and Y chromosome markers. The origins of North and South American Creoles and the contribution of breeds from Iberia, the Atlantic Islands, and other European countries to their genetic make-up were investigated. Malemediated B. indicus introgression was also assessed based on Y-haplotypes. 52

73 Capítulo 3 Origins and Genetic Diversity of Creole Cattle 3.2. Materials and methods Sample collection and DNA extraction Samples were collected from 413 animals (106 females, 307 males) of 13 native Portuguese cattle breeds: Alentejana (8, 31), Arouquesa (8, 31), Barrosã (8, 33), Brava de Lide (8, 26), Cachena (8, 25), Garvonesa (10, 6), Marinhoa (8, 17), Maronesa (8, 23), Mertolenga (8, 17), Minhota (8, 28), Mirandesa (8, 23), Preta (8, 29) and Ramo Grande (8, 18). Samples from Spain included three native breeds: Canaria (8, 14), Mostrenca (8, 21) and Palmera (8, 25). For the related Creoles of the Americas, we collected a total of 352 (97, 158) samples. From Argentina we sampled Argentino1 (8, 18) which included registered animals from Central Argentina, and Argentino2 (6, 6) which were free ranging animals from the north-eastern part of the country. From Brazil we sampled the Caracú breed (48 males). The Mexican Creoles were sampled in Baja California (20 females), Chiapas (8, 12), Chihuahua (15, 4), Nayarit (16 females), and Puebla (16 females). Additionally, we sampled one Creole population in Paraguay, Pampa Chaqueño (8, 25), and the North American Texas Longhorn (45 males). European (35, 195) and Zebu (19, 28) breeds which may have influenced Creoles were also analyzed: Angus (6, 41), British White (21 males), Charolais (8, 13), Friesian (8, 27), Hereford (5, 45), Jersey (20 males), Limousin (8, 17), Shorthorn (11 males), Brahman (13, 7) and Gyr (6, 21). Samples from British cattle were obtained in the U.S.A., except for 12 Angus and 11 Hereford which were from Argentina. The zebu samples were collected in Mexico, except for five Brahman bulls from which semen samples were obtained from a commercial source (Bovine Elite, Llc., USA). Charolais, Friesian and Limousin were sampled in Portugal. Care was taken to select unrelated individuals based on pedigree information where herdbook records were available. DNA was extracted from whole blood, semen or hair roots using the Gentra kit (PUREGENE, Gentra Systems, Inc.) PCR amplification and mtdna sequencing A fragment of approximately 1.1 Kb was amplified with forward primer CTGCAGTCTCACCATCAACC (L15737; Loftus et al. 1994) and reverse primer CCTAGAGGGCATTCTCACTGGG (H516; Miretti et al. 2002). Platinum High fidelity Taq DNA 53

74 Capítulo 3 Origins and Genetic Diversity of Creole Cattle polymerase and SuperMix (Invitrogen, Carlsbad, CA) were used in 25 μl volume PCRs following manufacturer s recommendations. PCR cycling consisted of initial denaturation at 94 o C for 2 min; 40 cycles at 94 o C for 30 s, 55 o C for 30 s, and 72 o C for 90 s with a final extension at 72 o C for 10 min. Direct cycle sequencing was done with the BigDye Terminator v3.1 kit (Applied Biosystems, Foster City, CA), with the forward primer and an internal forward primer CTTAATTACCATGCCGCGTG (MacHugh et al. 1999). Products were separated on ABI 3730 DNA Analyzer instruments (Applied Biosystems, Foster City, CA, USA) and sequences analyzed with SEQMAN II v6.1 (DNASTAR Inc., Madison, WI, USA) Statistical Analysis of mtdna data The mtdna sequences were aligned with ClustalW multiple alignment algorithm of BIOEDIT v7.0.1 (Hall 1999). Haplotype identification was done with GENALEX v6.0 (Peakall & Smouse 2006). ARLEQUIN v2.0 (Schneider et al. 2000) was used to estimate haplotype diversity (H±SD), nucleotide diversity (π±sd) for each population (Nei 1987), and pairwise F ST values (5% significance level obtained with 10,000 permutations). The mean number of pairwise nucleotide differences (MNPD) (Tajima 1983) within each population was estimated assuming heterogeneity of substitution rates per site (Tamura & Nei 1993). A hierarchical likelihood ratio test (hlrt) was used with MODELTEST v3.7 (Posada & Crandall 1998; available at to determine the best-fitting evolutionary model for the data and to estimate gamma distribution parameters (Posada & Crandall 2001). Analysis of molecular variance (AMOVA) was done with ARLEQUIN to test the effect of geographic breed grouping (Iberia, Atlantic Islands, Creoles, Zebu, United Kingdom, and Inland Europe) on total genetic variance. NETWORK v (Bandelt et al. 1999) was used to construct Median-Joining (MJ) networks between haplotypes with nucleotide (nt) substitutions weighted 10 for transitions and 30 for transversions. First a reduced-median (RM) network was constructed using a binary dataset, and the outputs then used to obtain the MJ networks. A neighbor-joining (N-J) dendrogram depicting breed group relationships was constructed from genetic distances (Tamura & Nei 1993) and using POPULATIONS v (Langella 1999). 54

75 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Analysis of Y chromosome SNPs and STRs Y chromosome haplotype analysis was done with 13 Y-specific markers as described by Ginja et al. (2009). Haplotype frequency and diversity (H±SD), pairwise F ST values (10,000 permutations for 5 % significance level), and AMOVA were obtained with ARLEQUIN v2.0 (Schneider et al. 2000). NETWORK v (Bandelt et al. 1999) was used to construct MJ networks of haplotypes as described in Ginja et al. (2009). A N-J dendrogram of breed group relationships was constructed from linearized F ST values (Slatkin 1995) with POPULATIONS v (Langella 1999) Results mtdna haplotype diversity Sequences of the complete D-loop region (919 bp) were aligned with the B. taurus (Eucons) reference sequence (Anderson et al. 1982). A total of 311 haplotypes (accession numbers FJ FJ816013) were identified in 569 animals and 35 cattle populations. Among 142 total variable sites detected, 86 were phylogenetically informative, 37 were singletons and 19 were indels (Table S3.1). Nucleotide frequencies for this region were: A= ; C = ; G = ; and T= The transition/transversion rate of 21.1:1 determined by MODELTEST confirmed a strong bias towards transitions. Haplotype frequencies across breeds are shown in Table S3.2. Hap209 was shared by several breeds of the 6 geographic groups and was identical to the Eucons. In the Creole group, Hap209 was the most common and found in five populations. Creoles shared the highest number of haplotypes (9) with the Iberian group, followed by the British (4), the Atlantic Islands (2) and Zebu (2). Three haplotypes (Hap054, Hap243, and Hap274) were shared exclusively among Iberian, Atlantic Islands and Creole cattle. Only one haplotype was shared between British (Angus), Zebu (Brahman) and the Creoles (Baja California and Nayarit). Hap039 was found in two individuals from the Atlantic Islands (Ramo Grande and Palmera) and in one from Mexico (Nayarit), but also in two Angus from Argentina. Hap211 was found in one Garvonesa, two Creoles from Mexico (Baja California and Chihuahua), and in one Angus. Estimates of mtdna genetic diversity within cattle populations and in each of the 6 geographic groups are summarized in Table 3.1. A total of 78 haplotypes were detected 55

76 Capítulo 3 Origins and Genetic Diversity of Creole Cattle among the Creoles of which 48 were unique of this group. The overall diversity estimates for Creoles were H=0.984±0.003, π=0.006±0.003, and MNPD=5.0±2.5. Among all breeds analysed, Palmera had only 6 haplotypes and the lowest diversity for all estimates (H=0.857±0.056, π=0.002±0.001, MNPD=2.0±1.2). Cachena, Minhota, British White and Shorthorn had the highest diversity, with all animals in each breed showing different haplotypes. Haplotype differences estimated as MNPD and π, tended to be uniform across breeds, with exception of the higher values found in Alentejana, the Creoles Baja California and Pampa Chaqueño, and Shorthorn mtdna differentiation and AMOVA Pairwise F ST values estimated between 35 cattle populations are shown in Table S3.3 and average pairwise F ST values per breed and group are summarized in Table 3.1. Among all breeds, Pampa Chaqueño, Caracú and Gyr had the highest average F ST (21.0±0.060, 19.0±0.073 and 11.3±0.055, respectively). Among Iberian breeds, Preta and Maronesa had the highest average F ST (7.6±0.051 and 7.2±0.055, respectively) whereas Minhota had the lowest (2.0±0.050). Within the Atlantic Islands, Palmera had the highest average F ST (8.7±0.066). Within the Creoles, Nayarit had the lowest average F ST (3.3±0.047). For the United Kingdom and Inland Europe groups, Angus and Charolais had the lowest average F ST (3.1±0.058 and 3.2±0.061, respectively), whereas British White had the highest (6.5±0.052). When pairwise F ST was calculated among breed groups, Creoles and Zebu were significantly (P<0.05) differentiated from all others (results not shown). The AMOVA analysis showed significant differences among breeds within groups (P<0.0001) which accounted for 5.1% of the total genetic variation (Table S3.4). Geographic clustering of breeds had a significant effect (P<0.05) but explained only 1.2% of the total variance, such that 93.7% of the variation corresponded to differences among individuals. When AMOVA was done for major haplogroups (European T3, Iberian Q, African T1/T1a, and African derived Creole AA) found in each region, results were highly significant (P < ) with differences among haplogroups accounting for most (52%) of the genetic variation (Table S3.4). A much lower effect of individual differences was observed (46%), whereas differences among regions within haplogroups explained only 1.5% of the total variation. 56

77 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Table 3.1. Estimates of mtdna genetic diversity within 35 cattle populations and 6 geographic groups. Breeds N H b SD π c SD MNPD a SD TNH d EH e F ST (%) SD f Arouquesa Barrosã Cachena Marinhoa Maronesa Minhota Mirandesa Alentejana Brava de Lide Garvonesa Mertolenga Preta Mostrenca Iberia Ramo Grande Canaria Palmera Atlantic Islands Argentino1& Baja California Caracú Chiapas Chihuahua Poblano Nayarit Pampa Chaqueño Texas Longhorn Creoles Brahman Gyr Zebu Angus British White Hereford Jersey Shorthorn United Kingdom Charolais Friesian Limousin Inland Europe a MNPD - mean number of pairwise nucleotide differences (including indels) between haplotypes; b H Haplotype diversity; c π - Population nucleotide diversity; d TNH - Total number of haplotypes; e EH - Exclusive haplotypes; f SD - Standard deviation 57

78 Capítulo 3 Origins and Genetic Diversity of Creole Cattle mtdna phylogenetics The best-fitting model of sequence evolution determined with MODELTEST was the HKY+I+G of Hasegawa, Kishino and Yano (1985). The shape parameter of the gamma distribution ( ) was and the proportion of invariable sites (I) was The RM networks (Figure 3.1) show the relationships between mtdna haplotypes in five geographic regions: Americas (Creoles), Atlantic Islands, Iberia, Inland Europe, and the United Kingdom. The zebu breeds (Brahman and Gyr) were included within the Creoles. Reference sequences (Table S3.5) representing known mtdna haplogroups were included in each network. In every geographic region, most haplotypes clustered within two distinct haplogroups: the African (T1a) and the European (T3). United Kingdom 58

79 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Inland Europe Iberian 59

80 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Atlantic Islands 60 North and South America (Creoles and Zebu) Figure 3.1. Reduced-median networks of mtdna haplotypes observed in cattle from the United Kingdom, Inland Europe, Iberia, the Atlantic Islands, and North and South America (Creoles and Zebu). The networks were reduced at the following positions: 16,049 and 16,057 (United Kingdom); 16,057, 16,131, 16,133, and 16,248 (Inland Europe); 15,947, 16,057, 16,122 and 351 (Iberia); 16,057, 16,131, 16,133, and 16,302 (Atlantic Islands); and 16,057 (Americas). Colours illustrate haplogroups as follows: T purple, T1 orange, T1a light orange, AA yellow, T2 green, T3 red, and Q brown. Circle sizes are proportional to the haplotype frequency. Haplotypes containing reference sequences are denoted by bold circles. Theoretical median vectors introduced by the Network software are represented by black dots.

81 Capítulo 3 Origins and Genetic Diversity of Creole Cattle For the Creoles, a total of 22 animals had T1a African type (found in every breed) and 109 individuals belonged to the European T3 haplogroup. We also found one Chihuahua of T1 type; four Caracús, 7 Pampa Chaqueños, and one Chihuahua of AA type; and one Chihuahua of T2 type. We identified new haplotypes related to the AA lineage in five animals from Baja California (Hap089) and one Chihuahua (Hap293) which clustered together in the Creoles RM network. A more detailed analysis of all African derived haplotypes (not shown) suggests that Hap293 more likely belongs to the T1a haplogroup even though it has the transition at nt 16,222 and that Hap089 is more closely related to the AA group. Interestingly, all B. indicus individuals showed B. taurus matrilines most of which belonged to the T3 group, except for 6 Brahman that showed African T1a types. In Iberia, 175 samples were of T3 type, and the T1a haplogroup was detected in 26 animals across different breeds, except for Marinhoa, Maronesa, and Preta. Three Marinhoa and one Mertolenga had the T2 type, and one Alentejana the Q type. One Arouquesa showed a Q haplotype (Hap086), however it clustered within T3. Coding-region sites are needed to infer Q reliably (Achilli et al. 2008) and even though this Arouquesa had the transversion typical of the Q haplogroup (nt 15,953), it was similar to the reference T3. In the Atlantic Islands, Ramo Grande and Canaria showed African influence with 6 animals of T1a type and one Canaria of T1 type, whereas all Palmeras had T3 type. Among the Inland Europe and United Kingdom breeds, most animals had T3 type except two Charolais with T1a and two with T2 type, two Angus from Argentina which were T1a, and three Herefords from Argentina which were AA (Hap070 and Hap268). This African matrilines most probably result from recent crossbreeding. The N-J dendrogram of genetic distances (Tamura & Nei 1993) between breed groups is shown in Figure 3.2. Creoles and Zebu clustered separately from all breeds but the Creoles were closer to the Iberian and Atlantic Islands than to the remaining European breeds. 61

82 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Figure 3.2. Neighbor-joining dendrogram obtained from genetic distances (Tamura & Nei 1993) between Iberian, Atlantic Islands, Creole, Zebu, United Kingdom and Inland European cattle mtdna sequences Y chromosome diversity Among the 24 Y-haplotypes found in 748 bulls, 7 were of the Y1 and 11 were of the Y2 haplogroups characteristic of B. taurus (Table 3.2). Additional variation was found within the B. indicus Y3 haplogroup, with 6 haplotypes identified. One SNP (UTY_19) and the indel (ZFY_10) were sufficient to discriminate Y1 and Y2 haplogroups. The remaining SNPs and three STRs (DDX3Y_1, BM861 and INRA124) distinguished between B. taurus and B. indicus lineages. Three STRs (INRA189, UMN0103 and UMN0307) were variable and defined new haplotypes in both taurine and zebu cattle. One STR (UMN0504) was monomorphic across breeds. The most frequent haplotypes were H6Y2 (0.227) and H11Y2 (0.148) followed by H14Y1 (0.128) and H3Y1 (0.131). Within the Y3 haplogroup, the most frequent haplotype was H18Y3 (0.053), which was fixed in Gyr. 62

83 Table 3.2. Y chromosome haplotypes defined by 5 SNPs, 1 indel and 7 STRs and their overall frequency (N). Haplotype N DDX3 Y1 SNPs Indel STRs DDX3 UTY ZFY ZFY ZFY DDX3 BM INRA INRA Y7 19 a Y H1Y C C A C C GT H2Y C C C C C H3Y C C C C C H4Y C C C C C H5Y C C C C C H6Y C C A C C GT H7Y C C A C C GT H8Y C C A C C GT H9Y T T A T T GT /122 b H10Y C C A C C GT H11Y C C A C C GT H12Y C C A C C GT H13Y C C A C C GT H14Y C C C C C H15Y C C C C C H16Y C C A C C GT H17Y C C A C C GT H18Y T T A T T GT /124 b H19Y T T A T T GT /122 b H20Y T T A T T GT /124 b H21Y T T A T T GT /130 b H22Y T T A T T GT /124 b H23Y C C C C C H24Y C C A C C GT a Results from the pyrosequencing assay (G/T) were converted to match Gotherstrom et al b Two fragments amplified in B. indicus. UMN 0103 UMN 0307 UMN 0504

84 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Overall, Y-haplotype diversity was generally low (mean H = 0.240±0.295) with several breeds showing a fixed haplotype (Table 3.3). We identified 12 private haplotypes with frequencies ranging between 0.04 in Brava de Lide (H5Y1) and 1.00 in Caracú (H22Y3). Furthermore, 6 haplotypes were found exclusively in Iberia, five in the Creoles, two in United Kingdom breeds, and one each in the Atlantic Islands and Inland European breed groups. The highest diversity was found among Creoles (H = 0.779±0.019), Iberian breeds (H = 0.712±0.016), and also within the Atlantic Islands (H = 0.677±0.037). The more intensively selected breeds from United Kingdom and Inland Europe had lower diversity (H = 0.636±0.025 and H = 0.546±0.026, respectively), whereas the Zebu group had the lowest diversity (H = 0.389±0.084). While these groups included fewer breeds, this result probably reflects a lower number of effective males within the more intensively selected breeds. Among Iberian breeds of the Y1 haplogroup, Mostrenca was fixed for H3Y1 and Mertolenga had H2Y1 in high frequency. Within the Canary Islands, Canaria showed both Y1 and Y2 types, whereas Palmera was almost fixed for H23Y1 which was exclusive of this breed group. Creole cattle had a heterogeneous composition with Y1, Y2 and Y3 haplogroups. Introgression from B. indicus was detected among all Creoles except Argentino1 and Pampa Chaqueño. United Kingdom cattle were mainly of the Y1 haplogroup, with H3Y1 haplotype fixed in Angus and Shorthorns, and H14Y1 fixed in Hereford. Jersey was an exception with H17Y2 in high frequency. The Inland European breeds belonged to the Y2 haplogroup, except for Friesian which was fixed for H4Y Y chromosome differentiation and AMOVA Pairwise F ST values for Y-haplotypes (Table S3.6) ranged from nearly zero to one, and were mostly significant (P < 0.05). Due to their sharing of H3Y1, Mostrenca, Angus and Shorthorn were not significantly differentiated (P > 0.05). We found non-significant (P > 0.05) pairwise F ST values among Argentino1 and the Portuguese breeds Brava de Lide (F ST = 0.050) and Garvonesa (F ST = 0.103). Based on average F ST values, Caracú (F ST = 0.905±0.180) was the most differentiated breed, whereas Chiapas was the least (F ST = 0.444±0.212). Mexican Creoles from Chihuahua and Chiapas were not significantly differentiated (F ST = 0.010, P>0.050). 64

85 Table 3.3. Y chromosome haplotype frequency and diversity (H±SD) within breeds.

86 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Pampa Chaqueño was not significantly (P > 0.05) differentiated from Hereford. Mean pairwise F ST among Creoles was 0.626±0.183, similar to that found for the Iberia (0.647±0.113), Atlantic Islands (0.671±0.144) and Inland Europe (0.688±0.145) breed groups. United Kingdom breeds were slightly more differentiated (average F ST = 0.752±0.081) and the Zebu group the most differentiated (average F ST = 0.830±0.046). We detected significant (P < ) differences among breeds based on the AMOVA analysis of the Y-haplotype data, with approximately 62% of the total genetic variation found between breeds within groups and 22% corresponding to individual differences (Table S3.4). Breed grouping based on geographic origin had a significant effect (P < 0.001) and accounted for approximately 16% of the total genetic variation Y chromosome phylogenetics Relationships among Y-haplotypes and their breed distributions are depicted in the MJ network of Figure 3.3. Haplotypes H2Y1, H3Y1, H4Y1, H5Y1, H14Y1, H15Y1 and H23Y1 were separated from H6Y2, H8Y2, H10Y2, H11Y2, H12Y2, H13Y2, H16Y2, H17Y2 and H24Y2 by two median vectors forming two clusters corresponding to Y1 and Y2 haplogroups, respectively. The Iberian H7Y2 from Arouquesa had an intermediate position and was separated from the Y1 cluster by only one median vector. H1Y2 clustered within the Y2 group and was separated from Y1 haplotypes by three median vectors. The B. indicus Y3 haplogroup was clearly separated from the B. taurus Y1 and Y2 clusters. Creole cattle shared H3Y1, H4Y1and H14Y1, H6Y2 and H17Y2 with several B. taurus breeds. With the exception of Argentino1 and Pampa Chaqueño, Creoles also clustered within the Y3 haplogroup together with Brahman and Gyr. The newly detected H22Y3 of Caracú had a more distant position in the network and may represent a more ancestral haplotype. 66

87 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Figure 3.3. Median-joining network constructed with Y-haplotypes from 748 bulls representing 33 cattle populations. Circle sizes are proportional to the haplotype frequency. Breed groups were defined based on geographic origins and are represented according to the following: Iberia (white), Atlantic Islands (dark grey), Creoles (orange), Zebu (black), United Kingdom (green) and Inland Europe (light grey). Theoretical median vectors introduced by the Network software are represented by black dots. The N-J dendrogram of Y-haplotypes among breed groups is shown in Figure 3.4. Creoles had an intermediate position between the most distant Zebu and the other groups and were more closely related to the United Kingdom breeds than to the other groups. 67

88 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Figure 3.4. Neighbor-joining dendrogram obtained from genetic distances between Iberian, Atlantic Islands, Creole, Zebu, United Kingdom and Inland European cattle Y-haplotypes. A summary of mtdna and Y-haplogroups is shown in Table 3.4. African influence (mtdna T1 and T1a; African Y-alleles) was detected in most Iberian and Atlantic Islands breeds. In Creoles, African matrilines (T1, T1a and AA) were detected in all populations, whereas African patrilines were only found in Caracú and Chiapas. In the United Kingdom and Inland European breeds, African matrilines were detected in British White (T1a), Hereford from Argentina (AA) and Charolais (T1a), whereas African patrilines were found only in British White and Jersey. 68

89 Capítulo 3 Origins and Genetic Diversity of Creole Cattle Table 3.4. Frequency (%) of mtdna and Y chromosome haplogroups, and of African Y-alleles per breed and geographical groups. Breeds mtdna Y chromosome T1 T1a AA T2 T3 Q N Y1 Y2 Y3 African Alleles Arouquesa Barrosã Cachena Marinhoa Maronesa Minhota Mirandesa Alentejana Brava de Lide Garvonesa Mertolenga Preta Mostrenca Iberia Ramo Grande Canaria Palmera Atlantic Islands Argentino1& Baja California Caracú Chiapas Chihuahua Poblano Nayarit Pampa Chaqueño Texas Longhorn Creoles Brahman Gyr Mean for Zebu Angus British White Hereford Jersey Shorthorns United Kingdom Charolais Friesian Limousin Inland Europe Overall N 69

90 Capítulo 3 Origins and Genetic Diversity of Creole Cattle 3.4. Discussion Creole cattle showed high genetic diversity of mtdna and Y chromosome haplotypes several of which were exclusive of this breed group. The Y-diversity found in Iberia and Creoles was higher compared to the more intensively selected European breeds, which were fixed or nearly so for a Y-haplotype. Our results did not reflect a founder effect from the dispersion of a few Iberian animals introduced in the Americas, but rather the heterogeneous genetic makeup of Creoles. Previous studies have also found high levels of diversity within Creole cattle (Giovambattista et al. 2001; Carvajal-Carmona et al. 2003). Creoles represent important reservoirs of cattle genetic diversity and should be subject of conservation measures. Signatures of Iberian ancestry in Creole cattle were inferred from mtdna and Y- haplotypes. Among the matrilines found in Creoles, the common European T3 haplogroup was prevalent ( 72%) and most of the haplotypes shared exclusively with Iberia and/or the Atlantic Islands were of this group. The haplotypes shared with animals from the Atlantic Islands are consistent with the use of these Islands as intermediate ports between Iberia and the Americas (Rouse 1977). Iberian cattle had a high incidence of African T1a matrilines, which were also found in all Creole populations with an overall frequency of 15%. The more divergent African-derived AA lineage was found in Baja California, Caracú, Chihuahua and Pampa Chaqueño, and accounted for 12% of the Creole haplogroups. Although we did not detect the AA lineage in the Iberian samples that we analysed, this matriline has been found in the Spanish Retinta (Miretti et al. 2004) and in one de Lidia individual (Cortes et al. 2008). Iberian origin of Creole patrilines was more difficult to infer but could be reflected by the presence of H3Y1 and H6Y2. H3Y1 was found in Mostrenca (fixed), Brava de Lide and Ramo Grande but this haplotype was also fixed in Angus and Shorthorn, and was in high frequency in British White. Thus it is not possible to determine if the presence of H3Y1 in Creoles reflects Iberian ancestry, or more recent crossbreeding with British bulls which is known to have occurred in the late 19 th century (Rouse 1977). Interestingly, the finding that Mostrenca belongs to the Y1 haplogroup, which based on the analysis of ancient DNA was frequent in aurochsen (Gotherstrom et al. 2005), appears to indicate the contribution of 70

91 Capítulo 3 Origins and Genetic Diversity of Creole Cattle wild bulls to this breed. Mostrenca is a semi-feral breed from the Doñana region and is kept isolated from other cattle populations (Rodero et al. 1992; Martinez et al. 2005). H6Y2 is the prevalent patriline in Iberia and also found in Creoles from Argentina, Mexico and U.S.A. The analysis of Y-haplotypes in other Spanish breeds thought to have been brought to the Americas, such as Retinta and Rubia Galega, would help clarify the Iberian origin of Creole patrilines. Whereas mtdna lineages reflected the genetic proximity among Creoles, Iberian and Atlantic Islands breeds, male-mediated B. indicus introgression was evident in most Creole populations except for Argentino1 and Pampa Chaqueño, and accounted for 51% of Y-haplogroups. No B. indicus matrilines were found in the Creoles which suggested that the first cattle introduced in the Americas were strictly B. taurus and that crossbreeding with zebu bulls occurred later (Meirelles et al. 1999; Miretti et al. 2004). Interestingly, the Brahman and Gyr animals that we analysed also had taurine mtdna sequences. These results are in agreement with other studies which reported phenotypically zebuine animals with taurine mtdna (Miretti et al. 2002; Mirol et al. 2003). Troy et al. (2001) attributed the absence of zebuine mtdna in African humped cattle to ancestral crossbreeding with B. taurus. The B. indicus patriline H22Y3 detected exclusively in Caracú, and fixed in this breed, supports the hypothesis of introduction of bulls directly from Africa during colonial times. H22Y3 carries the INRA allele, which was also detected in the West-African taurine N Dama (Edwards et al. 2000b). Hanotte et al. (2000) found zebu patrilines in taurine African cattle, including the N Dama from Guinea-Bissau which was a Portuguese colony. Cattle were introduced in Brazil by Portuguese settlers (Primo 1992), and Portugal had colonies in West Africa, and the islands of Cape Verde and S. Tomé e Principe, since the 15 th century until It is possible that cattle from Africa may have been introduced in Brazil through slave trade routes (Rouse 1977). In order to determine the exact origin of the Caracú patrilines, it will be necessary to analyse additional samples from the African continent, as well as other zebu breeds from Brazil. The contribution of African bulls can also be inferred through the detection of INRA allele as discussed by Ginja et al. (2009), and this allele was found in Y-haplotypes of Canaria (H11Y2), Chiapas (H17Y2), British White (H11Y2 & H16Y2) and Jersey (H17Y2) breeds. Magee et al. (2002) used autosomal STRs to infer West 71

92 Capítulo 3 Origins and Genetic Diversity of Creole Cattle African ancestry in Guadeloupe Creoles of the Caribbean. Therefore, the introduction of African cattle directly in the Americas appears to have occurred at least in Brazil and the Caribbean. The African influence detected in British White and Jersey breeds could be related with their putative Roman origin (Rouse 1970). The common H11Y2 haplotype was detected in animals from both breeds, as well as a patriline specific of each breed (H16Y2 and H17Y02, respectively). These haplotypes have the INRA allele and differ by allele variation at locus UMN0103. The analysis of autosomal STRs has also depicted a close genetic relationship among Jersey and African N Dama cattle from Guinea (Cymbron et al. 2005). Despite there is some indication of an African influence in these two breeds, a more complete analysis of European cattle is needed to determine the origins of their patrilines. We report a wider dispersal of the ancestral African derived AA matriline, which is found in Brazil, Paraguay and as far north as in Baja California. The detection of this lineage in Caracú (40%), as well as in three other Creole cattle from Brazil (Miretti 2002), and its absence in Portugal, lend support to the hypothesis of direct introduction of African cattle, although AA haplotypes have yet to be found in Africa (Liron et al. 2006a). Miretti et al. (2002; 2004) attributed the presence of the AA haplogroup in Caribbean Creoles to their Spanish ancestry but did not exclude the possibility that it existed in Portuguese cattle brought to Brazil during colonial times and disappeared since then. Sequencing additional mitochondrial regions could help to better characterize the AA haplogroup. Even though variation across the control region as provided valuable information regarding the genetic origins of cattle, complete mtdna sequences might be needed to determine more accurately the phylogeny of maternal haplogroups (Hiendleder et al. 2008, Achilli et al. 2008). Our results showed that Creoles retain genetic signatures of their Iberian ancestry, but also confirmed more recent introgression of zebu and British breeds. The high incidence of African lineages in Creoles is related with their Iberian origin, but direct contribution of cattle from West Africa cannot be excluded. Y-haplotypes were valuable to better understand the origins of Creoles and to complement mtdna information, particularly regarding the contributions of African cattle. Nonetheless, more comprehensive studies of Spanish and African breeds with mtdna and Y chromosome markers would be helpful to further clarify their contributions to the Creole cattle of the Americas. 72

93 Capítulo 4 ANALYSIS OF STR MARKERS REVEALS HIGH GENETIC STRUCTURE IN PORTUGUESE NATIVE CATTLE

94

95 CAPÍTULO 4. ANALYSIS OF STR MARKERS REVEALS HIGH GENETIC STRUCTURE IN PORTUGUESE NATIVE CATTLE Catarina Ginja 1,2,3, Luís Telo da Gama 2, Maria Cecília T. Penedo 3 1 Instituto Superior de Agronomia, Tapada da Ajuda, Lisboa, Portugal 2 Departamento de Genética e Melhoramento Animal, Instituto Nacional dos Recursos Biológicos, Fonte Boa, Vale de Santarém, Portugal 3 Veterinary Genetics Laboratory, University of California, One Shields Av., Davis, CA Abstract Genetic structure and diversity of 13 Portuguese native and three imported cattle breeds were assessed with 39 microsatellites. Allelic richness per locus was high, with an overall average of 8.3±2.5. The mean observed and expected heterozygosities were 0.673±0.043 and 0.691±0.034, respectively. The mean number of alleles per breed ranged between 5.36±1.27 and 7.87±2.66. Brava de Lide and Mirandesa breeds had the lowest genetic diversity, whereas Minhota, Arouquesa and Mertolenga had the highest. Significant (P < 0.05) heterozygote deficit was detected in all breeds except Garvonesa, Marinhoa, Minhota and Limousin. Hardy-Weinberg deviations are most probably due to inbreeding, particularly in Alentejana, Brava de Lide, Mertolenga and Ramo Grande (F is > 0, P < ). Based on the principal component and the Neighbor-Net analyses, Mirandesa was the most genetically distinct breed. Even though admixture was detected across all breeds (6.7%, q < 0.800), the molecular structure was consistent with original breed designations, with the exception of Cachena which had a clear influence of Barrosã (K=15). Mertolenga showed substructure with independent clustering of red speckled animals. The percentage animals correctly assigned was 90 in all breeds except Cachena, Garvonesa and Preta (q 0.800). The results obtained here confirmed that high levels of genetic diversity exist within Portuguese native cattle and that the breeds are highly structured. Conservation measures should be implemented for all native breeds to minimize inbreeding. Keywords: native cattle; microsatellites, genetic structure; admixture; breed assignment Journal of Heredity (in press) 75

96

97 Capítulo 4 Genetic Structure of Portuguese Native Cattle 4.1. Introduction In Portugal there are 13 breeds of native cattle that are raised in specific geographic regions and which have distinct characteristics described in the breed standards adopted in the herdbooks that maintain animal records for each breed. The introduction of imported breeds such as Friesian, Charolais and Limousin has threatened native cattle populations in the mid 20 th century (Ralo & Guerreiro 1981). For most native breeds, the number of breeding animals has declined and these genetic resources are at some level of risk of extinction (Gama et al. 2004). Even though most of the Portuguese native cattle have not been under intensive selection, recent bottlenecks have been detected through pedigree analysis. For example, the Alentejana breed shows signs of genetic erosion, and based on demographic parameters one male accounts for 60 % of the Y chromosomes currently represented (Carolino & Gama 2008). The marketing of certified meat products for the last decade has helped counteract the decline tendency with an increase in meat production from Portuguese native breeds of about 40% (Gama et al. 2004). Nonetheless, conservation measures are still needed to assure that these breeds are maintained. The genetic characterization of local genetic resources is important for the implementation of breedspecific conservation programs, but also to generate information for comparisons of genetic diversity at wider geographic scales (Bruford et al. 2003). The origins of Portuguese cattle have been investigated through the use of mitochondrial DNA (mtdna) (Cymbron et al. 1999) and Y chromosome sequence variation (Ginja et al. 2009). Influences from Central European and African cattle were detected, which is consistent with historical records (Zilhão 2001; Anderung et al. 2005; Beja-Pereira et al. 2006). Microsatellite (STR) markers are very informative and useful to characterize the genetic diversity and structure of domestic breeds (Bruford 2004). The genetic relationships among Iberian cattle and European breeds were investigated with STRs (Cañon et al. 2001; Beja-Pereira et al. 2003; Cymbron et al. 2005), but no more than five Portuguese native breeds were analyzed. Only two studies (Mateus et al. 2004a; Mateus et al. 2004b) focused on the characterization of Portuguese cattle with STRs, but these did not include all native breeds. Information is lacking on the genetic structure of Portuguese native cattle and the degree of admixture between breeds. 77

98 Capítulo 4 Genetic Structure of Portuguese Native Cattle Fully Bayesian Monte Carlo Markov Chain (MCMC) clustering methods are useful to estimate individual genotype probabilities, with or without prior information on source populations, and to detect admixture (Pritchard et al. 2000; Beaumont & Rannala 2004; Chikhi & Bruford 2005; Manel et al. 2005). These methods have been used to assess the genetic structure and assign individuals to breeds of several domestic species, such as cattle (Moioli et al. 2004; Negrini et al. 2007), sheep (Lawson Handley et al. 2007), goats (Cañon et al. 2006), pigs (Vicente et al. 2008), chicken (Rosenberg et al. 2001), cats (Beaumont et al. 2001; Randi et al. 2001; Driscoll et al. 2007; Lipinski et al. 2008), and dogs (Koskinen 2003; Leroy et al. 2009; Pires et al. 2009). The performance of assignment methods depends on several factors, such as number and polymorphism of the markers, number of populations and their degree of differentiation, and number of individuals sampled, hence it is necessary to assess their efficiency in specific contexts (Cornuet et al. 1999; Maudet 2001; Manel et al. 2002). The aim of this study is to contribute to the molecular characterization of Portuguese native cattle and to investigate their genetic structure with STRs. Fully Bayesian MCMC methods were used to investigate whether molecular structure mirrors breed designations, and to detect within-breed substructure. The degree of admixture between breeds was assessed, as well as possible crossbreeding of native cattle with imported commercial breeds. A principal component analysis from pairwise F st values, and a Neighbor-Net graph of breed clusters obtained from genetic distances were used to illustrate breed relationships. 78

99 Capítulo 4 Genetic Structure of Portuguese Native Cattle 4.2. Material and methods Sampling and DNA extraction Blood samples were collected from a total of 675 animals of 13 native Portuguese cattle breeds: Alentejana (38), Arouquesa (70), Barrosã (69), Brava de Lide (43), Cachena (51), Garvonesa (39), Marinhoa (46), Maronesa (47), Mertolenga (64), Minhota (50), Mirandesa (54), Preta (60), and Ramo Grande (44) from the Azores Archipelago. Samples were also collected from animals of the three major exotic breeds raised in Portugal: Charolais (58), Friesian (51), and Limousin (47). To minimize the degree of relationship among individuals, pedigree records were used for selection of nonrelated animals back to the second generation whenever possible. DNA was extracted using the Gentra kit (PUREGENE, Gentra Systems, Inc.) according to manufacturer recommendations STR genotyping We analyzed a total of 40 STR loci (BM0203; BM0888; BM1314; BM1818; BM1824; BM8125; BM2113; BM4208; BM5004; BRRIBO; CSSM036; CSSM042; CSRM060; CSSM066; CYP21; ETH003; ETH010; ETH152; ETH185; ETH225; HAUT027; HEL001; HEL009; ILSTS006; ILSTS011; INRA023; INRA032; INRA035; INRA037; INRA063; MGTG4B; MM12E6; RM006; RM067; SPS115; TGLA053; TGLA094; TGLA122; TGLA126; TGLA227) distributed across 21 cattle chromosomes (Bos taurus autosomes, BTA). Primer sequences, chromosome location, repeat motif, reference, and dye label are shown in supplementary Table S4.1. STR markers were amplified in multiplex polymerase chain reactions (PCR) using fluorescence-labelled primers and the QIAGEN multiplex PCR kit (QIAGEN Inc., USA). PCR reactions were prepared in a total reaction volume of 12 µl containing about 60 ng of genomic DNA, primers at concentrations that varied between μm and 6 µl of the QIAGEN PCR master mix. The PCR program included an activation step at 95 C for 15 min; 5 cycles at 94 C for 30 s, 60 C for 90 s and 72 C for 60 s; 28 cycles at 94 C for 30 s, 57 C for 90 s and 72 C for 60 s followed by a final extension at 72 C for 30 min. Negative and a positive DNA controls were included in all assays. PCR fragments were separated by capillary electrophoresis on ABI 3730 instruments (Applied Biosystems, Foster City, CA) according to 79

100 Capítulo 4 Genetic Structure of Portuguese Native Cattle the manufacturer recommendations. Allele sizes were determined with STRAND software (Hughes 2000) using the internal size standard GeneScan 500 LIZ (Applied Biosystems, Warrington, UK) Statistical Analysis Allele frequencies for all loci and breeds as well as the number of population-specific alleles (private alleles, PA) found in each breed were determined with GENALEX v. 6 (Peakall & Smouse 2006). The frequency of null alleles (r) per locus within each breed was estimated with the EM algorithm of Dempster et al. (1977) in FREENA software (Available at Chapuis & Estoup 2007). The presence of null alleles overestimates the number of homozygotes, decreases within population genetic diversity and inflates estimates of population differentiation (Dakin & Avise 2004; Lawson Handley et al. 2007). The software GENETIX v.4.03 (Belkhir et al ) was used to estimate observed (H o ) and unbiased within-breed expected (H e ) heterozygosities, mean number of alleles per breed (MNA), and to calculate Weir & Cockerham s (1984) F is values per breed with P-values obtained based on 1,000 permutations. FSTAT v2.9.3 (Goudet 2001) was used to estimate Weir & Cockerham s (1984) F-statistics per locus and P-values were obtained based on 1,000 randomizations. Allelic richness (R t ) over all breeds for each locus was also calculated with this software. Deviations from Hardy-Weinberg equilibrium (HWE) were assed with GENEPOP v. 3.4 software (Raymond & Rousset 2003). Both global tests across populations and loci and tests per locus per population were done using the method of Guo & Thompson (1992) and the P-values obtained using a Markov chain of 10,000 dememorization steps, 500 batches and 5,000 iterations. Genotypic linkage disequilibrium (LD) was also calculated with this software and the same Markov chain settings. Genetic structure and degree of admixture of Portuguese native breeds were investigated using the Bayesian clustering procedure of STRUCTURE (Pritchard et al. 2000). The most probable number of populations (K) given the observed genotypic data was estimated by performing 10 independent runs for each K (1 K 19) with burn-in length and 80

101 Capítulo 4 Genetic Structure of Portuguese Native Cattle MCMC iterations of 50,000 and 100,000, respectively. The parameter alpha (degree of admixture) was inferred from the data using the default settings and an admixture model with correlated allele frequencies (Falush et al. 2003). The method of Evanno et al. (2005) was used to identify the most probable K by determining the modal distribution of K. The analysis with STRUCTURE was repeated for subsets of the data to assess within-breed substructure. The most informative loci were identified with WHICHLOCI (Banks et al. 2003) using the allele frequency method after re-sampling 500 individuals from the original dataset in each population, and setting a minimum of 95% of correctly assigned individuals with a stringency of 2 (P-value = 0.01). Assignment tests were performed with STRUCTURE using prior information of source breeds and the settings described above for the MCMC. The proportion of each individual s genotype in each cluster or breed (q) and the probability of ancestry in other breeds were estimated. The percentage of individuals correctly assigned to source breed was calculated for distinct threshold q values. A principal component analysis (PCA) to represent breed relationships based on pairwise F st values was carried out in PCAGEN v (Available at Goudet 1999), and with P-values for the axes obtained from 1,000 randomizations of genotypes. Population pairwise D A distances were calculated in POPULATIONS (Langella 1999) and used to obtain a network of breed clusters following the Neighbor-Net method in SPLITSTREE4 v4.10 (Huson & Bryant 2006) Results Molecular markers Among the 40 markers, evidence of null alleles was detected only at INRA035 which had null alleles at high frequency (r > 0.2) across several breeds and for this reason this marker was discarded. A total of 457 alleles were detected at 39 STR loci across all breeds. Measures of genetic variability as well as F-statistics for each STR are shown in Table S4.1. The total number of alleles (TNA) per locus ranged between 6 for ILSTS011 and BM1824, and 32 for CYP21. Allelic richness per locus was high, with an overall average of 8.3 ±

102 Capítulo 4 Genetic Structure of Portuguese Native Cattle Several STRs had R t > 10 (BM203, CSSM066, CYP21, MGTG4B, TGLA053, and TGLA122), whereas the lowest value was 4.6 (RM006). The highest heterozygosity was found for TGLA053 (H o = ± and H e = ± 0.050) and TGLA227 (H o = ± and H e = ± 0.031), and the lowest for SPS115 (H o = ± and H e = ± 0.190). The F is value had an overall mean of ± (P < 0.01), and was significantly (P < 0.01) higher than zero for HAUT027 and INRA037. F it and F st per locus were mostly significant (P < 0.01), with overall means of ± and ± 0.004, respectively. Linkage disequilibrium was significant (P < ) for 24 STR pairs, however only the following corresponded to loci located in the same chromosome: BM0888/INRA037; CSRM060/INRA037; BM4208/MM12E6; HEL001/SPS115. Thus, the STRs INRA037, BM4208 and HEL001 were excluded from the analyses done with STRUCTURE. MM12E6 and SPS115 were selected for breed assignment analyses because, based on WHICHLOCI results, they were more informative than their counterparts BM4208 and HEL Within-breed genetic diversity Estimates of within-breed genetic diversity are summarized in Table 4.1. The breeds Brava de Lide and Mirandesa had the lowest diversity (H e = ± and H e = ± 0.147; H o = ± and H o = ± 0.151; MNA = 5.7 ± 1.8 and MNA = 5.4 ± 1.3, respectively). Both Garvonesa and Alentejana had relatively low levels of diversity. The highest genetic diversity was found in Minhota (H o =0.758±0.103 and H e =0.739±0.088). Likewise, Arouquesa and Mertolenga had high genetic diversity and showed the highest MNA (7.9 ± 2.7 and 7.8 ± 2.4). Private alleles were detected in all breeds except Alentejana and Marinhoa, however only five out of 54 PA were detected in frequencies 0.05 (two in Friesian, one in Mertolenga, one in Minhota, and one in Ramo Grande). Tests for deviations from HWE showed significant (P < 0.05) heterozygote deficit in all breeds except Garvonesa, Marinhoa, Minhota and Limousin. The number of loci that had significant heterozygote deficit (P < 0.05) varied between one (Marinhoa and Limousin) and 17 (Mertolenga). Out of the 39 STRs analyzed in each breed, only INRA037 showed significant (P < 0.05) HWE deviations across all breeds. Heterozygote excess was not significant for any of the locus/breed combinations tested. 82

103 Capítulo 4 Genetic Structure of Portuguese Native Cattle Table 4.1. Observed and expected heterozygosities (Ho and He, respectively), mean number of alleles (MNA), private alleles (PA), inbreeding coefficient (Fis), and number of loci showing heterozygote deficit (HWEd) estimated with 39 STRs in 13 Portuguese native and three imported cattle breeds. Breed N H o ±SD H e ±SD MNA±SD PA F is HWEd Portuguese native Alentejana ± ± ± *** 7 Arouquesa ± ± ± ** 9 Barrosã ± ± ± * 3 Brava de Lide ± ± ± *** 15 Cachena ± ± ± Garvonesa ± ± ± Marinhoa ± ± ± Maronesa ± ± ± * 7 Mertolenga ± ± ± *** 17 Minhota ± ± ± Mirandesa ± ± ± * 3 Preta ± ± ± * 3 Ramo Grande ± ± ± *** 8 Imported Charolais ± ± ± * 4 Friesian ± ± ± Limousin ± ± ± Overall ± ± ± The HWE deviations detected are most probably due to inbreeding as the within-breed F is estimates were significantly (P < 0.05) higher than zero in 10 populations. For Alentejana, Brava de Lide, Mertolenga and Ramo Grande the F is > 0 was highly significant (P < ) Genetic relationship between breeds Pairwise population F st values are shown in Table S4.2, and were all significant for P < 0.05 after a standard Bonferroni correction. The lowest F st value was found among Cachena and Barrosã (0.011), whereas the highest value was observed between Mirandesa and Friesian (0.177). Breed relationships based on pairwise F st are depicted in the PCA graph of Figure 4.1. The northern breeds Mirandesa, Barrosã and Cachena were the most distant. Marinhoa, Maronesa, Brava de Lide and Ramo Grande had an intermediate position, 83

104 Capítulo 4 Genetic Structure of Portuguese Native Cattle whereas the remaining native breeds grouped at the centre. Among the imported breeds, Friesian was the most distant and Limousin had a more central position closer to native breeds. Minhota and Ramo Grande showed a closer genetic relationship with imported cattle, which based on Axes 1 and 2 were split from most of the native breeds. Northern native cattle were split from southern breeds based on Axis 3, except for Marinhoa, Arouquesa and Minhota, which occupied a more central position. Figure 4.1. Principal component analysis based on pairwise F st values. Breed codes are the following: Alentejana (ALE); Arouquesa (ARO); Barrosã (BAR); Brava de Lide (BRV); Cachena (CAC); Garvonesa (GAR); Marinhoa (MRH); Maronesa (MRO); Mertolenga (MER); Minhota (MIN); Mirandesa (MIR); Preta (PRE); Ramo Grande (RGR); Charolais (CHA); Friesian (FRI); Limousin (LIM). 84

105 Capítulo 4 Genetic Structure of Portuguese Native Cattle The Neighbor-Net of DA genetic distances is shown in Figure 4.2 and pairwise population distance values are shown in Table S4.2. The imported breeds appear separated from the Portuguese native breeds, except Minhota and Ramo Grande, with the latter clustering with Friesian. Barrosã clustered with Cachena, and Mirandesa with Marinhoa, each pair forming a tight net. The southern breeds Alentejana, Garvonesa and Mertolenga grouped together, but the first two breeds were genetically closer. Brava de Lide split from the centre as an independent and more distant branch. The northern Maronesa also clustered separately, whereas Arouquesa was in the same branch as Mirandesa. Figure 4.2. Neighbor-Net graph of DA genetic distances among 13 Portuguese native and three imported cattle breeds. 85

106 Capítulo 4 Genetic Structure of Portuguese Native Cattle Genetic structure and admixture analysis For the analysis done without including prior information on sample origin and following Evanno et al. (2005), the highest K was found for K=2 and K=15 (Figure S4.1). The structure detected at K=2 is explained by the lowest likelihood variance, whereas the highest likelihood of the data was obtained for K=15 ( K = 50). Based on individual q values, Barrosã and Cachena animals formed one cluster whereas those from each of the remaining breeds formed independent groups (Figure 4.3a). Further analyses were done with subsets of the data to determine if individuals of these two breeds could be distinguished, and to assess substructure within Mertolenga associated with different coat colors. The modal value of K (85) was obtained at K = 3 for the analysis of Barrosã, Cachena and Mirandesa. Mirandesa was included as a reference breed for this analysis because it is a well differentiated population and thus useful to determine the most probable K value of this data subset. Clear evidence of admixture was detected between Cachena and Barrosã, although it was possible to identify a cluster of Cachena animals not related to Barrosã (Figure 4.3b). For Mertolenga, the modal value of K (17) was obtained at K = 3 but some level of substructure was detected at K = 4 as shown in Figure 4.3c. Red speckled (Rosilho) animals formed an independent cluster, whereas red (Vermelho) and red and white spotted (Malhado) individuals clustered together. The results of the Bayesian cluster analysis done with STRUCTURE are summarized in Table 4.2. Average membership proportions in each cluster (Q) ranged between ± in Ramo Grande and ± in Mirandesa, with an overall average of ± Approximately 70 % of the individuals were classified within their source cluster with q The most heterogeneous breeds were Arouquesa, Cachena, Mertolenga, Minhota, Preta and Ramo Grande, with < 55 % of the individuals correctly assigned (q 0.800). Mirandesa had the highest percentage of animals assigned to the source cluster (93 % with q 0.800). When prior information on source breeds was considered in the analysis, the overall Q was ± 0.149, and varied between ± in Garvonesa and ± in Barrosã. Individual q values are depicted in Figure 4.3d. The overall percentage of individuals correctly assigned to the source breed was about 93% for q 0.800, and 82% for q The percentage of correctly assigned animals with q was 90 % in all breeds except Cachena, Garvonesa and Preta. 86

107 Figure 4.3. Results of the Bayesian cluster analysis with STRUCTURE. (a) Graphical representation of individual genotype membership coefficients (q) in each of 15 clusters (Barrosã and Cachena are in the same group) without prior information on source breeds. (b) Detailed analysis of Barrosã and Cachena using Mirandesa as outgroup. (c) Substructure within Mertolenga using the related Alentejana and Garvonesa breeds for comparison. (d) Assignment results when sample origin is included in the analysis.

108 Table 4.2. Summary results of the Bayesian cluster analysis done with STRUCTURE. Average genotype membership proportions (Q), the percentage of correctly assigned (% corr. assign.) animals, and the percentage of admixed (% Adm.) individuals are shown for each breed and overall. Breed names Without prior information With prior information on breeds Q ± SD % Corr. assign. q Q ± SD q % Corr. assign. q q % Adm. With prior information on breeds and 16 STRs Q ± SD q % Corr. assign. Portuguese native Alentejana ± ± ± Arouquesa ± ± ± Barrosã ± ± ± Brava de Lide ± ± ± Cachena ± ± ± Garvonesa ± ± ± Marinhoa ± ± ± Maronesa ± ± ± Mertolenga ± ± ± Minhota ± ± ± Mirandesa ± ± ± Preta ± ± ± Ramo Grande ± ± ± Imported Charolais ± ± ± Friesian ± ± ± Limousin ± ± ± Overall ± ± ± q q 0.999

109 Capítulo 4 Genetic Structure of Portuguese Native Cattle Among native cattle, Barrosã (94 %), Mirandesa (89 %) and Maronesa (92 %) had the highest percentage of individuals correctly assigned with q In fact, for Mirandesa and Barrosã there were about 24 % and 22 % of animals with q 0.999, respectively. Overall, only 10 % of the individuals could be assigned to the source breed with high stringency (q 0.999). When the assignment analysis was done using a subset of the 16 most informative markers (BM0888, BM2113, BM5004, BRRIBO, CSSM042, CSSM066, CY0P21, ETH003, ETH010, HEL009, INRA023, MGTG4B, MM12E6, TGLA053, TGLA122, and TGLA227), there was a slight increase in the overall percentages of correctly assigned animals at each threshold q value considered except at the highest stringency (q 0.999). Evidence of admixture was found for a total of 56 animals (6.7 %) which had q < in their breed of origin, however only two of these animals were (mis)assigned to a breed other than the source (one Arouquesa and one Garvonesa). Admixed animals were detected across all breeds, and among native breeds ranged between 2.6 % (Alentejana) and 15.4 % (Garvonesa) Discussion The levels of within-breed diversity detected in Portuguese native cattle were high (average H o = 0.673±0.043, H e = 0.691±0.034 and MNA = 6.7±0.77) and comparable to those previously reported (Cañon et al. 2001; Mateus et al. 2004b). Preta, Cachena and Ramo Grande (Azores) were characterized here for the first time, and showed levels of diversity comparable to other native breeds, even though the latter two have a census of less than 900 cows (Gama et al. 2004). The genetic variability found in Portuguese cattle might reflect contributions from animals of distinct origins. Cymbron et al. (2005) found significantly higher diversity in Mediterranean cattle, which included three Portuguese breeds, when compared to Northern European cattle, as a result of Near Eastern and African influences. Analysis of mtdna sequences and Y-haplotypes have confirmed the heterogeneous genetic composition of Portuguese cattle, through the detection both European and African lineages (Cymbron et al. 1999; Beja-Pereira et al. 2006; Ginja et al. 2009). The results obtained here also support African influence in Portuguese breeds through the detection of BM allele (Alentejana, Garvonesa and Mertolenga) which was previously 89

110 Capítulo 4 Genetic Structure of Portuguese Native Cattle associated with West African taurine cattle (MacHugh 1996). The presence of zebu BM (Arouquesa, Garvonesa, Marinhoa and Mirandesa) and ETH alleles (Alentejana, Mertolenga and Preta), also found in African cattle (MacHugh 1996), suggests that zebu gene flow in Portugal might have an African origin. Despite the high genetic diversity detected within Portuguese native cattle, significant inbreeding was also observed in some breeds. While the heterozygote deficit observed in Brava de Lide and Mertolenga could be the result of a Wahlund effect related to the presence of independent lineages in these breeds, there is evidence of genetic erosion caused by very low effective number of males in Alentejena (Carolino and Gama 2008) and very small population size in Ramo Grande (Gama et al. 2004). Thus, measures should be applied to minimize the negative effects of inbreeding and preserve these valuable genetic resources. The Bayesian clustering analysis confirmed that Portuguese breeds are highly structured, with slight admixture. Despite the small geographic area where these cattle are raised, there are low levels of gene flow among breeds. However, some level of admixture is expected because Portuguese cattle were threatened by crossbreeding with imported commercial breeds, and parentage DNA testing is not a common practice for registration of animals in herdbooks. The partition of the dataset was consistent with the original breed designations. In the case of Barrosã and Cachena breeds, although the most probable number of clusters was two, there was clear admixture between them. These two breeds were treated as one population for the structure analysis done with prior information on breeds. Historical evidence supports a close genetic relationship of these breeds. Cachena was considered a subtype of Barrosã and only in 1998 was recognized as an independent breed (Leite & Dantas 2000). The minor substructure detected in Mertolenga reflects the tendency of breeders to separate herds according to distinct coat colors. Rosilho herds are distributed from the central to the southern region of Alentejo, Vermelho animals are raised throughout the central towards the north western area, whereas Malhado herds are fewer and dispersed throughout Alentejo ( The structure analysis was useful to identify the more uniform breeds and confirm their genetic differentiation. Mirandesa was extremely homogenous, showing very high proportions of individual genotype memberships (Q = 0.919±0.073). The genetic distinctiveness of this breed is probably associated with the fact that it was the first among 90

111 Capítulo 4 Genetic Structure of Portuguese Native Cattle Portuguese native breeds to have a herdbook which was established in 1959 (Sousa 2000). Based on a previous study, Mirandesa is genetically distinct from other European breeds, and contributes significantly to the overall genetic diversity (Cañon et al. 2001). Brava de Lide and Maronesa had a high percentage of individuals correctly assigned, even for the analysis done without prior information on sample origin, which indicates that these breeds are genetically distinct and is consistent with their placement depicted in the Neighbor-Net graph. Both breeds are considered to belong to a more ancestral group of the Iberian Peninsula as discussed by Mateus et al. (2004b). A recent study on mtdna sequence variation in De Lidia cattle, the Spanish equivalent of Brava de Lide, concluded that these animals represent primitive Iberian cattle with multiple influences, such as Mediterranean and African (Cortes et al. 2008). The assignment tests done with prior population information resulted in high overall percentages of individuals correctly classified, except for the most stringent threshold q value of The degree of genetic differentiation among Portuguese breeds and the results of the assignment tests indicate that it is possible to identify reference animals with high membership coefficients in their breed of origin. Even for closely related breeds, such as Mirandesa/Marinhoa and Alentejana/Garvonesa, it was possible to correctly assign individuals with high threshold q values (e.g. q 0.950). The assignment analyses were useful to detect admixture and to identify the animals that conform to the genetic profile of the breed, which could be selected for breeding to help maintain the integrity of each breed. For the more heterogeneous breeds, the percentages of correctly assigned individuals were lower (< 79%, q 0.950). Because local breeds might have multiple origins, some degree of heterogeneity is anticipated and should be considered as part of their history, rather than a depreciative feature (Econogene 2006). This is most probably the case of Mertolenga which is heterogeneous at the molecular and phenotypic levels. However, low genotype memberships can also reflect dilution of a gene pool due to crossbreeding, which seems to be the case of Minhota and Ramo Grande. Even though the source of the admixture was often difficult to determine because of low q values in each breed, the PCA and the Neighbor-Net representations of breed clusters are consistent with this interpretation. Historical evidence supports crossbreeding in Minhota, mainly with German Yellow and Charolais animals (Machado 2000). Ramo Grande appears associated with 91

112 Capítulo 4 Genetic Structure of Portuguese Native Cattle Friesian, and crossbreeding among these two breeds is supported by the large predominance of Friesian cattle in the Azores Archipelago. A recent survey of Y-haplotypes in Portuguese cattle showed prevalence of Friesian patrilines in Ramo Grande (Ginja et al. 2009). Nonetheless, the genetic composition of Ramo Grande can also mirror the initial contribution of distinct continental breeds because some of the admixed animals had recent ancestry in other native breeds. The admixture detected in Preta appears to reflect crossbreeding with related southern breeds such as Alentejana and Garvonesa. The heterogeneity observed in Garvonesa is the result of genetic erosion of this native breed, which is highly threatened and only a few individuals persist (Gama et al. 2004). In conclusion, Portuguese native breeds retain high genetic diversity and are highly structured. Nonetheless, some breeds showed signs of genetic erosion due to inbreeding or crossbreeding mainly with imported cattle. These results can be used to assist authorities in the implementation of national conservation measures and breeding programs. The genotype dataset assembled here is also useful for the assignment of unknown samples to source breeds. Assignment methods can also be used for validation of certified meat products but further investigation is still needed to validate the performance of such methods to assure high confidence in breed allocation. 92

113 Capítulo 5 GENETIC DIVERSITY AND STRUCTURE OF CREOLE CATTLE BASED ON STRS: A CONSERVATION PERSPECTIVE

114

115 CAPÍTULO 5. GENETIC DIVERSITY AND STRUCTURE OF CREOLE CATTLE BASED ON STRS: A CONSERVATION PERSPECTIVE Abstract A set of 24 microsatellites was used to analyse the genetic diversity and structure of Creole cattle from North and South America, as well as their relationship with Iberian and commercial European and zebu breeds. Genetic diversity of Creoles was high, with overall means of H o = 0.715± 0.040, H e = ± and MNA = 7.01 ± Five Iberian breeds, Poblano Creoles and Hereford showed heterozygote deficit due to inbreeding (F is > 0, P < 0.001). Genetic variation was geographically structured (P < ) with breed groups accounting for 3 % of the total variation, whereas 8 % corresponded to breed differences and 89 % to individual differences. Bayesian clustering showed that Argentinean1 (herdbook registered) and Caracú retain signatures of Iberian ancestry, and disclosed the heterogeneity of most Creole populations, caused by admixture with commercial zebu and European breeds. Zebu introgression was found in all Creoles, except Argentino1, being highest in free ranging Argentinean and Chiapas Creoles. Crossbreeding with Hereford was detected in Pampa Chaqueño. Mexican Creoles were not differentiated and formed one cluster in the STRUCTURE analysis, whereas Argentino1, Caracú and Texas Longhorn had the highest percentage of correctly assigned individuals (> 84%, q 0.950). Conservation analyses among Iberian and Creole cattle identified Palmera, Mirandesa and Caracú as genetically distinct breeds which had the highest contribution to overall genetic diversity. This study enhanced our understanding of the origins and genetic structure of Creole cattle. Keywords: Creole cattle; microsatellites; genetic diversity; genetic structure; conservation 95

116

117 Capítulo 5 Genetic Structure of Creole Cattle 5.1. Introduction The intensification of Animal Production in the mid 20 th century lead to the predominant use of a few breeds, causing the erosion of local animal genetic resources. According to the Food and Agriculture Organization several domestic breeds are currently highly threatened (Scherf 2000), and efforts are being made to characterize the genetic diversity of domestic species at global geographic scales, so that appropriate conservation measures can be defined and undertaken (FAO 2004a; Cañon et al. 2006; Econogene 2006; Tapio et al. 2006a; Lawson Handley et al. 2007; Peter et al. 2007; Megens et al. 2008). Furthermore, the characterization of livestock from domestication centers and colonization routes is considered important to improve our understanding about the origins and genetic relationships of domestic breeds (Taberlet et al. 2008), and also to investigate their past dispersion in association with the movement of human populations. While for Europe, Africa, Asia and Middle East several studies regarding the genetic characterization of cattle have been published, this is not the case for the Americas. In particular, information regarding the genetic diversity and structure of Creole cattle is scarce (FAO 2007), therefore this subject is addressed here in detail. The Creoles of the Western hemisphere are remnants from cattle taken to the Americas during the colonial period from the 15 th to the 19 th century. The small number (< 1,000) of Iberian animals introduced through the Caribbean Islands, was then transported to the mainland and spread throughout the continent, becoming well adapted to a wide range of environmental conditions (Rouse 1977; Primo 1992). During the 19 th and 20 th centuries, Creole cattle suffered the influence of highly productive European breeds, such as Angus, Hereford and Shorthorn, but also from zebu (Bos indicus) breeds, such as Brahman and Gyr (Rouse 1970). Influence of West African cattle brought to the Americas through slave trade routes is also likely to have occurred (Liron et al. 2006a). The contribution of European and African breeds to the Creoles has been confirmed through the analysis of mitochondrial DNA (Miretti et al. 2002; Liron et al. 2006a), as well as Y chromosome haplotypes (Ginja et al. in press). However, the genetic structure of Creole cattle populations could be further disentangled at a more refined scale, through the use of highly polymorphic molecular markers. 97

118 Capítulo 5 Genetic Structure of Creole Cattle Microsatellites (STRs) have been widely used to assess within and between-breed genetic diversity, to detect admixture among breeds, and to assign individuals to source populations (Bruford et al. 2003). In cattle, STRs have been used to characterize the genetic diversity and structure of breeds from distinct geographic locations (MacHugh et al. 1998; Martin-Burriel et al. 1999; Cañon et al. 2001; Hanotte et al. 2002; Beja-Pereira et al. 2003; Freeman et al. 2004; Mateus et al. 2004b; Cymbron et al. 2005; Zhang et al. 2007). The genetic diversity of Mediterranean and Iberian native breeds has been assessed with STRs and is significantly higher than that observed in more intensively raised European cattle, which appears to reflect their multiple origins, with influences from Near Eastern and African cattle (Cañon et al. 2001; Beja-Pereira et al. 2003; Cymbron et al. 2005). A study of African native cattle based on STRs has revealed that they were originally of the taurine type, which spread through the eastern part of the continent towards the south, and were influenced by Near Eastern and European breeds (Hanotte et al. 2002). The identification of specific Bos indicus alleles at STR loci has been useful to document zebu introgression into African taurine cattle (MacHugh et al. 1997; Hanotte et al. 2000). In regards to the genetic characterization of Creole cattle through STRs, few studies have been conducted so far, and these are often based on a small (3-9) number of markers (Russell et al. 2000; Magee et al. 2002; Liron et al. 2006b). Recently, Egito et al. (2007) used a set of 22 STRs to investigate the genetic structure of 10 Brazilian Creole breeds and concluded that, despite some degree of inbreeding, Creoles retain high genetic diversity. Indicine introgression into Creoles has also been reported (Giovambattista et al. 2000; Magee et al. 2002; Liron et al. 2006b; Egito et al. 2007). Recently, the genetic variability detected at STR loci has been used to estimate breed contributions to overall diversity and prioritize breeds for conservation (Econogene 2006; Tapio et al. 2006a). The so called Weitzman approach (Weitzman 1992) uses genetic distances to summarize diversity, where the most distinct breed is given the highest priority for conservation. Alternative methods have been proposed to incorporate the within-breed genetic diversity (Eding & Meuwissen 2001; Caballero & Toro 2002; Garcia et al. 2005; Ollivier & Foulley 2005). While there is the need to prioritize breeds for conservation and allocation of funds that are limited, it is important to identify breeds that might carry unique 98

119 Capítulo 5 Genetic Structure of Creole Cattle genotypes, those with specific adaptive traits, and also account for their cultural value to maintain overall diversity of a species (Econogene 2006). In this work, the genetic diversity and structure of North and South American Creole cattle were assessed with 24 STRs, and the genetic relationships between Creoles and breeds from Iberia, the Atlantic Islands, and other European countries were analysed. We were also interested in investigating the degree of admixture among breeds, and assess the extent of B. indicus introgression into Creoles. We used the Weitzman approach, and also a combination of between and within-breed diversity measures, to estimate the contribution of each population to the overall genetic diversity of Iberian and Creole cattle and discussed the results from a conservation perspective Material and Methods Sampling and DNA extraction A total of 1,568 samples were collected from 38 cattle populations of six distinct breed groups: Iberia (693 animals), Atlantic Islands (138), Creoles (355), United Kingdom (166), Inland Europe (156), and Zebu (60). Iberian samples included animals from 12 Portuguese one Spanish native breeds, as follows: the Portuguese breeds were Alentejana (38), Arouquesa (70), Barrosã (69), Brava de Lide (43), Cachena (51), Garvonesa (39), Marinhoa (46), Maronesa (47), Mertolenga (64), Minhota (50), Mirandesa (54), Preta (60), and the Spanish was Mostrenca (62). The Atlantic Islands group included Ramo Grande (44) from the Azores Archipelago, Canaria (44) and Palmera (50) from the Canary Islands Gran Canaria and Palma, respectively. Creole samples were collected in: Argentina (herdbook registered animals named as Argentino1, 56; and free ranging animals named Argentino2, 11); Brazil (Caracú, 45); Mexico (Baja California, 17; Chiapas, 25; Chihuahua, 11; Nayarit, 23; and Puebla, 42); Paraguay (Pampa Chaqueño, 89); and U.S.A. (Texas Longhorn, 36). Breeds from the United Kingdom were the following: Angus (19), British White (16), Hereford (28), Jersey (20), and Shorthorn (10). Additional Angus (41) and Hereford (32) samples were obtained in Argentina. 99

120 Capítulo 5 Genetic Structure of Creole Cattle The Inland European breed group included Charolais (58), Friesian (51), and Limousin (47) samples collected in Portugal. The zebu breeds Brahman (39) and Gyr (21) were collected in Mexico, except for five Brahman bulls which were obtained from a commercial source (Bovine Elite, Llc., USA). Care was taken to select unrelated individuals based on pedigree information where herdbook records were available. DNA was extracted from whole blood, semen or hair roots using the Gentra kit (PUREGENE, Gentra Systems, Inc.) STR genotyping We analyzed a total of 24 STR loci (BM1314; BM1818; BM1824; BM8125; BM2113; CSRM060; CSSM066; ETH003; ETH010; ETH185; ETH225; HAUT027; HEL009; ILSTS006; ILSTS011; INRA023; INRA032; INRA037; INRA063; MM12E6; SPS115; TGLA053; TGLA122; TGLA227) distributed across 18 cattle chromosomes (B. taurus autossomes, BTA). These markers correspond to a subset of the STRs used for the genetic analysis of Portuguese native breeds as described by Ginja et al. (in press). STR markers were amplified in multiplex polymerase chain reactions (PCRs) using fluorescence-labelled primers and the QIAGEN multiplex PCR kit (QIAGEN Inc., USA). PCR reactions were prepared in a total reaction volume of 12 µl containing about 60 ng of genomic DNA, primers at concentrations that varied between μm and 6 µl of the QIAGEN PCR master mix. The PCR program included an activation step at 95ºC for 15 min; 5 cycles at 94ºC for 30 s, 60ºC for 90 s and 72ºC for 60 s; 28 cycles at 94ºC for 30 s, 57ºC for 90 s and 72ºC for 60 s followed by a final extension at 72ºC for 30 min. Negative and positive DNA controls were included in all assays. PCR fragments were separated by electrophoresis on ABI 3730 or ABI 377 instruments (Applied Biosystems, Foster City, CA) according to the manufacturer recommendations. Allele sizes were determined with STRAND software (Hughes 2000) using the internal size standards GeneScan 500 LIZ and 400HD ROX (Applied Biosystems, Warrington, UK). Allele sizes were adjusted through the analysis of 40 samples with both instruments. 100

121 Capítulo 5 Genetic Structure of Creole Cattle Statistical analysis Allele frequencies for all loci and breeds, as well as the number of population-specific alleles (private alleles, PA) found in each breed, were determined with GenAlex v. 6 (Peakall & Smouse 2006). The software GENETIX v.4.03 (Belkhir et al ) was used to estimate observed (H o ) and unbiased within-breed expected (H e ) heterozygosities, mean number of alleles per breed (MNA), and to calculate Weir & Cockerham s (1984) F is values per breed, with P-values obtained based on 1,000 permutations. FSTAT v2.9.3 (Goudet 2001) was used to estimate Weir & Cockerham s (1984) F-statistics per locus, and P-values were obtained based on 1,000 randomizations. Deviations from Hardy-Weinberg equilibrium (HWE) were assessed with GENEPOP v. 3.4 software (Raymond & Rousset 2003). Both global tests across populations and loci, and tests per locusand population, were carried out using the method of Guo & Thompson (1992) and the P-values obtained using a Markov chain of 10,000 dememorization steps, 500 batches and 5,000 iterations. Genotypic linkage disequilibrium (LD) was also calculated with this software and the same Markov chain settings. A principal component analysis (PCA) to represent breed relationships based on pairwise F st values was carried out in PCAGEN v (Available at Goudet 1999) with P-values for the axes obtained based on 1,000 randomizations of genotypes. Population pairwise D A distances were calculated in POPULATIONS (Langella 1999) and used to obtain a network of breed clusters following the Neighbor-Net method in SPLITSTREE4 v4.10 (Huson & Bryant 2006). Analysis of molecular variance AMOVA was done with ARLEQUIN v3.1 (Excoffier et al. 1992) and considering the six breed groups defined in the sampling section (Iberia, Atlantic Islands, Creoles, United Kingdom, Inland Europe and Zebu). Significance levels were determined through Monte Carlo simulation, with 10,000 permutations. The genetic structure and degree of admixture of cattle populations were investigated using the Bayesian clustering procedure of STRUCTURE (Pritchard et al. 2000). The most probable number of underlying populations (K), given the observed genotypic data, was estimated by performing 10 independent runs for each K, with burn-in length and MCMC iterations of 10,000 and 100,000, respectively. The parameter alpha (degree of 101

122 Capítulo 5 Genetic Structure of Creole Cattle admixture) was inferred from the data using the default settings and an admixture model with correlated allele frequencies (Falush et al. 2003). The method of Evanno et al. (2005) was used to identify the most probable K, by determining the modal distribution of K. The analyses with STRUCTURE were done for the entire dataset (1<K<38) and also for subsets of the data according to the following groups: Iberian and Atlantic Islands (1<K<18); United Kingdom and Inland European (1<K<14); and Creoles (1<K<14). The proportion of each individual s genotype in each cluster or breed (q) was estimated. To determine the percentage of correctly classified animals in each breed, assignment tests were performed with STRUCTURE using prior information on source breeds and the settings described above for the MCMC. The percentage of individuals correctly assigned to source populations was calculated for distinct threshold q values, and the probability of ancestry in other breeds also estimated. The contribution of each breed to the overall genetic diversity of Iberian and Creole cattle was first calculated based on D A genetic distances, using the Weitzman approach (Weitzman 1998) with the WEITZPro software (Derban et al. 2002), such that the resulting values represent between-breed diversity (CB). In a second approach, the aggregate genetic diversity (D1) was calculated following Ollivier and Foulley (2005), to incorporate CB and within-breed diversity (CW) in the estimation of breed contributions to diversity. In this procedure, D1 was obtained after weighting CB by F st and CW by (1-F st ), with F st values recalculated as described in the Statistical analysis section and to include only Iberian and Creole populations Results Molecular markers The total number of alleles detected at the 24 STR loci across all populations was 324. The number of alleles per locus ranged between 8 for BM1824 and 23 for TGLA122, with an overall average of ± HAUT027 and SPS115 had low observed genetic variability (H o = ± and H o = ± 0.182, respectively), whereas TGLA053 had the highest (H o = ± 0.107). Out of the 24 STRs analyzed, ETH185, HAUT027 and 102

123 Capítulo 5 Genetic Structure of Creole Cattle INRA037 showed significant (Bonferroni, P < ) heterozygote deficit across several breeds and these markers had F is values significantly (P < 0.01) higher than zero (0.061 ± 0.022, ± 0.022, and ± 0.021, respectively). Overall F is, F it and F st means were ± 0.006, ± and ± 0.004, respectively. Linkage disequilibrium was significant (Bonferroni, P < ) for 17 STR pairs out of 276 loci combinations, however only BM8125/ETH185 and CSRM060/INRA037 corresponded to loci located in the same chromosome. ETH185, HAUT027 and INRA037 were excluded from the STRUCTURE analyses because they were not in HWE and two loci showed LD Genetic diversity Estimates of within-breed genetic diversity are summarized in Table 5.1, with means for each breed group also shown. Over all populations, average observed and expected heterozygosities, and MNA were ± 0.051, ± and 6.44 ± 1.03, respectively. Among Creoles, genetic diversity was high, with overall means of H o = 0.715± 0.040, H e = ± and MNA = 7.01 ± Both Caracú and Pampa Chaqueño had relatively high levels of diversity and, within Mexican Creoles, the Nayarit had high values for all diversity estimates. The lowest genetic diversity within Creoles was found for Argentino1 (H o = ± 0.134, H e = ± 0.108, and MNA = 5.58 ± 1.18). A total of 8 private alleles were detected among Creoles, with the highest number (4) observed in Pampa Chaqueño. Only three out of the 25 PA found were in frequencies 0.05 (INRA allele in Caracú, SPS allele in Gyr, and HEL allele in Shorthorn). Out of 912 locus-population combinations, significant (P < 0.05) heterozygote deficit was found in 138 occasions, of which 35 were detected in the Creoles. After a Bonferroni correction, the breeds Brava de Lide, Mertolenga, Canaria, and Poblano had heterozygote deficit significantly higher than expected (P < ). The HWE deviations detected are most probably due to inbreeding, as the within-breed F is estimates were significantly (P < 0.05) higher than zero in 16 populations. For Alentejana, Brava de Lide, Mertolenga, Ramo Grande, Canaria, Poblano and Hereford the F is > 0 was highly significant (P < 0.001). Caracú was the only breed that showed significant heterozygote excess and F is < 0 (P < 0.05). 103

124 Table 5.1. Observed (H o ) and expected heterozygosities (H e ), mean number of alleles (MNA), private alleles (PA), inbreeding coefficient (F is ), and number of loci with heterozygote deficit (HWEd). 104 Breed names (Abbr.) N H o ± SD H e ± SD MNA ± SD PA F is HWEd Arouquesa (ARO) ± ± ± Barrosã (BAR) ± ± ± Cachena (CAC) ± ± ± Marinhoa (MARI) ± ± ± Maronesa (MARO) ± ± ± Minhota (MIN) ± ± ± Mirandesa (MIR) ± ± ± Alentejana (AL) ± ± ± *** 4 Brava de Lide (BRAVA) ± ± ± *** 10 Garvonesa (GA) ± ± ± Mertolenga (ME) ± ± ± *** 11 Preta (PR) ± ± ± Mostrenca (MO) ± ± ± Iberian ± ± ± ± Ramo Grande (RG) ± ± ± *** 6 Canaria (CAN) ± ± ± *** 7 Palmera (PAL) ± ± ± Atlantic Islands ± ± ± ± Argentino1 (ARG1) ± ± ± Argentino2 (ARG2) ± ± ± * 1 Caracú (CAR) ± ± ± Baja California (BCA) ± ± ± * 2 Chiapas (CHIA) ± ± ± ** 5 Chihuahua (CHIH) ± ± ± Nayarit (NAY) ± ± ± Poblano (POB) ± ± ± *** 11 Pampa Chaqueño (PCH) ± ± ± ** 4 Texas Longhorn (TLH) ± ± ± * 4 Creoles ± ± ± ± Brahman (BRAH) ± ± ± Gir (GY) ± ± ± ** 6 Zebu ± ± ± ± Angus (AA) ± ± ± ** 2 Arg. Angus (AAA) ± ± ± ** 3 British White (BW) ± ± ± Hereford (HE) ± ± ± *** 4 Arg. Hereford (AHE) ± ± ± Jersey (JE) ± ± ± Shorthorn (SH) ± ± ± United Kingdom ± ± ± ± Charolais (CH) ± ± ± ** 4 Friesian (FR) ± ± ± Limousin (LI) ± ± ± Inland Europe ± ± ± ± Overall ± ± ± ±

125 Capítulo 5 Genetic Structure of Creole Cattle Genetic relationships among Old and New World cattle Pairwise population F st values are shown in supplementary Table S5.1 and were all significant (P < 0.01), except for Chihuahua/Argentino2, Chihuahua/Baja California, Chihuahua/Nayarit, and Chihuahua/Poblano. The lowest F st value was found among Baja California and Chihuahua (0.008), whereas the highest value was observed between Palmera and Gyr (0.291). Among Creoles, Argentino1 and Caracú had the highest average F st (0.122 ± and ± 0.03, respectively). Overall, Zebu had the highest average F st of the six breed groups defined (0.197 ± 0.036). Breed relationships based on pairwise F st are depicted in the PCA graph of Figure 5.1. The first three axes contain 12.5, 10.2 and 8.2 percent of inertia and were all significant (P < 0.01). Mirandesa, Mostrenca, Palmera, Brahman and Gyr were the most distant breeds, whereas most populations grouped at the centre. Zebu and Creoles, except Argentino1 which showed a closer genetic relationship with Iberian breeds, were split from all other populations based on Axis 1. Most Iberian breeds were separated from all others, however and based on Axes 1 and 2 some breeds of this group were genetically closer to commercial European breeds (e.g. Ramo Grande). Based on Axis 3, Barrosã, Cachena, Brava de Lide, Maronesa and Canaria were genetically close to Mexican Creoles from Nayarit and Chihuahua. This axis also depicts some proximity of Pampa Chaqueño and Caracú. The Neighbor-Net of DA genetic distances is shown in Figure 5.2 and pairwise population distance values are shown in Table S5.1. There is a clear separation between zebu (depicted in orange) and taurine cattle (green, blue, brown and black colors), which was also supported by a 99% bootstrap value for the same branch of a Neighbor-joining tree of DA genetic distances (not shown). Most Creoles (depicted in red) were at an intermediate position between these two breed groups. The figure illustrates a geographic breed clustering which is consistent with the six breed groups defined, except for Ramo Grande and Minhota which clustered within the Inland European group. Jersey also appeared isolated and distant from the United Kingdom group. 105

126 Capítulo 5 Genetic Structure of Creole Cattle Figure 5.1. Principal component analysis based on pairwise F st values. Breed codes are shown in Table 5.1. The network indicates some influence of Hereford in Pampa Chaqueño. Likewise, zebu introgression into Creoles was depicted, particularly in Argentino2, Chiapas and Nayarit. Argentino1 and Caracú were in an intermediate position between Creoles and the Iberian breed group. Interestingly, Brava de Lide and Mostrenca clustered together, which was also supported by a 76% bootstrap value (not shown). 106

127 Capítulo 5 Genetic Structure of Creole Cattle Figure 5.2. Neighbor-Net graph of DA genetic distances among 38 cattle populations. Text colours represent the six geographic breed groups as follows: Iberian (green); Atlantic Islands (brown); Creoles (red); Zebu (orange), United Kingdom (blue), and Inland Europe (black). The results of the hierarchical AMOVA showed that genetic variation is geographically structured with breed groups accounting for about 3 % of the total variation (P < ), whereas 8 % corresponded to differences among breeds within groups (P < ), and most of the genetic variation explained by differences among individuals ( 89 %, P < ). 107

128 Capítulo 5 Genetic Structure of Creole Cattle Table 5.2. AMOVA results for 24 STRs and six geographic breed groups. Breed Groups N Among groups Variance components (%) Among breeds within groups Within breeds F-statistics F ct (P) F st (P) F sc (P) Iberia 13 Atlantic Islands 3 Creoles 10 Zebu 2 United Kingdom 7 Inland Europe Overall (< ) (< ) (< ) Genetic structure and admixture in Creoles The results of the STRUCTURE analysis without prior information on sample origin across all 38 populations and for K=2 showed an unambiguous division between taurine (depicted in green) and zebuine (in red) genotypes, and zebu introgression was detected in all Creole populations except Argentino1 (Figure 5.3a). Creoles were clearly heterogeneous, and for K=4 it was possible to identify the genetic contribution of Iberian (in green), British and other European breeds (in red and blue), as well as zebu (in yellow), to most Creole populations (Table 5.3 and Figure 5.3b). Iberian influence was highest in Argentino1 (Q = 0.835), followed by Caracú (Q = 0.358) and Chihuahua (Q = 0.310), whereas the British and Friesian breeds had the highest contribution in Pampa Chaqueño (Q = 0.714) and Baja California (Q = 0.315). Argentino2, Mexican Creoles, and Texas Longhorn showed influence (0.177 Q 0.310) from a cluster of other European breeds (depicted in blue), which included Jersey, Inland European cattle (Charolais and Limousin), Iberian cattle (Brava de Lide, Garvonesa and Mostrenca), and breeds from the Atlantic Islands (Canaria and Palmera). Zebu introgression was higher in Argentino2 (Q = 0.484) and Chiapas (Q = 0.407), and lower in Pampa Chaqueño (Q = 0.149) and Chihuahua (Q=0.194). 108

129 Figure 5.3. Graphical representation of the STRUCTURE results. (a) Taurine (green) and zebuine (red) membership coefficients (q) across 38 breeds for K=2. (b) Iberian (green), United Kingdom and Friesian (red), Inland European and Jersey (blue), as well as zebu (yellow) membership coefficients across 38 breeds for K=4. (c) Detailed analysis of Creoles for K=6. (d) Assignment results when sample source was included in the analysis.

130 Capítulo 5 Genetic Structure of Creole Cattle For the Creoles alone, and following Evanno et al. (2005), the highest K = 238 was obtained for K=6 (Figure S5.1). Based on individual q values, Argentino1, Argentino2, Caracú, Pampa Chaqueño, and Texas Longhorn animals formed independent groups, whereas the Mexican Creoles clustered together (Figure 5.3c). Mexican Creoles were the most heterogeneous and showed admixture with Argentino2 and Texas Longhorn which, based on the analyses with all populations, may correspond to contributions from zebu here represented by Argentino2 and European breeds, such as Hereford, represented by Texas Longhorn. Based on K, the K values determined for the Iberian (including the Atlantic Islands), and the group of commercial breeds from the United Kingdom and Inland Europe, was consistent with breed designations, except for Cachena and Barrosã, which clustered together. Thus, for the Iberian breeds the most probable K was 15 and for the United Kingdom and Inland European group was 8 (results not shown). Individual q values resulting from the assignment analysis done for K=30 are depicted in Figure 5.3d, with zebu breeds, the Portuguese Cachena and Barrosã, and Mexican Creoles forming one cluster each. The percentage of correctly assigned individuals for different threshold q values (q 0.800, q 0.950, and q 0.999), as well as the degree of admixture were determined for each Creole population and are shown in Table 5.3. Average membership proportions in each cluster (Q) ranged between 0.615± in Argentino2 and ± in Texas Longhorn, with an overall average for the Creoles of ± The overall percentage of correctly assigned individuals was about 92% for q 0.800, 78% for q 0.950, and 4.8% for q Argentino1 and Caracú had high percentages of correct assignments, and even for the most stringent threshold q about 14% and 18% of the individuals were correctly assigned to these two breeds, respectively. Texas Longhorns also had high percentage of animals correctly assigned (86%, q 0.950), whereas Argentino2 and Chiapas had the lowest percentage of correct assignments with q Evidence of admixture was found for a total of 29 Creole individuals (8.2 %) which had q < in their source population. Admixed animals were detected across all Creoles except in Chihuahua, and ranged between 1.8% in Argentino1 and 54.5% in Argentino2. 110

131 Table 5.3. Summary results of the STRUCTURE analysis for Creoles. Average genotype memberships (Q) in each of four clusters are shown for each Creole population. For the assignment analysis, average Q values, the percentage of correctly assigned (% corr. assign.) and of admixed (% Adm.) individuals are shown for each breed. Overall values are depicted in the last row. Creole populations N Without prior information membership proportions (Q) A B C D Q ± SD With prior information on breeds % Corr. Assign. % Adm. q q q Argentino ± Argentino ± Caracú ± Baja California ± Chiapas ± Chihuahua ± Nayarit ± Poblano ± Pampa Chaqueño ± Texas Longhorn ± Overall ± A Includes most Iberian breeds; B Includes Jersey, Charolais, Limousin, the Iberian Brava de Lide, Garvonesa, and Mostrenca, as well as Canaria and Palmera; C Includes British breeds, and Friesian; D Zebu cluster

132 Capítulo 5 Genetic Structure of Creole Cattle Most of these animals showed zebu admixture, however one Argentino1 had ancestry in Canaria and Limousin, one Chiapas had Friesian ancestry and another had Palmera, one Nayarit had Mostrenca ancestry and another had Angus, and one Pampa Chaqueño had ancestry in Mertolenga and Canaria Conservation perspective Breed contributions to genetic diversity were calculated for Iberian, Atlantic Islands and Creole breeds, and an overall F st = was estimated for this group, as previously described. The contributions of British and Inland European breeds to the genetic diversity have been reported elsewhere (Econogene 2006), while Zebu cattle were not included in the analysis because we did not intend to assess the conservation value of these breeds. The CB ranged between 1.8 and 6.8, whereas CW and D1varied between and 0.542, and and 1.050, respectively (Table 5.4). Palmera, Mirandesa, Caracú, Mostrenca and Brava de Lide had the highest contribution to between-breed diversity, whereas Mexican Creoles and Pampa Chaqueño had the highest contribution to within-breed genetic diversity. Breed ranking based on aggregate diversity was identical to that of CW, with the exception of Caracú which ranked higher for D1. 112

133 Capítulo 5 Genetic Structure of Creole Cattle Table 5.4. Iberian and Creole breed contributions (%) to between-breed (CB), within-breed (CW), and aggregate (D1) genetic diversity. Lowest values are in italics and highest are in bold. Breed CB CW D1 Arouquesa Barrosã/Cachena Marinhoa Maronesa Minhota Mirandesa Alentejana Brava de Lide Garvonesa Mertolenga Preta Mostrenca Ramo Grande Canaria Palmera Argentino Argentino Caracú Baja California Chiapas Chihuahua Nayarit Poblano Pampa Chaqueño Texas Longhorn D1=0.091*CB+0.909*CW 113

134 Capítulo 5 Genetic Structure of Creole Cattle 5.4. Discussion Our study of 24 autosomal STRs revealed that considerable levels of genetic diversity exist within Creole cattle, when compared to breeds from other regions. For example, Pampa Chaqueño and Poblano had a higher MNA (> 8.0) than the commercial breeds of the United Kingdom (< 5.6). Caracú, Pampa Chaqueño and Mexican creoles also had high heterozygosity (H e > 0.70). Creole diversity reflects multiple influences in their genetic makeup, rather than a founder effect from the initial introduction of few animals in the Americas (Liron et al. 2006b). This is consistent with previous analysis of mtdna sequence variation, which confirmed the presence of European as well as African matrilines among Creoles (Miretti et al. 2002; Carvajal-Carmona et al. 2003; Mirol et al. 2003), but also detected some level of genetic proximity with breeds from Iberia and the Atlantic Islands (Ginja et al. in press; Miretti et al. 2004). A recent study of Y-haplotypes also revealed high genetic diversity among Creole patrilines, with zebu, European, and possibly West African influences (Ginja et al. in press). The relatively low F st values detected for Creoles, and in particular for the Mexican populations ( 0.086), could be related with the lack of breed standards defined through herdbooks for most Creole cattle (Giovambattista et al. 2001; Quiroz 2007), and the presence of admixture which in combination with the high generation interval and low reproductive rate in cattle leads to lower levels of genetic drift (Gama, personal communication). In contrast with European breeds that have intensive breeding programs and show higher levels of inbreeding (e.g. Hereford and Angus), among Creoles the deficit in heterozygosity due to inbreeding was highly significant in only one population (Poblano). The AMOVA results (P < ) showed that about 89% of the genetic variation is found within breeds, whereas only 8% corresponded to variation among breeds. This is consistent with previous studies in cattle (Jordana et al. 2003; Tapio et al. 2006a) and other domestic species (Lawson Handley et al. 2007; Pires et al. 2009). Even though only about 3% of the total variation is explained by differences among geographic breed groups, the group effect was highly significant (P < ). 114

135 Capítulo 5 Genetic Structure of Creole Cattle The results of the Bayesian clustering analysis for the Creoles showed signatures of Iberian ancestry, as well as heterogeneity in several populations, caused by admixture with zebu and commercial European breeds. Interestingly, Argentino1 was genetically closer to the Iberian breed group, as inferred from the results of the STRUCTURE analysis for K=4, but also through the PCA and Neighbor-Net graphs, and did not show evidence of crossbreeding. The integrity of Argentinean Creoles is most probably a result of the efforts made since the 1940 s to preserve this breed, which has an herdbook established and also a widespread geographical distribution (Bouzat et al. 1998). Caracú also had a considerable proportion of genotype memberships attributed to the Iberian cluster, which may reflect influence of Portuguese breeds introduced in Brazil during the colonization (Rouse 1977; Primo 1992). Our results indicated that Caracú is genetically distinct from the other breeds included in our analyses (mean F st = ± 0.03) with high percentages of correctly assigned individuals, even when high threshold q values were used, but also showed some level of zebu introgression. The finding in Caracú of alleles which are considered to be of zebu origin, but were also detected in African cattle (MacHugh 1996) at STRs BM2113 (allele 143) and ETH152 (allele 193 which has been found in Caracú and Texas Longhorn, even though this marker was not included in our study) could suggest an African influence. This is further supported by the finding of a distinct zebuine patriline fixed in Caracú, which could also be related with an African origin of this breed (Ginja et al. 2009). Zebu introgression was found in all Creole populations, except Argentino1 (herdbook registered animals). This was expected based on historical evidence of crossbreeding among Creoles and zebu animals over the last century (Rouse 1977; Primo 1992), but also from previous studies of STRs which detected zebu influence in Creoles from Bolivia, Brazil and the Caribbean (Giovambattista et al. 2000; Magee et al. 2002). The separation between the taurine and zebuine clusters is explained by the presence of zebu allelic variants, which are absent in taurine cattle, and the distinct allele distributions between these two breed groups (MacHugh et al. 1997). Zebu specific alleles (MacHugh 1996) were detected at STRs BM2113 (allele 131) and ETH225 (alleles 154 and 158) in all Creole populations except Argentino1, whereas West African taurine alleles (BM ) were only found in Pampa Chaqueño. The assignment results showed that zebu admixture was highest among Creoles from Mexico but also in free ranging Argentinean cattle (Argentino2). Mexican Creoles were 115

136 Capítulo 5 Genetic Structure of Creole Cattle not significantly differentiated, as depicted in the PCA graph, and were grouped in a single cluster in the STRUCTURE analysis of Creoles (Figure 5.3c). Among Mexican cattle, Chiapas had the highest zebu influence, whereas Chihuahua had the highest membership coefficient within the Iberian cluster (Table 5.3). Crossbreeding with commercial European breeds was also detected among Creoles, and was highest in Pampa Chaqueño, which was genetically closer to Hereford. These results are consistent with the finding of the H14Y1 patriline fixed in these two breeds (Ginja et al.2009). Native and peripheral breeds such as Creoles are often threatened by crossbreeding with commercial breeds, which instead have been losing genetic diversity and tend to be highly inbred (Taberlet et al. 2008). Despite the fact that it is difficult to assess the value of a breed in terms of biodiversity, there is the need to define conservation priorities for allocation of funds (FAO 2007). The ranking of breeds based on the Weitzman approach (CB) attributed highest conservation priority to the most genetically distinct breeds, such as Palmera, Mirandesa, and Caracú. However, this measure is influenced by genetic drift in isolated populations, and may reflect isolation rather than breed contributions to overall diversity (Econogene 2006). On the other hand, the risk of prioritizing breeds for conservation based exclusively on within-breed (CW) diversity is that preference would be given to breeds showing signs of crossbreeding, such as Minhota, Mexican Creoles and Pampa Chaqueño, and hence mostly breeds where zebu introgression has increased genetic diversity because alleles from two distinct lineages are represented (Freeman et al. 2004). Therefore, breeds that might have distinct and unique genotypes could be sacrificed with the goal of maximizing overall diversity. Aggregate diversity (D1) did not retrieve substantially different breed rankings from CW, and because of the relatively low F st value estimated for this breed group, different weights could be used to increase the contribution of CB (Ollivier & Foulley 2005). However, when the CB was weighted five times in relation to CW (Piyasatian & Kinghorn 2003) the breed ranking was identical to that of CB (results not shown). Thus, CB and CW can be seen as two extreme rankings in terms of breed contributions to overall diversity, and the choice of the appropriate weights to be given to each estimate is not a resolved issue (Econogene 2006). Whereas the preservation of genetically distinct breeds is important to maintain within-species diversity, it is also important to preserve threatened and inbred populations that may represent well adapted 116

137 Capítulo 5 Genetic Structure of Creole Cattle breeds with unique traits (Tapio et al. 2006a). Overall, the prioritization of breeds for conservation is not a simple task, as other factors such as the cultural and historical value of breeds should also be taken into account (Econogene 206). This study complements prior genetic analyses of Creole cattle, and because it included Creoles from North and South America, and Iberian as well as commercial European and zebu breeds which may have influenced the Creoles, it further enhanced our understanding of their origins and genetic structure. Overall, high levels of genetic diversity were detected among Creoles but also dilution from crossbreeding with zebu and commercial European breeds. The analyses done with STRUCTURE were useful to identify subtle traces of Iberian influence in Creole cattle. The STR markers used in our study have been applied to characterize cattle worldwide (Lenstra & Econogene 2008), thus the genotypic database assembled here can be used to implement a meta-analysis of combined datasets, to include additional breeds and make inferences at larger geographic scales. 117

138

139 Capítulo 6 CONSIDERAÇÕES FINAIS

140

141 CAPÍTULO 6. CONSIDERAÇÕES FINAIS E PERSPECTIVAS FUTURAS 6.1. Considerações finais Este trabalho constitui um estudo aprofundado de caracterização genética das raças bovinas Ibéricas e Crioulas, cujos resultados fornecem informação relevante acerca das suas origens, da diversidade existente e da sua estrutura genética. Uma particularidade deste trabalho de investigação prende-se com o facto de ter sido congregada, para todas as raças, informação inerente a três tipos de marcadores moleculares (STRs, cromossoma Y e mtdna), com características distintas e amplamente recomendados para a caracterização genética de animais domésticos (Bruford et al. 2003). Assim, foi possível obter uma perspectiva global acerca das origens e da composição genética destas raças. A análise de polimorfismos do mtdna foi extremamente útil, pois permitiu enquadrar a diversidade genética destas raças num contexto filogeográfico, através da classificação dos haplotipos encontrados em haplogrupos cuja origem foi previamente descrita. A estratégia utilizada para a análise de polimorfismos do cromossoma Y é inovadora, pois incluiu informação conjugada de SNPs e STRs para a definição de haplotipos. Esta abordagem permitiu detectar variação adicional nos haplogrupos Y1, Y2 e Y3, inicialmente definidos por Gotherstom et al. (2005), o que proporcionou uma análise detalhada das relações genéticas entre linhas paternas das várias raças bovinas. A informação genética resultante deste tipo de análise foi crucial para identificar possíveis cruzamentos mediados por machos. Por último, os STRs foram importantes para consolidar toda esta informação, e ainda para determinar a estrutura genética destas populações. Relativamente aos bovinos Ibéricos, e em particular às raças autóctones Portuguesas, este estudo complementou informação já publicada (Beja-Pereira et al. 2003; Mateus et al. 2004b; Cymbron et al. 2005) referente à caracterização da sua diversidade genética. No entanto, foram analisadas, pela primeira vez, as 13 raças autóctones de Portugal, incluindo a raça Ramo Grande do Arquipélago Açoriano. A amostragem destas raças foi extremamente cuidadosa e exaustiva, o que permitiu estabelecer na Estação Zootécnica Nacional um banco de DNA que fica disponível para trabalhos futuros. Foram, ainda, incluídas nas análises a raça Mostrenca de Espanha, e duas raças das Ilhas Canárias 121

142 Capítulo 6 Considerações Finais e Perspectivas Futuras (Palmera e Canária) que estão historicamente relacionadas com os bovinos Ibéricos e Crioulos. A raça Mostrenca constitui uma raça ancestral na Península Ibérica, que se encontra em estado semi-selvagem na região do Parque Nacional de Doñana, e que pode ter contribuído para o pool genético dos bovinos do Novo Mundo (Martinez et al. 2005). A diversidade genética detectada na Ibéria foi relativamente elevada, tendo algumas raças (e.g. Alentejana, Brava de Lide, Mertolenga e Ramo Grande) mostrado evidência de consanguinidade, enquanto a raça Mirandesa parece ter sofrido uma redução da diversidade genética por diminuição temporária do efectivo (bottleneck). As análises do cromossoma Y são consistentes com a ancestralidade histórica de algumas raças da Península Ibérica, nomeadamente da raça Brava de Lide, Mertolenga, Preta, e Mostrenca, que apresentaram linhas paternas do haplogrupo Y1, que tem sido associado à influência do auroque (Gotherstrom et al. 2005). No entanto, é necessária uma análise mais detalhada e que inclua amostras de adna da Península Ibérica, para se poder determinar a frequência dos diferentes haplogupos do cromossoma Y nos bovinos ancestrais desta região. Neste estudo é corroborada a forte influência de animais de origem Africana na constituição genética de várias raças de bovinos Ibéricos. Esta contribuição é sustentada pelos três tipos de marcadores moleculares utilizados e pela frequência elevada de linhagens Africanas. Estes resultados sugerem uma contribuição ampla e ancestral de bovinos Africanos, como é discutido por Beja Pereira et al. (2006) para as raças da região do Mediterrâneo (incluindo 6 raças Portuguesas), mas também da introdução de animais provenientes de África pelas comunidades Mouras que ocuparam o sul da Península Ibérica até finais do século XV (Cymbron et al. 1999). A análise de STRs revelou que a estrutura genética dos bovinos Ibéricos corresponde à designação das raças, excepto no caso das raças Cachena e Barrosã, que tendem a formar um grupo único. Contudo, encontrou-se evidência de diluição na raça Minhota, por cruzamento com raças comerciais, assim como na raça Ramo Grande, que terá sofrido a influência de touros da raça Frísia. Na raça Mertolenga foi detectada subestrutura associada à criação independente de bovinos com o fenótipo Rosilho, o que pode justificar os desvios observados à situação de Equilíbrio Hardy-Weinberg por um efeito de Wahlund 122

143 Capítulo 6 Considerações Finais e Perspectivas Futuras (fragmentação da população) e não devido a consanguinidade, até porque esta raça apresentou uma diversidade genética elevada. Os resultados dos testes de classificação de animais em populações de origem indicam que as raças autóctones Portuguesas estão suficientemente diferenciadas para permitir uma percentagem elevada de classificações correctas, com um grau de confiança relativamente elevado (q > 0.950). Estes resultados podem ser úteis na validação molecular de produtos certificados de origem animal, tal como foi discutido por Ginja (2002). Historicamente, considera-se que o gado Crioulo das Américas tem origem nos bovinos Ibéricos transportados pelos colonizadores Espanhóis e Portugueses, mas terá também sofrido influência de raças comerciais Britânicas e da Europa Continental, assim como de bovinos zebu (Rouse 1977). A análise genética foi consistente com estes registos históricos, e confirmou a proximidade com raças autóctones da Península Ibérica, mas também revelou a existência de uma elevada heterogeneidade entre os Crioulos. As análises de haplotipos do mtdna confirmaram que a linhagem materna Europeia T3 é a mais comum entre os Crioulos, mas também revelaram a presença de haplotipos Africanos T1a e AA. Os polimorfismos do cromossoma Y são consistentes com estes resultados, pois o haplogrupo Y2, que é comum em raças Ibéricas, foi observado em frequências variáveis nos Crioulos e, além disso, comprovaram a influência de raças da Europa do Norte (haplogrupo Y1) e de zebu (haplogrupo Y3). A análise de STRs ilustrou claramente a diferença entre animais taurinos e zebuínos, permitiu identificar as raças de origem Ibérica e Britânica, e confirmou a heterogeneidade dos Crioulos devida a introgressão de outras raças. O Crioulo Argentino (animais registados no livro genealógico da raça) e o Caracú são geneticamente distintos das restantes populações Crioulas, e apresentam a maior proximidade com os ancestrais Ibéricos. No caso do Caracú, foi detectada uma linhagem paterna substancialmente diferenciada, portadora de alelos observados em bovinos Africanos e com influência de gado zebu (haplogrupo Y3). Este resultado, em paralelo com a elevada frequência de linhagens maternas ancestrais derivadas de África (AA) observadas na raça Caracú e ausentes nos bovinos Portugueses, sugere a introdução no Brasil de gado oriundo de África, possivelmente através das rotas de escravos. A análise de STRs corroborou estes resultados, na medida em que foram encontrados alelos específicos de zebu, também detectados em gado Africano (MacHugh 1996). A questão da introdução de 123

144 Capítulo 6 Considerações Finais e Perspectivas Futuras bovinos na América do Sul directamente desde África tem sido discutida e, se por um lado poderá estar associada à presença na Ibéria de linhagens Africanas (Miretti et al. 2004), por outro a influência directa Africana é igualmente plausível (Liron et al. 2006a). A ampla difusão de linhagens Africanas ancestrais (AA) agora descrita, é consistente com estas duas origens. No entanto, a análise de raças Africanas, nomeadamente para marcadores específicos do cromossoma Y, poderia contribuir para o esclarecimento desta questão. Os Crioulos Mexicanos constituem um grupo extremamente heterogéneo e pouco diferenciado, o que é consistente com a ausência de tradição de gerir as populações de bovinos Crioulos como entidades independentes, i.e., raças (Rouse 1977), mas também resulta da diluição por cruzamento com raças comerciais, nomeadamente no caso das populações de Chiapas e Nayarit. A introgressão de gado zebu em Crioulos foi identificada pela presença de haplotipos Y3, nomeadamente no Caracú, nos Crioulos Mexicanos, e no Texas Longhorn. O facto de as raças comerciais Europeias estarem fixas para um único haplotipo paterno, permitiu identificar a contribuição de machos destas raças para populações de Crioulos, nomeadamente de touros Hereford para o Pampa Chaqueño e para o Texas Longhorn. A diversidade genética observada nos Crioulos foi elevada, nomeadamente no que respeita à variedade de linhas maternas e paternas encontradas, mas também aos parâmetros de variabilidade genética estimados para os marcadores autossómicos neutros. Estes resultados não reflectem um efeito fundador inerente à introdução inicial de um número reduzido de animais (Primo 2004), mas antes as origens múltiplas dos Crioulos com influência de raças Ibéricas e Africanas. Acresce ainda o facto de os bovinos Ibéricos que lhes deram origem, também apresentarem diversidade genética elevada. Em paralelo, na maioria dos casos não existe uma tradição na gestão de populações de Crioulos como raças registadas num Livro Genealógico, com padrões definidos e sujeitas a programas de selecção com objectivos produtivos. Numa perspectiva de conservação, se por um lado importa preservar a diversidade destes recursos genéticos animais, por outro é importante que as populações de Crioulos mantenham as suas peculiaridades, nomeadamente em termos da adaptação aos ambientes em que persistem. Este estudo demonstrou que algumas populações de Crioulos, nomeadamente as do México, correm sério risco de 124

145 Capítulo 6 Considerações Finais e Perspectivas Futuras diluição por cruzamento com raças comerciais, havendo necessidade urgente de tomar medidas que minimizem a erosão genética a que têm estado sujeitas. Os resultados das análises de conservação identificaram as raças Palmera, Mirandesa e Caracú como sendo as mais distintas geneticamente e as que maior influência têm na diversidade genética global. No entanto, esta classificação considera apenas a diferenciação das populações com base em distâncias genéticas e não incorpora a variabilidade genética intra-racial. As decisões sobre as populações prioritárias a considerar em termos de implementação de medidas de conservação não são simples, e devem incluir não só a informação sobre a contribuição de cada raça para a diversidade genética, mas também as particularidades inerentes a determinadas raças, assim como o seu valor histórico e cultural. Este estudo fornece, também, informação relevante para o maneio e gestão das populações de bovinos Ibéricos e Crioulos a nível local, nomeadamente no que respeita à identificação das raças mais ameaçadas por cruzamento com raças comerciais, de populações com índices de consanguinidade elevados e das raças que possuem características genéticas distintas associadas às suas origens e evolução Perspectivas futuras Naturalmente, a investigação sobre as origens e evolução dos bovinos Ibéricos e Crioulos não se esgota neste estudo. Ainda que algumas questões possam ser clarificadas com base nos nossos resultados, outras dúvidas surgem, que poderão ser elucidadas em investigações futuras. Por exemplo, qual é a origem exacta das linhagens Africanas detectadas nos Crioulos? Se houve contribuição directa de bovinos Africanos para o gado do Novo Mundo, em que locais ocorreu a introdução de animais oriundos de África e qual foi a extensão desta influência? A linhagem materna ancestral derivada de África (AA) terá existido em Portugal? Qual a frequência dos haplogrupos paternos e maternos observados nas raças modernas, em bovinos selvagens e animais pré-domésticos da Península Ibérica e do Norte de África? A resposta a estas e a outras questões levantadas pelo nosso estudo não parece ser simples, e sem dúvida que a análise mais alargada de raças de Espanha e de África 125

146 Capítulo 6 Considerações Finais e Perspectivas Futuras (nomeadamente do Norte de África), assim como da região da Guiné e do arquipélago de Cabo Verde (onde os Portugueses mantiveram colónias), poderia ajudar a esclarecer a influência Africana em bovinos Crioulos. A análise de haplotipos do mtdna em raças Espanholas não está completa e o estudo da variação associada ao cromossoma Y em raças bovinas reduz-se, na maioria dos casos, à utilização de um único STR (e.g., INRA124), em estudos de hibridação entre B. taurus e B. indicus, ou à análise de SNPs para identificação dos três haplogrupos principais. Este estudo ilustra as vantagens da definição de haplotipos do cromossoma Y com base em informação combinada de SNPs e STRs, no sentido em que permite uma análise mais detalhada das relações entre as diversas raças. Por exemplo, neste momento já se estabeleceram colaborações (Dr. J. Lenstra e Dr. J. Kantanen) para explorar a origem da linhagem paterna da raça Frísia e em que medida esta ocorre em raças geneticamente próximas e que pertencem ao mesmo grupo de bovinos (e.g. Dutch Belted). Estabeleceu-se, também, uma colaboração com grupos de investigação de Espanha (Dr. J. Cañon, Dr. P. Zaragoza e Dr. A. Martínez) e de diversos países da América Latina, no âmbito da Rede Iberoamericana para a Conservação da Biodiversidade de Animais Domésticos Locais e para o Desenvolvimento Rural Sustentável (Rede CYTED XII-H, coordenada pelo Dr. J. Delgado), para analisar conjuntamente os resultados da variação de STRs em bovinos de toda a Península Ibérica e em várias populações de Crioulos. As origens da linhagem materna ancestral AA derivada de África não são conhecidas, pois não foram ainda observados animais Africanos pertencentes a este haplogrupo. A sequenciação do genoma mitocondrial completo de animais com haplotipos AA poderia permitir uma comparação mais detalhada com outros animais para os quais já existe esta informação e ajudar a compreender melhor a origem destas linhagens no contexto da filogenia dos bovinos. Estudos recentes indicam que é importante utilizar informação de sequências de mtdna completas para fazer inferências detalhadas sobre as origens e a evolução dos bovinos (Achilli et al. 2008; Hiendleder et al. 2008). O estudo de amostras de adna de bovinos da Península Ibérica e do Norte de África, pela análise de polimorfismos do mtdna e cromossoma Y, é extremamente valioso para determinar a composição genética dos ancestrais selvagens, de animais pré-domésticos e também das várias populações de bovinos domésticos ao longo do tempo. Estas análises poderiam ser úteis para tentar definir se ocorreram processos locais de domesticação, para 126

147 Capítulo 6 Considerações Finais e Perspectivas Futuras averiguar se houve hibridação entre animais domésticos e selvagens e se esta se processou por via materna ou se foi mediada por touros. O adna tem fornecido informação importante sobre as origens e a evolução dos bovinos domésticos Europeus (MacHugh et al. 1999; Beja-Pereira et al. 2006; Bollongino et al. 2006; Edwards et al. 2007b; Pellecchia et al. 2007; Svensson et al. 2007). No caso particular de marcadores específicos do cromossoma Y, importa esclarecer se os haplotipos Y1 detectados em raças modernas da Península Ibérica reflectem influência ancestral de machos selvagens. Um estudo de Gotherstrom et al. (2005) confirmou a presença deste haplogrupo em auroques do Norte da Europa, no entanto dados recentes sugerem que a frequência dos haplogrupos Y1 e Y2 em animais domésticos variou ao longo dos tempos, podendo estas variações estar associadas a pressões de selecção inerentes ao melhoramento de bovinos (Svensson & Gotherstrom 2008). Por outro lado, a análise de polimorfismos do mtdna em adna de bovinos Ibéricos poderia complementar resultados recentes, que sugerem uma influência ancestral de gado Africano (Anderung et al. 2005), mas também elucidar sobre a existência da linhagem AA, nomeadamente em Portugal. Num projecto de colaboração com o Instituto Português de Arqueologia (Dr. S. Davis), foram já recolhidas amostras de bovinos ancestrais em várias escavações arqueológicas de Portugal, e que incluem ossadas do Calcolítico, da Idade do Ferro, e dos períodos Romano, Muçulmano e pós-muçulmano (desde a.c. até ao século XVI). Neste momento, está já em curso uma análise preliminar em colaboração com o Departamento de Biologia Evolutiva da Universidade de Uppsala (Dr. A. Gotherstrom), na Suécia, para testar a qualidade e especificidade do adna que é possível obter a partir destas amostras. Por último, seria importante complementar a caracterização genética realizada no âmbito deste estudo com a informação fornecida por marcadores não-neutros, que possam estar associados a características produtivas de interesse, sujeitos a selecção artificial ou envolvidos em mecanismos de adaptação a condições ambientais distintas. Os desenvolvimentos recentes na tecnologia de genotipagem de SNPs, que permitem a análise de um número elevado de SNPs distribuídos pelo genoma, fornecem novas perspectivas no que respeita a estudos da associação entre variabilidade genética e características fenotípicas de interesse. 127

148

149 DIVULGAÇÃO DO CONHECIMENTO Publicações em revistas científicas internacionais com refrees Ginja C., Gama L. T. & Penedo M. C. T. (2009) Y chromosome haplotype analysis in Portuguese cattle breeds using SNPs and STRs. Journal of Heredity 100(2), Ginja C., Penedo M. C. T. Melucci L., Quiroz J., Martínez López R.O., Revidatti M. A., Martínez-Martínez A., Delgado J. V. & Gama L. T. Origins and genetic diversity of New World Creole cattle: inferences from mitochondrial and Y chromosome polymorphisms. Animal Genetics (doi: /j x). Ginja C., Gama L. T. & Penedo M. C. T. Analysis of STR markers reveals high genetic structure in Portuguese native cattle Journal of Heredity (in press). Ginja C., Penedo M. C. T., Gama L. T. et al. Genetic diversity and structure of Creole cattle based on STRs: a conservation perspective (em preparação para publicação conjunta com grupos de investigação de Espanha e da América Latina). Bastos-Silveira C., Luis C., Ginja C., Gama L. T. & Oom. M. M. (2008) Genetic variation of BoLA and non-bola microsatellite loci in Portuguese cattle breeds. Animal Genetics, 40: Comunicações em livros de actas de encontros científicos Comunicações orais Ginja C., Gama L. T., Delgado J. V. & Martinez A. Genetic characterization of Iberian cattle. Presented at the VI Simposio Iberoamericano sobre Conservación y Utilización de Recursos Zoogenéticos, Chiapas, Mexico, November 2005, Livro de memórias, pp Ginja C., Gama L. T. & Penedo M. C. T. Molecular characterization of Portuguese native cattle based on autosomal, Y chromosome and mtdna markers. Presented at the European Science Foundation Workshop: Diversity, selection and adaptation in wildlife and livestock - molecular approaches, Salzburg, Austria, November

150 Divulgação do conhecimento Comunicações em painel Ginja C., Melucci L., Quiroz J., Martínez López R.O., Revidatti M. A., Martínez- Martínez A., Penedo M. C. T. & Gama L. T. Y-chromosome haplotype diversity in cattle. Presented at the 31 st Conference of the International Society for Animal Genetics, Amsterdam, The Netherlands, August Ginja C., Penedo M. C. T. & Gama L. T. The use of molecular tools for management and conservation of Portuguese native cattle: preliminary data from autosomal, Y chromosome and mitochondrial markers. Presented at VI Congresso Ibérico sobre Recursos Genéticos Animais, Sociedade Portuguesa de Recuros Geneticos Animais, Lisbon, September

151 REFERÊNCIAS BIBLIOGRÁFICAS

152

153 REFERÊNCIAS BIBLIOGRÁFICAS Achilli A., Olivieri A., Pellecchia M., et al. (2008) Mitochondrial genomes of extinct aurochs survive in domestic cattle. Current Biology 18, Anderson S., de Bruijn M.H., Coulson A.R., Eperon I.C., Sanger F. & Young I.G. (1982) Complete sequence of bovine mitochondrial DNA. Conserved features of the mammalian mitochondrial genome. Journal of Molecular Biology 156, Anderung C., Bouwman A., Persson P., Carretero J.M., Ortega A.I., Elburg R., Smith C., Arsuaga J.L., Ellegren H. & Gotherstrom A. (2005) Prehistoric contacts over the Straits of Gibraltar indicated by genetic analysis of Iberian Bronze Age cattle. Proceedings of the National Academy of Sciences of the United States of America 102, Anderung C., Hellborg L., Seddon J., Hanotte O. & Gotherstrom A. (2007) Investigation of X- and Y- specific single nucleotide polymorphisms in taurine (Bos taurus) and indicine (Bos indicus) cattle. Animal Genetics 38, Bailey J.F., Richards M.B., Macaulay V.A., Colson I.B., James I.T., Bradley D.G., Hedges R.E. & Sykes B.C. (1996) Ancient DNA suggests a recent expansion of European cattle from a diverse wild progenitor species. Proceedings of the National Academy of Sciences of the United States of America 263, Bandelt H.J., Forster P. & Rohl A. (1999) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution 16, Bandelt H.J., Forster P., Sykes B.C. & Richards M.B. (1995) Mitochondrial portraits of human populations using median networks. Genetics 141, Bandelt H.J., Macaulay V. & Richards M. (2000) Median networks: speedy construction and greedy reduction, one simulation, and two case studies from human mtdna. Molecular Phylogenetics and Evolution 16, Banks M.A., Eichert W. & Olsen J.B. (2003) Which genetic loci have greater population assignment power? Bioinformatics 19, Bannasch D.L., Bannasch M.J., Ryun J.R., Famula T.R. & Pedersen N.C. (2005) Y chromosome haplotype analysis in purebred dogs. Mammalian Genome 16, Beaumont M., Barratt E.M., Gottelli D., Kitchener A.C., Daniels M.J., Pritchard J.K. & Bruford M.W. (2001) Genetic diversity and introgression in the Scottish wildcat. Molecular Ecology 10, Beaumont M.A. & Rannala B. (2004) The Bayesian revolution in genetics. Nature Reviews Genetics 5,

154 Referências Bibliográficas Beja-Pereira A., Alexandrino P., Bessa I., Carretero Y., Dunner S., Ferrand N., Jordana J., Laloe D., Moazami-Goudarzi K., Sanchez A. & Cañon J. (2003) Genetic characterization of southwestern European bovine breeds: a historical and biogeographical reassessment with a set of 16 microsatellites. Journal of Heredity 94, Beja-Pereira A., Caramelli D., Lalueza-Fox C., et al. (2006) The origin of European cattle: evidence from modern and ancient DNA. Proceedings of the National Academy of Sciences of the United States of America 103, Beja-Pereira A., England P.R., Ferrand N., Jordan S., Bakhiet A.O., Abdalla M.A., Mashkour M., Jordana J., Taberlet P. & Luikart G. (2004) African origins of the domestic donkey. Science 304, Belkhir K., Borsa P., Chikhi L., Raufaste N. & Bonhomme F. ( ) GENETIX: logiciel sous Windows TM pour la génétique des populations. Laboratoire Génome, Populations, Interactions, CNRS, Université de Montpellier II, Montpellier, France. Bensasson D., Zhang D., Hartl D.L. & Hewitt G.M. (2001) Mitochondrial pseudogenes: evolution's misplaced witnesses. Trends in Ecology and Evolution 16, Bishko C.J. (1952) The Peninsular background of Latin American cattle ranching. The Hispanic American Historical Review 32, Bishop M.D., Kappes S.M., Keele J.W., Stone R.T., Sunden S.L., Hawkins G.A., Toldo S.S., Fries R., Grosz M.D., Yoo J. & et al. (1994) A genetic linkage map for cattle. Genetics 136, Blaires R.M.C. (2004) Informe sobre la situación de los recursos zoogenéticos del Paraguay. p. 42. Comision Consultiva Nacional, Food and Agriculture Organization, Asunción, Paraguay. Bollongino R., Edwards C.J., Alt K.W., Burger J. & Bradley D.G. (2006) Early history of European domestic cattle as revealed by ancient DNA. Biology Letters 2, Bollongino R., Elsner J., Vigne J.D. & Burger J. (2008) Y-SNPs do not indicate hybridisation between European aurochs and domestic cattle. PLoS ONE 3, e3418. Bouzat J.L., Giovambattista G., Golijow C.D., Lojo M.M. & Dulout F.N. (1998) Genetica de la conservacion de razas autoctonas: el ganado criollo Argentino. Interciencia 23, Bradley D.G., MacHugh D.E., Cunningham P. & Loftus R.T. (1996) Mitochondrial diversity and the origins of African and European cattle. Proceedings of the National Academy of Sciences of the United States of America 93, Bradley D.G., MacHugh D.E., Loftus R.T., Sow R.S., Hoste C.H. & Cunningham E.P. (1994) Zebu-taurine variation in Y chromosomal DNA: a sensitive assay for genetic introgression in west African trypanotolerant cattle populations. Animal Genetics 25,

155 Referências Bibliográficas Bruford M.W. (2004) Conservation genetics of UK livestock: from molecules to management. In: Farm animal genetic resources (eds. by Simm G, Villanueva B & Townsend S), pp Nottingham University Press, Nottingham, UK. Bruford M.W., Bradley D.G. & Luikart G. (2003) DNA markers reveal the complexity of livestock domestication. Nature Reviews Genetics 4, Caballero A. & Toro M.A. (2002) Analysis of genetic diversity for the management of conserved subdivided populations. Conservation Genetics 3, Cai X., Chen H., Lei C., Wang S., Xue K. & Zhang B. (2007) mtdna diversity and genetic lineages of eighteen cattle breeds from Bos taurus and Bos indicus in China. Genetica 131, Cañon J., Alexandrino P., Bessa I., Carleos C., Carretero Y., Dunner S., Ferrand N., García D., Jordana J., Laloe D., Pereira A., Sanchez A. & Moazami-Goudarzi K. (2001) Genetic diversity measures of local European beef cattle breeds for conservation purposes. Genetics Selection and Evolution 33, Cañon J., García D., García-Atance M.A., Obexer-Ruff G., Lenstra J.A., Ajmone-Marsan P. & Dunner S. (2006) Geographical partitioning of goat diversity in Europe and the Middle East. Animal Genetics 37, Cañon J., Tupac-Yupanqui I., García-Atance M.A., Cortés O., García D., Fernández J. & Dunner S. (2008) Genetic variation within the Lidia bovine breed. Animal Genetics 39, Carolino N. & Gama L.T. (2008) Indicators of genetic erosion in an endangered population: the Alentejana cattle breed in Portugal. Journal of Animal Science 86, Carvajal-Carmona L.G., Bermudez N., Olivera-Angel M., Estrada L., Ossa J., Bedoya G. & Ruiz-Linares A. (2003) Abundant mtdna diversity and ancestral admixture in Colombian criollo cattle (Bos taurus). Genetics 165, Chapuis M.P. & Estoup A. (2007) Microsatellite null alleles and estimation of population differentiation. Molecular Biology and Evolution 24, Charlesworth B., Sniegowski P. & Stephan W. (1994) The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371, Chikhi L. & Bruford M.W. (2005) Mammalian population genetics and genomics. In: Mammalian Genomics (eds. by Ruvinsky A & Marshall-Graves J), pp CABI Publishing, Oxford, UK. Chikhi L., Goossens B., Treanor A. & Bruford M.W. (2004) Population genetic structure of and inbreeding in an insular cattle breed, the Jersey, and its implications for genetic resource management. Heredity 92,

156 Referências Bibliográficas Ciampolini R., Cetica V., Ciani E., Mazzanti E., Fosella X., Marroni F., Biagetti M., Sebastiani C., Papa P., Filippini G., Cianci D. & Presciuttini S. (2006) Statistical analysis of individual assignment tests among four cattle breeds using fifteen STR loci. Journal of Animal Science 84, Clutton-Brock J. (1999) A natural history of domesticated mammals. Cambridge University Press, Cambridge. Cooper A. & Poinar H.N. (2000) Ancient DNA: do it right or not at all. Science 289, Cornuet J.M., Piry S., Luikart G., Estoup A. & Solignac M. (1999) New methods employing multilocus genotypes to select or exclude populations as origins of individuals. Genetics 153, Cortes O., Tupac-Yupanqui I., Dunner S., Garcia-Atance M.A., Garcia D., Fernandez J. & Canon J. (2008) Ancestral matrilineages and mitochondrial DNA diversity of the Lidia cattle breed. Animal Genetics 39, Cymbron T., Freeman A.R., Isabel Malheiro M., Vigne J.D. & Bradley D.G. (2005) Microsatellite diversity suggests different histories for Mediterranean and Northern European cattle populations. Proceedings of the Royal Society of London, Series B, Biological Sciences 272, Cymbron T., Loftus R.T., Malheiro M.I. & Bradley D.G. (1999) Mitochondrial sequence variation suggests an African influence in Portuguese cattle. Proceedings of the Royal Society of London, Series B, Biological Sciences 266, Dadi H., Tibbo M., Takahashi Y., Nomura K., Hanada H. & Amano T. (2009) Variation in mitochondrial DNA and maternal genetic ancestry of Ethiopian cattle populations. Animal Genetics. (doi: /j x). Dakin E.E. & Avise J.C. (2004) Microsatellite null alleles in parentage analysis. Heredity 93, Davis J.M. (2008) Zooarcheological evidence for Moslem and Christian improvements of sheep and cattle in Portugal. Journal of Archaeological Science 35, Dempster A.P., Laird N.M. & Rubin D.B. (1977) Maximum likelihood from incomplete data via the EM algorithm. Journal of the Royal Statistical Society, Series B, Statistical methodology 39, Derban S., Foulley J.L. & Ollivier L. (2002) WEITZPro. HU, Berlin; ENSAE, Paris and INRA-SGQA, Jouyen-Josas. Diamond J. (2002) Evolution, consequences and future of plant and animal domestication. Nature 418, Driscoll C.A., Menotti-Raymond M., Roca A.L., Hupe K., Johnson W.E., Geffen E., Harley E.H., Delibes M., Pontier D., Kitchener A.C., Yamaguchi N., O'Brien S J. & Macdonald D.W. (2007) The Near Eastern origin of cat domestication. Science 317,

157 Referências Bibliográficas Econogene (2006) Marker-assisted conservation of European cattle breeds: An evaluation. Animal Genetics 37, Eding H. & Meuwissen T.H. (2001) Marker-assisted estimates of between and whithin population kinships from genetic marker data for the construction of core sets in genetic conservation schemes. Journal of Animal Breeding and Genetics, Edwards C.J., Baird J.F. & MacHugh D.E. (2007a) Taurine and zebu admixture in Near Eastern cattle: a comparison of mitochondrial, autosomal and Y-chromosomal data. Animal Genetics 38, Edwards C.J., Bollongino R., Scheu A., et al. (2007b) Mitochondrial DNA analysis shows a Near Eastern Neolithic origin for domestic cattle and no indication of domestication of European aurochs. Proceedings of the Royal Society of London, Series B, Biological Sciences 274, Edwards C.J., Dolf G., Looft C., Loftus R.T. & Bradley D.G. (2000a) Relationships between the endangered Pustertaler-Sprinzen and three related European cattle breeds as analysed with 20 microsatellite loci. Animal Genetics 31, Edwards C.J., Gaillard C., Bradley D.G. & MacHugh D.E. (2000b) Y-specific microsatellite polymorphisms in a range of bovid species. Animal Genetics 31, Egito A.A., Mariante A.S. & Albuquerque M.S.M. (2002) The Brazilian genetic resources conservation plan. Archivos de Zootecnia 51, Egito A.A., Paiva S.R., Albuquerque Mdo S., Mariante A.S., Almeida L.D., Castro S.R. & Grattapaglia D. (2007) Microsatellite based genetic diversity and relationships among ten Creole and commercial cattle breeds raised in Brazil. BMC Genetics 8, 83. Elsik C.G., Tellam R.L., Worley K.C., et al. (2009) The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science 324, Evanno G., Regnaut S. & Goudet J. (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14, Excoffier L., Smouse P.E. & Quattro J.M. (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics 131, Falush D., Stephens M. & Pritchard J.K. (2003) Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164, FAO (2004a) Measurement of Domestic Animal Diversity - A review of recent diversity studies. p. 38. Food and Agriculture Organisation of the United Nations, Commission on Genetic Resources, Working Group on Animal Genetic Resources, Rome, Italy. 137

158 Referências Bibliográficas FAO (2004b) Recursos genéticos animais em Portugal. Relatório Nacional. p. 68. Food and Agriculture Organization of the United Nations, Vale de Santarém, Portugal. FAO (2007) The state of the World's Animal Genetic Resources for Food and Agriculture. (eds. by Rischkowsky B & Pilling D), p Food and Agriculture Organization of the United Nations, Rome, Italy. FAO/UNEP (2000) World watch list for domestic animal diversity. (ed. by Scherf BD). Food and Agriculture Organisation of the United Nations, Rome, Italy. Felius M. (1985) Genus Bos: Cattle breeds of the world. Merck & Co., Inc., New Jersey, U.S.A. Freeman A.R., Meghen C.M., Machugh D.E., Loftus R.T., Achukwi M.D., Bado A., Sauveroche B. & Bradley D.G. (2004) Admixture and diversity in West African cattle populations. Molecular Ecology 13, Fries R. & Popescu P. (1999) Cytogenetics and physical chromosome maps. In: The genetics of Cattle (eds. by Fries R & Ruvinsky A), pp C.A.B. International, Wallingford, Oxon, U.K. Gama L.T., Carolino N., Costa M.S. & Matos C.P. (2004) Recursos genéticos animais em Portugal. Relatório Nacional. p. 68. Food and Agriculture Organization of the United Nations, Vale de Santarém, Portugal. Garcia D., Corral N. & Canon J. (2005) Combining inter- and intrapopulation information with the Weitzman approach to diversity conservation. Journal of Heredity 96, Geigl E.M. (2008) Palaeogenetics of cattle domestication: methodological challenges for the study of fossil bones preserved in the domestication centre in Southwest Asia. Comptes Rendus Palevol 7, Ginja C. (2002) Identificação de raças bovinas Portuguesas através da utilização de marcadores moleculares. Universidade de Trás-os-Montes e Alto Douro, Vila Real, Portugal. Ginja C., Gama L.T. & Penedo M.C.T. (2009) Y chromosome haplotype analysis in Portuguese cattle breeds using SNPs and STRs. Journal of Heredity 100, Ginja C., Penedo M.C.T., Melucci L., Quiroz J., Matrinez Lopez O.R., Revidatti M.A., Martinez A.M., Delgado J.V. & Gama L. Origins and genetic diversity of New World Creole cattle: inferences from mitochondrial and Y chromosome polymorphisms. Animal Genetics (doi: /j x). Giovambattista G., Ripoli M.V., De Luca J.C., Mirol P.M., Liron J.P. & Dulout F.N. (2000) Malemediated introgression of Bos indicus genes into Argentine and Bolivian Creole cattle breeds. Animal Genetics 31, Giovambattista G., Ripoli M.V., Peral-Garcia P. & Bouzat J.L. (2001) Indigenous domestic breeds as reservoirs of genetic diversity: the Argentinean Creole cattle. Animal Genetics 32,

159 Referências Bibliográficas Giuffra E., Kijas J.M., Amarger V., Carlborg O., Jeon J.T. & Andersson L. (2000) The origin of the domestic pig: independent domestication and subsequent introgression. Genetics 154, Gotherstrom A., Anderung C., Hellborg L., Elburg R., Smith C., Bradley D.G. & Ellegren H. (2005) Cattle domestication in the Near East was followed by hybridization with aurochs bulls in Europe. Proceedings of the Royal Society of London, Series B, Biological Sciences 272, Goudet J. (1999) PCAGEN software. Goudet J. (2001) FSTAT a program to estimate and test gene diversities and fixation indices. p. Updated from Goudet Group T.I.S.M.W. (2001) A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature 409, Guo S.W. & Thompson E.A. (1992) Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics 48, Hall T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, Hammer M.F., Karafet T.M., Redd A.J., Jarjanazi H., Santachiara-Benerecetti S., Soodyall H. & Zegura S.L. (2001) Hierarchical patterns of global human Y-chromosome diversity. Molecular Biology and Evolution 18, Hanotte O., Bradley D.G., Ochieng J.W., Verjee Y., Hill E.W. & Rege J.E. (2002) African pastoralism: genetic imprints of origins and migrations. Science 296, Hanotte O., Tawah C.L., Bradley D.G., Okomo M., Verjee Y., Ochieng J. & Rege J.E. (2000) Geographic distribution and frequency of a taurine Bos taurus and an indicine Bos indicus Y specific allele amongst sub-saharan African cattle breeds. Molecular Ecology 9, Hasegawa M., Kishino H. & Yano T. (1985) Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22, Hellborg L. & Ellegren H. (2003) Y chromosome conserved anchored tagged sequences (YCATS) for the analysis of mammalian male-specific DNA. Molecular Ecology 12, Hellborg L. & Ellegren H. (2004) Low levels of nucleotide diversity in mammalian Y chromosomes. Molecular Biology and Evolution 21, Hewitt G.M. (2001) Speciation, hybrid zones and phylogeography - or seeing genes in space and time. Molecular Ecology 10,

160 Referências Bibliográficas Hiendleder S., Lewalski H. & Janke A. (2008) Complete mitochondrial genomes of Bos taurus and Bos indicus provide new insights into intra-species variation, taxonomy and domestication. Cytogenetic and Genome Research 120, Hughes S.S. (2000) STRand Nucleic Acids Analysis Software University of California, Davis, CA, U.S.A. Huson D.H. & Bryant D. (2006) Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23, Jobling M.A. & Tyler-Smith C. (2003) The human Y chromosome: an evolutionary marker comes of age. Nature Reviews Genetics 4, Jordana J., Alexandrino P., Beja-Pereira A., Bessa I., Cañon J., Carretero J.M., Dunner S., Laloe D., Moazami-Goudarzi K., Sanchez A. & Ferrand N. (2003) Genetic structure of eighteen local south European beef cattle breeds by comparative F-statistics analysis. Journal of Animal Breeding and Genetics 120, Jorde L.B., Watkins W.S., Bamshad M.J., Dixon M.E., Ricker C.E., Seielstad M.T. & Batzer M.A. (2000) The distribution of human genetic diversity: a comparison of mitochondrial, autosomal, and Y-chromosome data. American Journal of Human Genetics 66, Kantanen J., Olsaker I., Holm L.E., Lien S., Vilkki J., Brusgaard K., Eythorsdottir E., Danell B. & Adalsteinsson S. (2000) Genetic diversity and population structure of 20 North European cattle breeds. Journal of Heredity 91, Kappes S.M., Keele J.W., Stone R.T., McGraw R.A., Sonstegard T.S., Smith T.P., Lopez-Corrales N.L. & Beattie C.W. (1997) A second-generation linkage map of the bovine genome. Genome Research 7, Kayser M., Caglia A., Corach D., et al. (1997) Evaluation of Y-chromosomal STRs: a multicenter study. International Journal of Legal Medicine 110, , Kayser M., Choi Y., van Oven M., Mona S., Brauer S., Trent R.J., Suarkia D., Schiefenhovel W. & Stoneking M. (2008) The impact of the Austronesian expansion: evidence from mtdna and Y chromosome diversity in the Admiralty Islands of Melanesia. Molecular Biology Evolution 25, Kayser M., Krawczak M., Excoffier L., Dieltjes P., Corach D., Pascali V., Gehrig C., Bernini L.F., Jespersen J., Bakker E., Roewer L. & de Knijff P. (2001) An extensive analysis of Y- chromosomal microsatellite haplotypes in globally dispersed human populations. American Journal of Human Genetics 68, Kim K.S., Yeo J.S. & Choi C.B. (2002) Genetic diversity of north-east Asian cattle based on microsatellite data. Animal Genetics 33,

161 Referências Bibliográficas Koskinen M.T. (2003) Individual assignment using microsatellite DNA reveals unambiguous breed identification in the domestic dog. Animal Genetics 34, Kumar P., Freeman A.R., Loftus R.T., Gaillard C., Fuller D.Q. & Bradley D.G. (2003) Admixture analysis of South Asian cattle. Heredity 91, Lahn B.T., Pearson N.M. & Jegalian K. (2001) The human Y chromosome, in the light of evolution. Nature Reviews Genetics 2, Lai S.J., Liu Y.P., Liu Y.X., Li X.W. & Yao Y.G. (2006) Genetic diversity and origin of Chinese cattle revealed by mtdna D-loop sequence variation. Molecular Phylogenetics and Evolution 38, Langella O. (1999) POPULATIONS. CNRS UPR9034, France. Larson G., Albarella U., Dobney K., et al. (2007) Ancient DNA, pig domestication, and the spread of the Neolithic into Europe. Proceedings of the National Academy of Sciences of the United States of America 104, Lawson Handley L.J., Byrne K., Santucci F., Townsend S., Taylor M., Bruford M.W. & Hewitt G.M. (2007) Genetic structure of European sheep breeds. Heredity 99, Leite J.V. & Dantas R.V. (2000) Cachena. In: Catálogo de raças autóctones de Castela e Leão (Espanha) - Região Norte de Portugal: Espécies bovina e equina (ed. by Garcia EY), pp Fundação Rei Afonso Henriques, Salamanca, Spain. Lenstra J.A. & Econogene (2008) What's in a breed? Criteria for conservation. In: ESF Workshop: Diversity, selection and adaptation in wildlife and livestock - molecular approaches, Salzburg. Leroy G., Verrier E., Meriaux J.C. & Rognon X. (2009) Genetic diversity of dog breeds: between-breed diversity, breed assignation and conservation approaches. Animal Genetics. Li M.H., Zerabruk M., Vangen O., Olsaker I. & Kantanen J. (2007) Reduced genetic structure of north Ethiopian cattle revealed by Y-chromosome analysis. Heredity 98, Lindgren G., Backstrom N., Swinburne J., Hellborg L., Einarsson A., Sandberg K., Cothran G., Vila C., Binns M. & Ellegren H. (2004) Limited number of patrilines in horse domestication. Nature Genetics 36, Lipinski M.J., Froenicke L., Baysac K.C., Billings N.C., Leutenegger C.M., Levy A.M., Longeri M., Niini T., Ozpinar H., Slater M.R., Pedersen N.C. & Lyons L.A. (2008) The ascent of cat breeds: genetic evaluations of breeds and worldwide random-bred populations. Genomics 91, Liron J.P., Bravi C.M., Mirol P.M., Peral-Garcia P. & Giovambattista G. (2006a) African matrilineages in American Creole cattle: evidence of two independent continental sources. Animal Genetics 37,

162 Referências Bibliográficas Liron J.P., Peral-Garcia P. & Giovambattista G. (2006b) Genetic characterization of Argentine and Bolivian Creole cattle breeds assessed through microsatellites. Journal of Heredity 97, Liu W.S., Beattie C.W. & Ponce de Leon F.A. (2003) Bovine Y chromosome microsatellite polymorphisms. Cytogenetic Genome Research 102, Liu W.S., Mariani P., Beattie C.W., Alexander L.J. & Ponce De Leon F.A. (2002) A radiation hybrid map for the bovine Y Chromosome. Mammalian Genome 13, Loftus R.T., Ertugrul O., Harba A.H., El-Barody M.A., MacHugh D.E., Park S.D. & Bradley D.G. (1999) A microsatellite survey of cattle from a centre of origin: the Near East. Molecular Ecology 8, Loftus R.T., MacHugh D.E., Bradley D.G., Sharp P.M. & Cunningham P. (1994) Evidence for two independent domestications of cattle. Proceedings of the National Academy of Sciences of the United States of America 91, Luikart G., Gielly L., Excoffier L., Vigne J.D., Bouvet J. & Taberlet P. (2001) Multiple maternal origins and weak phylogeographic structure in domestic goats. Proceedings of the National Academy of Sciences of the United States of America 98, Machado M.A. (2000) Galega/Minhota In: Catálogo de raças autóctones de Castela e Leão (Espanha) - Região Norte de Portugal: Espécies bovina e equina (ed. by Garcia EY), pp Fundação Rei Afonso Henriques, Salamanca, Spain. MacHugh D.E. (1996) Molecular biogeography and genetic structure of domesticated cattle. In: Department of Genetics, Trinity College. University of Dublin, Dublin. MacHugh D.E., Loftus R.T., Cunningham P. & Bradley D.G. (1998) Genetic structure of seven European cattle breeds assessed using 20 microsatellite markers. Animal Genetics 29, MacHugh D.E., Shriver M.D., Loftus R.T., Cunningham P. & Bradley D.G. (1997) Microsatellite DNA variation and the evolution, domestication and phylogeography of taurine and zebu cattle (Bos taurus and Bos indicus). Genetics 146, MacHugh D.E., Troy C.S., McCormick F., Olsaker I., Eythorsdottir E. & Bradley D.G. (1999) Early medieval cattle remains from a Scandinavian settlement in Dublin: genetic analysis and comparison with extant breeds. Philosophical transactions of the Royal Society of London. Series B, Biological Sciences 354, ; discussion -9. Magee D.A., Meghen C., Harrison S., Troy C.S., Cymbron T., Gaillard C., Morrow A., Maillard J.C. & Bradley D.G. (2002) A partial african ancestry for the creole cattle populations of the Caribbean. Journal of Heredity 93,

163 Referências Bibliográficas Manel S., Berthier P. & Luikart G. (2002) Detecting wildlife poaching: Identifying the origin of individuals with Bayesian Assignment tests and multilocus genotypes. Conservation Biology 16, Manel S., Gaggiotti O.E. & Waples R.S. (2005) Assignment methods: matching biological questions with appropriate techniques. Trends in Ecology and Evolution 20, Mannen H., Kohno M., Nagata Y., Tsuji S., Bradley D.G., Yeo J.S., Nyamsamba D., Zagdsuren Y., Yokohama M., Nomura K. & Amano T. (2004) Independent mitochondrial origin and historical genetic differentiation in North Eastern Asian cattle. Molecular Phylogenetics and Evolution 32, Mariante A.S., Mcmanus C. & Mendonça J.F. (2003) Country report on the state of Animal genetic resources - Brazil. EMBRAPA - Genetic Resources and Biotechnology, Food and Agriculture Organization, Brasilia, Brazil. Martin-Burriel I., García-Muro E. & Zaragoza P. (1999) Genetic diversity analysis of six Spanish native cattle breeds using microsatellites. Animal Genetics 30, Martinez A.M., Calderon J., Camacho E., Rico C., Vega-Pla J.L. & Delgado J.V. (2005) Genetic characterization of the Mostrenca cattle with microsatellites. Archivos de Zootecnia 54, Mateus J.C., Eding H., Penedo M.C. & Rangel-Figueiredo M.T. (2004a) Contributions of Portuguese cattle breeds to genetic diversity using marker-estimated kinships. Animal Genetics 35, Mateus J.C., Penedo M.C., Alves V.C., Ramos M. & Rangel-Figueiredo T. (2004b) Genetic diversity and differentiation in Portuguese cattle breeds using microsatellites. Animal Genetics 35, Maudet C. (2001) Diversité et caractérisation génétique des races bovines et caprines originaires de la région Rhône-Alpes. In: Laboratoire de Biologie des Populations d'altitude de Grenoble, p Université Joseph Fourier, Grenoble, France. Maudet C., Luikart G. & Taberlet P. (2002) Genetic diversity and assignment tests among seven French cattle breeds based on microsatellite DNA analysis. Journal of Animal Science 80, Meadows J.R., Hanotte O., Drogemuller C., Calvo J., Godfrey R., Coltman D., Maddox J.F., Marzanov N., Kantanen J. & Kijas J.W. (2006) Globally dispersed Y chromosomal haplotypes in wild and domestic sheep. Animal Genetics 37,

164 Referências Bibliográficas Megens H.J., Crooijmans R.P., San Cristobal M., Hui X., Li N. & Groenen M.A. (2008) Biodiversity of pig breeds from China and Europe estimated from pooled DNA samples: differences in microsatellite variation between two areas of domestication. Genetics Selection and Evolution 40, Meirelles F.V., Rosa A.J.M., Lobo R.B., Garcia J.M., Smith L.C. & Duarte F.A.M. (1999) Is the American Zebu really Bos indicus? Genetics and Molecular Biology 22, Miretti M.M., Dunner S., Naves M., Contel E.P. & Ferro J.A. (2004) Predominant African-derived mtdna in Caribbean and Brazilian Creole cattle is also found in Spanish cattle (Bos taurus). Journal of Heredity 95, Miretti M.M., Pereira H.A., Jr., Poli M.A., Contel E.P. & Ferro J.A. (2002) African-derived mitochondria in South American native cattle breeds (Bos taurus): evidence of a new taurine mitochondrial lineage. Journal of Heredity 93, Mirol P.M., Giovambattista G., Liron J.P. & Dulout F.N. (2003) African and European mitochondrial haplotypes in South American Creole cattle. Heredity 91, Moioli B., Napolitano F. & Catillo G. (2004) Genetic diversity between Piedmontese, Maremmana, and Podolica cattle breeds. Journal of Heredity 95, Negrini R., Milanesi E., Colli L., Pellecchia M., Nicoloso L., Crepaldi P., Lenstra J.A. & Ajmone-Marsan P. (2007) Breed assignment of Italian cattle using biallelic AFLP markers. Animal Genetics 38, Nei M. (1987) Molecular Evolutionary Genetics. Columbia University Press, New York, NY, USA. Ollivier L. & Foulley J.L. (2005) Aggregate diversity: new approach combining within- and betweenbreed genetic diversity. Livestock Production Science 95, Peakall R. & Smouse P.E. (2006) Genalex 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6, Pellecchia M., Negrini R., Colli L., Patrini M., Milanesi E., Achilli A., Bertorelle G., Cavalli-Sforza L.L., Piazza A., Torroni A. & Ajmone-Marsan P. (2007) The mystery of Etruscan origins: novel clues from Bos taurus mitochondrial DNA. Proceedings of the Royal Society of London, Series B, Biological Sciences 274, Peter C., Bruford M., Perez T., Dalamitra S., Hewitt G. & Erhardt G. (2007) Genetic diversity and subdivision of 57 European and Middle-Eastern sheep breeds. Animal Genetics 38, Pires A.E., Amorim I.R., Ginja C., Gomes M., Godinho I., Simões F., Oom M., Petrucci-Fonseca F., Matos J. & Bruford M.W. (2009) Molecular structure in peripheral dog breeds: Portuguese native breeds as a case study. Animal Genetics 40,

165 Referências Bibliográficas Piyasatian N. & Kinghorn B.P. (2003) Balancing genetic diversity, genetic merit and population viability in conservation programmes. Journal of Animal Breeding and Genetics 120, Posada D. & Crandall K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics 14, Posada D. & Crandall K.A. (2001) Selecting the best-fit model of nucleotide substitution. Systematics Biology 50, Primo A.T. (1992) El ganado bovino Iberico en las Americas: 500 anos despues. Archivos de Zootecnia 41, Primo A.T. (2004) América: conquista e colonização. Movimento, Porto Alegre, Brazil. Pritchard J.K., Stephens M. & Donnelly P. (2000) Inference of population structure using multilocus genotype data. Genetics 155, Quiroz J. (2007) Caracterización genética de los bovinos Criollos Mexicanos y su relación con otras poblaciones. Universidade de Córdoba, Córdoba, España. Ralo A. & Guerreiro A. (1981) Raças exóticas e cruzamentos. In: Bovinos em Portugal (ed. by Rodrigos A). Direcção Geral dos Serviços Veterinários, Lisboa. Randi E., Pierpaoli M., Beaumont M., Ragni B. & Sforzi A. (2001) Genetic identification of wild and domestic cats (Felis silvestris) and their hybrids using Bayesian clustering methods. Molecular Biology and Evolution 18, Raymond M. & Rousset F. (2003) GENEPOP: population genetics software for exact tests and ecumenicism. Renfrew C. (2001) From molecular genetics to Archaeogenetics. Proceedings of the National Academy of Sciences of the United States of America 98, Rodero A., Delgado J.V. & Rodero E. (1992) Primitive Andalusian livestock and their implications in the discovery of America. Archivos de Zootecnia 41, Roewer L., Croucher P.J., Willuweit S., Lu T.T., Kayser M., Lessig R., de Knijff P., Jobling M.A., Tyler- Smith C. & Krawczak M. (2005) Signature of recent historical events in the European Y- chromosomal STR haplotype distribution. Human Genetics 116, Roewer L., Krawczak M., Willuweit S., et al. (2001) Online reference database of European Y- chromosomal short tandem repeat (STR) haplotypes. Forensic Science International 118, Rosenberg N.A., Burke T., Elo K., Feldman M.W., Freidlin P.J., Groenen M.A., Hillel J., Maki-Tanila A., Tixier-Boichard M., Vignal A., Wimmers K. & Weigend S. (2001) Empirical evaluation of genetic clustering methods using multilocus genotypes from 20 chicken breeds. Genetics 159,

166 Referências Bibliográficas Rouse J.E. (1970) World cattle. University of Oklahoma Press: Norman, U.S.A. Rouse J.E. (1977) The Criollo: Spanish cattle in the Americas. NORMAN, University of Oklahoma Press, U.S.A. Russell N.D., Rios J., Erosa G., Remmenga M.D. & Hawkins D.E. (2000) Genetic differentiation among geographically isolated populations of Criollo cattle and their divergence from other Bos taurus breeds. Journal of Animal Science 78, Scherf B.D. (2000) World watch list for domestic animal diversity. Food and Agriculture Organisation of the United Nations, Rome, Italy. Schlotterer C. (2000) Evolutionary dynamics of microsatellite DNA. Chromosoma 109, Schlotterer C. (2004) The evolution of molecular markers - just a matter of fashion? Nature Reviews Genetics 5, Schneider S., Roessli D. & Excoffier L. (2000) Arlequin ver : A software for population genetics data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland. Skaletsky H., Kuroda-Kawaguchi T., Minx P.J., et al. (2003) The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423, Slatkin M. (1995) A measure of population subdivision based on microsatellite allele frequencies. Genetics 139, Sousa F.J.R. (2000) Mirandesa. In: Catálogo de raças autóctones de Castela e Leão (Espanha) - Região Norte de Portugal: I. Espécies bovina e equina (ed. by Garcia JEY), pp Fundação Rei Afonso Henriques, Salamanca, Spain. Sponenberg D.P. & Olson T.A. (1992) Colonial Spanish cattle in the USA: history and present status. Archivos de Zootecnia 41, Su B., Xiao C., Deka R., Seielstad M.T., Kangwanpong D., Xiao J., Lu D., Underhill P., Cavalli-Sforza L., Chakraborty R. & Jin L. (2000) Y chromosome haplotypes reveal prehistorical migrations to the Himalayas. Human Genetics 107, Sunnucks P. (2000) Efficient genetic markers for population biology. Trends in Ecology and Evolution 15, Svensson E. & Gotherstrom A. (2008) Temporal fluctuations of Y-chromosomal variation in Bos taurus. Biology Letters 4, Svensson E.M., Anderung C., Baubliene J., Persson P., Malmstrom H., Smith C., Vretemark M., Daugnora L. & Gotherstrom A. (2007) Tracing genetic change over time using nuclear SNPs in ancient and modern cattle. Animal Genetics 38, Taberlet P., Valentini A., Rezaei H.R., Naderi S., Pompanon F., Negrini R. & Ajmone-Marsan P. (2008) Are cattle, sheep, and goats endangered species? Molecular Ecology 17,

167 Referências Bibliográficas Tajima F. (1983) Evolutionary relationship of DNA sequences in finite populations. Genetics 105, Tamura K. & Nei M. (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10, Tapio I., Varv S., Bennewitz J., Maleviciute J., Fimland E., Grislis Z., Meuwissen T.H., Miceikiene I., Olsaker I., Viinalass H., Vilkki J. & Kantanen J. (2006a) Prioritization for conservation of northern European cattle breeds based on analysis of microsatellite data. Conservation Biology 20, Tapio M. & Grigaliunaite I. (2003) Use of mitochondrial DNA as a genetic marker in domesticated mammals. Ekologija (Vilnius) 1, Tapio M., Marzanov N., Ozerov M., Cinkulov M., Gonzarenko G., Kiselyova T., Murawski M., Viinalass H. & Kantanen J. (2006b) Sheep mitochondrial DNA variation in European, Caucasian, and Central Asian areas. Molecular Biology and Evolution 23, Troy C.S., MacHugh D.E., Bailey J.F., Magee D.A., Loftus R.T., Cunningham P., Chamberlain A.T., Sykes B.C. & Bradley D.G. (2001) Genetic evidence for Near-Eastern origins of European cattle. Nature 410, Underhill P.A., Shen P., Lin A.A., et al. (2000) Y chromosome sequence variation and the history of human populations. Nature Genetics 26, Vaiman D., Mercier D., Moazami-Goudarzi K., Eggen A., Ciampolini R., Lepingle A., Velmala R., Kaukinen J., Varvio S.L., Martin P. & et al. (1994) A set of 99 cattle microsatellites: characterization, synteny mapping, and polymorphism. Mammalian Genome 5, Verkaar E.L., Nijman I.J., Beeke M., Hanekamp E. & Lenstra J.A. (2004) Maternal and paternal lineages in cross-breeding bovine species. Has wisent a hybrid origin? Molecular Biology and Evolution 21, Verkaar E.L., Vervaecke H., Roden C., Romero Mendoza L., Barwegen M.W., Susilawati T., Nijman I.J. & Lenstra J.A. (2003) Paternally inherited markers in bovine hybrid populations. Heredity 91, Vicente A.A., Carolino M.I., Sousa M.C., Ginja C., Silva F.S., Martinez A.M., Vega-Pla J.L., Carolino N. & Gama L.T. (2008) Genetic diversity in native and commercial breeds of pigs in Portugal assessed by microsatellites. Journal of Animal Science 86, Wan Q.H., Wu H., Fujihara T. & Fang S.G. (2004) Which genetic marker for which conservation genetics issue? Electrophoresis 25,

168 Referências Bibliográficas Weir B.S. & Cockerham C.C. (1984) Estimating F-statistics for the analysis of population structure. Evolution 38, Weitzman M.L. (1992) On diversity. The Quarterly Journal of Economics, Weitzman M.L. (1998) The Noah's ark problem. Econometrica 66, Wendorf F. & Schild R. (1994) Are the early Holocene cattle in the Eastern Sahara domestic or wild? Evolutionary Antropology 3, White D.J., Wolff J.N., Pierson M. & Gemmell N.J. (2008) Revealing the hidden complexities of mtdna inheritance. Molecular Ecology 17, Zeder M.A. (2008) Domestication and early agriculture in the Mediterranean Basin: Origins, diffusion, and impact. Proceedings of the National Academy of Sciences of the United States of America 105, Zeder M.A., Emshwiller E., Smith B.D. & Bradley D.G. (2006) Documenting domestication: the intersection of genetics and archaeology. Trends in Genetics 22, Zhang D.X. & Hewitt G.M. (2003) Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology 12, Zhang G.X., Wang Z.G., Chen W.S., Wu C.X., Han X., Chang H., Zan L.S., Li R.L., Wang J.H., Song W.T., Xu G.F., Yang H.J. & Luo Y.F. (2007) Genetic diversity and population structure of indigenous yellow cattle breeds of China using 30 microsatellite markers. Animal Genetics 38, Zilhão J. (2001) Radiocarbon evidence for maritime pioneer colonization at the origins of farming in west Mediterranean Europe. Proceedings of the National Academy of Sciences of the United States of America 98,

169 ANEXOS Anexo I. Figuras e Tabelas suplementares ao Capítulo 2

170

171 Anexo I. Figuras e Tabelas suplementares ao Capítulo 2 a) b) 151

172 Anexo I Figuras e Tabelas Suplementares ao Capítulo 2 c) d) 152

173 Anexo I Figuras e Tabelas Suplementares ao Capítulo 2 Figure S2.1. Sequence alignments and SNPs positions for the 5 intronic Y chromosome regions analyzed in our study (Genbank accession numbers EU to EU547277) compared to reference Genbank sequences for each gene: a) DDX3Y gene intron 1, C/T SNP at position 196 and (AT)8_10 STR at position 150; b) DDX3Y gene intron 7, C/T SNP at position 103; c) UTY gene intron 19, C/A SNP at position 25; d) ZFY gene human intron 9, C/T SNP at position 141; and e) ZFY gene human intron 10, C/T SNP at position 131 and GT indel at position (not detected in these animals, marked by box). C/T SNPs at positions 29 and 56 of AF were not found in our sequences. e) 153

174 Anexo I Figuras e Tabelas Suplementares ao Capítulo 2 Table S2.1. Primer sequences, T a, fluorescence label and references for Y chromosome STRs. Locus Name Primer sequence (5-3 ) T a (ºC) Label Reference BM861-F BM861-R DDX3Y1STR-F DDX3Y1STR-R INRA124-F INRA124-R INRA126-F INRA126-R INRA189-F INRA189-R UMN0103-F UMN0103-R UMN0307-F UMN0307-R UMN0504-F UMN0504-R UMN0920-F UMN0920-R UMN2001-F UMN2001-R UMN2303-F UMN2303-R UMN2404-F UMN2404-R UMN3008-F UMN3008-R TTGAGCCACCTGGAAAGC CAAGCGGTTGGTTCAGATG TGAACCACTAGGGAGGTCATC TTCCAATTTAGCTGTGGTTATCTG GATCTTTGCAACTGGTTTG CAGGACACAGGTCTGACAATG GTTGTTGCCTCTGCAGAGTAGG GACACTCTTTCTATTTTCAAGG TACACGCATGTCCTTGTTTCGG CTCTGCATCTGTCCTGGACTGG ACACAGAGTATTCACCTGAG ATTTACCTGGGTCAAAGCAC GATACAGCTGAGTGACTAAC GTGCAGACATCTGAGCTGTG AGGCCATCTGCATAGTGAAG TGCTGGACTGCTCATCTCTG GTTGAGGACTCTTGCATCTG CACAGGCCTAGAAGATTGAG TCAGGCAAGACTACTGGAGC TACCCTGGCGATTCTGCAA TACTTGCTTGAGACTTACTG TGTGAACACATCTGATTCTG GGTACAATTGAAAATATG TGTACCTACACTGATATGTT TTGTGGAGGACTATTCATGG TCTGGACTCGACAGGACACC 58 Ned Bishop et al. (1994) 58 Fam Götherström et al. (2005) 58 Vic Vaiman et al. (1994) 58 Fam Vaiman et al. (1994) 55 Fam Kappes et al. (1997) 58 Fam Liu et al. (2002) 58 Vic Liu et al. (2002) 58 Ned Liu et al. (2002) 55 Ned Liu et al. (2002) 55 Fam Liu et al. (2002) 58 Ned Liu et al. (2002) 58 Fam Liu et al. (2002) 58 Fam Liu et al. (2002) 154

175 Anexo II. Figuras e Tabelas suplementares ao Capítulo 3

176

177 Anexo II. Figuras e Tabelas suplementares ao Capítulo 3 157

178 Table S3.1. Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

179 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

180 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

181 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

182 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

183 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

184 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

185 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

186 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

187 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

188 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

189 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

190 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

191 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

192 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

193 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

194 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

195 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

196 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

197 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

198 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

199 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

200 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

201 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

202 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

203 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

204 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

205 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

206 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

207 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

208 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

209 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

210 Table S3.1 (cont.). Sequence variation in the control region of 569 cattle samples aligned with the Bos taurus reference sequence (Accession number V00654). A total of 311 haplotypes were identified (only variable nt shown). Dashes (-) indicate gaps and dots (.) denote identities with the reference sequence. Haplotype frequency (N) and the respective haplogroup are also shown.

211 Table S.3.2. Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

212 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

213 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

214 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

215 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

216 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

217 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

218 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

219 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

220 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

221 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

222 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

223 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

224 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

225 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

226 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

227 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

228 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

229 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

230 Table S.3.2 (cont.). Frequency of the 311 mtdna haplotypes in each population of the 6 geographic groups.

231 Table S3.3. Pairwise F ST values between populations for mtdna sequences. Significant values (P < 0.05) are shown in bold.

232 Table S3.3 (cont.). Pairwise F ST values between populations for mtdna sequences. Significant values (P < 0.05) are shown in bold.

233 Anexo II Figuras e Tabelas Suplementares ao Capítulo 3 Table S3.4. AMOVA results for mtdna. N Variance components (%) F statistics Geographic Groups Iberia 13 Atlantic Islands 3 Creoles 9 Zebu 2 United Kingdom 5 Inland Europe 3 Among groups Among breeds within groups Among individuals Overall Fct (P) Fst (P) Fsc (P) (<0.05) (<0.0001) (<0.0001) mtdna Haplogroups a European T2/T3 6 Iberian Q 1 African T1/T1a 6 African derived Creole (AA) 2 N Variance components (%) F statistics Among Among regions Among groups within individuals Fct (P) Fst (P) Fsc (P) groups Overall (< ) (<0.0001) (<0.0001) a Four haplotype groups were considered: European T, T2, and T3 mtdna sequences grouped by geographic region (Iberia, Atlantic Islands, Creoles, Zebu, United Kingdom and Inland Europe); Q haplotype found only in Iberia; African T1 and T1a mtdna sequences grouped by the six geographic regions described above; Creole AA mtdna sequences. 213

234 Anexo II Figuras e Tabelas Suplementares ao Capítulo 3 Table S3.4. (cont.). AMOVA results for Y-haplotypes. Geographic groups N Iberia 13 Atlantic Islands 3 Creoles 7 Zebu 2 United Kingdom 5 Inland Europe 3 Among groups Variance components (%) Among breeds within groups Overall F statistics Within breeds F CT (P) F ST (P) F SC (P) (<0.001) (<0.0001) (<0.0001) 214

235 Anexo II Figuras e Tabelas Suplementares ao Capítulo 3 Table S3.5. Reference mtdna sequences used in the phylogenetic analysis. Group Origin (Breed) Accession Number Reference T1 Italy (Chianina) EU (Achilli et al. 2008) T1 Butana (African B. indicus) L (Loftus et al. 1994) T1 Butana (African B. indicus) L (Loftus et al. 1994) T1a Italy (Podolian) EU (Achilli et al. 2008) T1a White Fulani (African B. indicus) L (Loftus et al. 1994) T1a White Fulani (African B. indicus) L (Loftus et al. 1994) T1a Kenana (African B. indicus) L (Loftus et al. 1994) T1a Kenana (African B. indicus) L (Loftus et al. 1994) T1a N'Dama (African B. taurus) L (Loftus et al. 1994) T1a N'Dama (African B. taurus) L (Loftus et al. 1994) T2 Korean cattle DQ Shin, H. D. & Kim, L.H. (unpublished) T3 Fleckvieh AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Simmental AF (Hiendleder et al. 2008) T3 Holstein AF (Hiendleder et al. 2008) T3 Holstein AF (Hiendleder et al. 2008) T3 Holstein AF (Hiendleder et al. 2008) T3 China (Brahman) DQ Qu,K.-X et al (in press) T3 China (Brahman) DQ Qu,K.-X et al (in press) T3 Angus L (Loftus et al. 1994) T3 Angus L (Loftus et al. 1994) T3 Charolais L (Loftus et al. 1994) T3 Charolais L (Loftus et al. 1994) T3 Friesian L (Loftus et al. 1994) T3 Friesian L (Loftus et al. 1994) T3 Hereford L (Loftus et al. 1994) T3 Hereford L (Loftus et al. 1994) T3 Jersey L (Loftus et al. 1994) T3 Jersey L (Loftus et al. 1994) T3 Simmental L (Loftus et al. 1994) T3 Simmental L (Loftus et al. 1994) T3 V00654 (Anderson et al. 1982) T3a Korean cattle DQ Shin, H. D. & Kim, L.H. (unpublished) T4 Korea (Beef cattle) DQ Shin, H. D. & Kim, L.H. (unpublished) T5 Iraq (Iraqi breed) EU (Achilli et al. 2008) T123 Italy (Cabannina) EU (Achilli et al. 2008) Q Italy (Cabannina) EU (Achilli et al. 2008) Q Italy (Cabannina) EU (Achilli et al. 2008) P Korea (Beef cattle) DQ Shin, H. D. & Kim, L.H. (unpublished) I1 Iraq (Iraqi breed) EU (Achilli et al. 2008) I1 India Hariana (B. indicus) L (Loftus et al. 1994) I1 India Hariana (B. indicus) L (Loftus et al. 1994) I1 India Sahiwal (B. indicus) L (Loftus et al. 1994) I1 India Tharparkar (B. indicus) L (Loftus et al. 1994) I1 India Tharparkar (B. indicus) L (Loftus et al. 1994) I1 Nellore (B. indicus) NC_ Miretti, M.M. et al (unpublished) I2 Sri Lanka Zwergzebu (B. indicus) AF (Hiendleder et al. 2008) I2 Iraq (Iraqi breed) EU (Achilli et al. 2008) I2 India Sahiwal (B. indicus) L (Loftus et al. 1994) 215

236 Table S3.6. Pairwise F ST values between populations for Y-haplotypes. Non significant values (P > 0.05) are shown in bold.

237 Table S3.6 (cont.). Pairwise F ST values between populations for Y-haplotypes. Non significant values (P > 0.05) are shown in bold.

238

239 Anexo III. Figuras e Tabelas suplementares ao Capítulo 4

240

241 Anexo III. Figuras e Tabelas suplementares ao Capítulo 4 Table S4.1. STR primer sequences, chromosome location, repeat motif, reference, allele range, and fluorescence label. Allele range, total number of alleles (TNA), allelic richness (R t ), observed (H o ) and expected (H e ) heterozygosities, and F-statistics are shown for each locus across 16 breeds. 221

242 Anexo III Figuras e Tabelas Suplementares ao Capítulo 4 Table S4.1 (cont.). STR primer sequences, chromosome location, repeat motif, reference, allele range, and fluorescence label. Allele range, total number of alleles (TNA), allelic richness (R t ), observed (H o ) and expected (H e ) heterozygosities, and F-statistics are shown for each locus across 16 breeds. 222

243 Anexos III Figuras e Tabelas Suplementares ao Capítulo 4 Table S4.1 (cont.). STR primer sequences, chromosome location, repeat motif, reference, allele range, and fluorescence label. Allele range, total number of alleles (TNA), allelic richness (R t ), observed (H o ) and expected (H e ) heterozygosities, and F-statistics are shown for each locus across 16 breeds. 223

244 Anexo III Figuras e Tabelas Suplementares ao Capítulo 4 Table S4.1 (cont.). STR primer sequences, chromosome location, repeat motif, reference, allele range, and fluorescence label. Allele range, total number of alleles (TNA), allelic richness (R t ), observed (H o ) and expected (H e ) heterozygosities, and F-statistics are shown for each locus across 16 breeds. 224

245 Table S4.2. Pairwise population F st (below diagonal) and DA (above diagonal) values. Maximum and minimum values are shown in bold. Breed names Alentejana Arouquesa Barrosã Brava de Lide Cachena Charolais Friesian Garvonesa Limousin Marinhoa Maronesa Mertolenga Minhota Mirandesa Preta Ramo Grande F st values were all significant for P < 0.05 after standard Bonferroni correction.

246 Anexo III Figuras e Tabelas Suplementares ao Capítulo 4 Figure S4.1. Graphic depicting the distribution of et al. (2005). K estimated as described by Evanno 226

247 Anexo IV. Figuras e Tabelas suplementares ao Capítulo 5

248

249 Anexo IV. Figuras e Tabelas suplementares ao Capítulo 5

250 Table S5.1. Pairwise population F st (below diagonal) and DA (above diagonal) values.

251 Table S5.1 (cont.). Pairwise population F st (below diagonal) and DA (above diagonal) values.