Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h.

Tamanho: px
Começar a partir da página:

Download "Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h."

Transcrição

1 1 Nome: Curso: Nº 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h. As proteínas sensoras dos sistemas reguladores de dois components são usadas por bactérias para detectar e responder a alterações ambientais. A bactéria Pseudomonas aeruginosa PA14 tem pelo menos 60 dessas proteínas sensoras que contribuem para a sua enorme capacidade de adaptação a múltiplos ambientes incluindo o humano. Peixes da espécie Danio rerio são usadas como modelo de infecção para Pseudomonas pois estas bactérias são capazes de estabelecer infecções agudas causando a morte do animal. 1- Suponha que dispõe de mutantes por transposição em cada uma das 60 proteínas sensoras. Diga como pode avaliar o grau de virulência desses mutantes, descrevendo a experiência, incluindo o(s) controlo(s) e o tipo de resultados que espera obter. (1,0 valor) 2- Da experiência anterior identificou-se o gene kinb como sendo importante na virulência de Pseudomonas aeruginosa PA14. Sabendo que a sequência de nucleótidos do genoma deste organismo é conhecida, pode-se facilmente obter a sequência de nucleótidos e de aminoácidos de KinB. Explique como pode prever in silico a localização celular desta proteína bem como a existência de domínios conservados. (1,0 valor)

2 2 3- De seguida, pretende confirmar a atenuação da virulência do mutante de transposição para kinb, mas usando um mutante de eliminação. Para tal, pode usar o vector pk18mob (lacz +, mob +, canamicina R ) e a cassete aacc1 (gentamicina R ) para o construir. a) Descreva todos os passos para a clonagem, no vector indicado, das regiões flanqueantes do gene kinb e cassete de substituição. (1,5 valores) b) A transformação de P. aeruginosa PA14 com a molécula de DNA recombinante preparada em a) pode ser efectuada por electrotransformação. Descreva o princípio teórico desta técnica e o modo como faria a selecção das colónias recombinantes. (1,0 valor)

3 3 c) Como poderá confirmar o mutante de eliminação para o gene kinb através do uso da técnica de hibridação de Southern? (2,0 valores) 4- Para confirmar que a atenuação da virulência do mutante de eliminação construído se deve exclusivamente à ausência deste gene, é necessário efectuar uma experiência de complementação in trans. a) A primeira decisão a tomar é a escolha de um vector de clonagem apropriado. Quais são as características que esse vector deverá conter atendendo a que pretende produzir a proteína KinB em P. aeruginosa? (1,0 valor)

4 b) Descreva a clonagem do gene kinb no vector referido em 4a). (1,5 valores) 4 c) Que experiência faria e qual o resultado que deve obter para demonstrar que o mutante de eliminação para kinb não apresenta qualquer outra mutação. (1,0 valor) 5- Sendo uma proteína sensora, KinB autofosforila num resíduo de histidina antes de efectuar a transdução de sinal para a proteína reguladora de resposta. Para confirmar que H385 é o alvo directo de autofosforilação, este aminoácido foi substituído por uma alanina usando técnicas de mutagénese dirigida. Refira qual o material biológico necessário e quais os principais passos do procedimento experimental até à correcta identificação do gene alterado. (2,0 valores)

5 5 6- Testou-se o efeito da mutação do gene kinb na produção do pigmento piocianina e de elastase. Os resultados encontram-se nos seguintes gráficos: a) Qual a importância da proteína KinB em ambos os fenótipos testados? (1,0 valor) b) Qual o efeito da modificação do resíduo de histidina H385A de KinB em ambos os fenótipos? (1,0 valor) 7- Seleccione a resposta correcta através de um círculo (0,5 valores cada): 1- No processo de inactivação por inserção: a) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica inactivo e as colónias de E. coli mantêm-se brancas b) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica inactivo e as colónias de E. coli tornam-se azuis c) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica activo e as colónias de E. coli mantêm-se brancas d) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica activo e as colónias de E. coli tornam-se azuis

6 2- A função da transcriptase reversa na clonagem de DNA eucariótico em células procarióticas é: a) Sintetizar cdna a partir de mrna eucariótico b) Processar o precursor do mrna c) Sintetizar mrna a partir de DNA d) Sintetizar DNA bacteriano a partir de DNA eucariótico 6 3- Para que uma sonda de DNA hibride é necessário que: a) As cadeias de DNA alvo sejam homólogas, tendo regiões com sequências iguais ou semelhantes b) As cadeias de DNA alvo sejam fragmentadas por uma exonuclease c) As cadeias de DNA alvo não sejam homólogas d) O DNA alvo seja complementar ao RNA 4- Durante a reacção de PCR, a Taq polimerase inicia a síntese de DNA: a) No final das cadeias simples de RNA b) Em qualquer cadeia aberta c) Em iniciadores de RNA ligados ao gene de interesse d) Em iniciadores de DNA ligados ao gene de interesse 5- Para que a amplificação de DNA ocorra qual dos seguintes compostos tem de estar presente? a) Ribonucleótidos b) Iniciadores de RNA c) Desoxinucleótidos d) Primase 6- Considere a sequência 5 ATGCCTGGACCTTAACGCGCCTAGGTATCTTGA3. Suponha que necessita de iniciadores 10-mer para PCR. Essas sequências serão: a) ATGCCTGGAC e GGTATCTTGA b) ATGCCTGGAC e TCAAGATACC c) TACGGACCTG e TCAAGATACC d) ATGCCTGGAC e CCATAGAACT 7- Uma bactéria capaz de obter DNA livre a partir do meio externo diz-se: a) Competente b) Lisogénica c) Infectada d) Incompetente 8- O gene da transposase codifica para uma enzima que: a) Facilita a recombinação homóloga b) Facilita a replicação viral dentro de um genoma c) Facilita a integração em determinados locais de elementos transponíveis d) Facilita a complementação homóloga 9- Os elementos P são transposões de: a) Drosophila melanogaster b) Caenorhabditis elegans c) Escherichia coli d) Drosophila elementi 10) Pequenos fragmentos de DNA que codificam enzimas capazes de cortar esse segmento de DNA e de o introduzir noutro local denominam-se: a) Plasmídeos b) Nucleóides c) Transposões d) DNA topoisomerases

7 7 11) O RNA de interferência é um mecanismo para o silenciamento da expressão de genes ao nível da: a) Replicação b) Transcrição c) Tradução d) Pós-transcrição, mas pré-tradução 12) A proteína que actua como uma endonuclease nos passos iniciais do processamento dos precursores de RNAi denomina-se: a) Phaser b) Sizer c) Dicer d) RNase Respostas Adicionais

2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min

2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min Nome: Curso: Nº 2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min Bordetella pertussis é o agente causador da tosse convulsa, uma doença respiratória humana altamente infecciosa e transmissível.

Leia mais

Bases e aplicações. da tecnologia do DNA recombinante

Bases e aplicações. da tecnologia do DNA recombinante Bases e aplicações da tecnologia do DNA recombinante Por quê entender a Tecnologia do DNA recombinante? y y Doenças: diagnóstico, prognóstico e tratamento Compreensão dos mecanismos biológicos y y y organismos

Leia mais

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial.

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial. GENÉTICA BACTERIANA GENOMA BACTERIANO Cromossoma (nucleóide) Informação genética essencial. Ácido desoxirribonucléico (DNA). Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello

Leia mais

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e Perguntas para o roteiro de aula Professora: Drª Marilda S. Gonçalves Propriedades físico-químicas dos ácidos nucléicos 1) Descreva as principais características estruturais gerais das moléculas de DNA

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Seleção de clones e screening de bibliotecas genômicas

Seleção de clones e screening de bibliotecas genômicas UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Seleção de clones e screening de bibliotecas genômicas Prof. Dr. Silas

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

Genética Bacteriana. Julliane Dutra Medeiros

Genética Bacteriana. Julliane Dutra Medeiros Genética Bacteriana Julliane Dutra Medeiros 1 A célula bacteriana 2 Relembrando conceitos... Genoma informação genética de uma célula (cromossomo e plasmídeos) Estruturas contendo DNA que transportam fisicamente

Leia mais

REGULAÇÃO DO MATERIAL GENÉTICO

REGULAÇÃO DO MATERIAL GENÉTICO REGULAÇÃO DO MATERIAL GENÉTICO Prof. Ana Rita Rainho Controlo da actividade celular Se todas as células de um organismo possuem a mesma informação genética, qual o mecanismo que permite às células diferenciar-se?

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste Nome do Aluno: Nº: Curso: BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste 11/01/2012 (Duração: 1,5 h) Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Relembrando: Material genético

Relembrando: Material genético REGULAÇÃO GÉNICA Relembrando: Material genético O MATERIAL GENÉTICO é o suporte físico do conjunto de padrões de informações hereditárias, transmitidas ao longo das gerações. GENE é a unidade de informação

Leia mais

Lição nº1. 17 (T1) e 18 (T2) de Setembro

Lição nº1. 17 (T1) e 18 (T2) de Setembro GENÉTICA e BIOLOGIA MOLECULAR (componente Biologia Molecular) DBV- Secção de Genética e Dinâmica de Populações Faculdade de Ciências de Lisboa Ano lectivo de 07/08 SUMÁRIOS Lição nº1 17 (T1) e 18 (T2)

Leia mais

Departamento de Genética Nilce M. Martinez Rossi

Departamento de Genética Nilce M. Martinez Rossi ORGANIZAÇÃO E FUNCIONALIDADE DO GENOMA HUMANO Departamento de Genética Nilce M. Martinez Rossi Fenótipo = GENÓTIPO + Ambiente O que é o genoma? Projetos Genoma Genoma: sequencia de DNA de todos os cromossomos

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética.

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética. UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética Biologia 12º ano UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Vírus, um grupo a parte.

Vírus, um grupo a parte. Vírus, um grupo a parte. Vírus, um grupo a parte. Estrutura típica de um vírus: 01)Observe a figura a seguir, onde está representado, esquematicamente, o vírus HIV e analise as proposições quanto à sua

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

7.012 Conjunto de Problemas 4

7.012 Conjunto de Problemas 4 Nome Seção 7.012 Conjunto de Problemas 4 Pergunta 1 Você está estudando a síntese do aminoácido triptofano em bactérias. As enzimas TrpA, TrpB, TrpC, TrpD, TrpE e AroH são essenciais para a síntese desse

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin Organização Gênica de Eucariotos Prof. Odir A. Dellagostin Classificação dos seres vivos Domínio Eukarya Reinos Protistas (protozoários e leveduras) Fungi (fungos) Plantae (vegetais) Animalia (animais)

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

1. O QUE É A ENGENHARIA GENÉTICA?

1. O QUE É A ENGENHARIA GENÉTICA? 1. O QUE É A ENGENHARIA GENÉTICA? Termos sinónimos: Manipulação genética, clonagem de genes, tecnologia do DNA recombinante, modificação genética, nova genética. Áreas de acção: Investigação básica - função

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

Actividade prática: Constrói os teus Kits de Genética!

Actividade prática: Constrói os teus Kits de Genética! Actividade prática: Constrói os teus Kits de Genética! Mais uma vez vais vestir a tua bata de cientista e investigador e preparar o teu dia a dia no laboratório. Hoje é um dia especial, vais receber a

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

PS 4 Soluções Pergunta 1

PS 4 Soluções Pergunta 1 PS 4 Soluções Pergunta 1 Você está estudando a síntese do aminoácido triptofano em bactérias. As enzimas TrpA, TrpB, TrpC, TrpD, TrpE e AroH são essenciais para a síntese desse aminoácido. Bactérias do

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

Prof. Msc. Cleysyvan Macedo

Prof. Msc. Cleysyvan Macedo Prof. Msc. Cleysyvan Macedo PRINCIPAIS CARACTERÍSTICAS DOS VÍRUS: Não possui estruturas celulares (membrana plasmática, citoplasma, etc.). São formado basicamente por uma cápsula protéica denominada capsômero

Leia mais

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula.

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula. Pergunta 1 Parte A Você está estudando um receptor chamado Receptor do Fator de Tamanho ou SF-R em um eucariota haplóide. Abaixo encontra-se um diagrama esquemático da proteína SF-R: A fim de ser localizado

Leia mais

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I E S C O L A S E C U N D Á R I A A N T Ó N I O S É R G I O 10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o 2 7-03- 201 4 GRUPO I 1 1 Os seres vivos

Leia mais

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs Clonagem Molecular Fragmentos de DNA de interesse Vetores: Plasmídeos Fagos Cosmídeos BACs/ YACs Hospedeiros: E.coli Levedura Células vegetais Células animais Enzimas: Enzimas de restrição DNA polimerases

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Modificação da informação genética (II)

Modificação da informação genética (II) Modificação da informação genética (II) Principais mecanismos que geram variabilidade genética nas bactérias e contribuem para o processo de evolução:. Mutação. Transposição. Transferência de genes ( veiculada

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2014 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 05/05/2014 HORA 10.00H - 12.00H

Leia mais

MARCADORES MOLECULARES

MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais

Transposons. Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS

Transposons. Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS Emily Bruna Justino Transposons Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS Esta habilidade em se realocar é chamada

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA GENÉTICA É a ciência que estuda a hereditariedade Estuda os gens, como eles transportam informações, são replicados e passados para as gerações subseqüentes de células ou transmitidos entre organismos

Leia mais

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B)

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) Para produzir 5mg de somatostatina, são necessários 500.000 cérebros de carneiro, ou por engenharia genética 7,5kg de E. coli com gene enxertado deste

Leia mais

Resumo - capítulo 7. Pedro Ivo Gomes de Faria

Resumo - capítulo 7. Pedro Ivo Gomes de Faria Resumo - capítulo 7 Pedro Ivo Gomes de Faria Sumário 1 Capítulo 7 - Tecnologia do DNA recombinante 2 1.1 Fragmentação, separação e sequenciamento de moléculas de DNA................................ 2 1.2

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA I - INTRODUÇÃO Atualmente é muito comum ouvirmos falar de clonagem em meios de comunicação que atingem o grande público. É também bastante comum assistirmos

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I Prof. Odir Dellagostin Woese 1978 3 domínios O QUE É UM GENE? Toda sequência nucleotídica necessária e suficiente para

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Transcrição: Síntese de RNA Tradução: Síntese Proteica

Transcrição: Síntese de RNA Tradução: Síntese Proteica Transcrição: Síntese de RNA Tradução: Síntese Proteica A estrutura química da molécula de RNA apresenta pequenas diferenças em relação ao DNA. http://www.nature.com/scitable/learning-path/theelaboration-of-the-central-dogma-701886#url

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO DISCIPLINA DE BIOLOGIA 4º Teste de Avaliação (V1) 12ºano Turma A e B TEMA: Património Genético e Imunidade Nome: Nº Classificação:, valores A professora: (Isabel

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 3. Multiplicação da célula de tabaco com o gene do vaga-lume.

1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 3. Multiplicação da célula de tabaco com o gene do vaga-lume. 01. Analise a figura a seguir, que representa um determinado experimento: 1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 2. Introdução do DNA em célula de tabaco. 3. Multiplicação

Leia mais

Fases do Ciclo Celular

Fases do Ciclo Celular Ciclo Celular Fases do Ciclo Celular Todas as células passam por um ciclo de vida que, assim como a vida de um organismo complexo, apresenta diferentes fases e é irreversível. Duração do ciclo celular

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Replicação dos Vírus. Células 26/04/2012. Ciclo celular. Vírus: não apresentam estrutura celular. ausência de metabolismo

Replicação dos Vírus. Células 26/04/2012. Ciclo celular. Vírus: não apresentam estrutura celular. ausência de metabolismo Replicação dos Vírus Profª Maria Luzia da Rosa e Silva Vírus: não apresentam estrutura celular ausência de metabolismo Entretanto, a produção de novas partículas (Replicação) Requer síntese de macromoléculas

Leia mais

Vírus - Caracterização Geral

Vírus - Caracterização Geral Noções de Vírus By Profª. Cynthia Vírus - Caracterização Geral Vírus = veneno ou fluído venenoso (Latim) Acelulares/ Partículas Infecciosas Composição química de nucleoproteínas (DNA ou RNA+Proteínas)

Leia mais

Universidade dos Açores Prova de Ingresso 2006

Universidade dos Açores Prova de Ingresso 2006 Universidade dos Açores Prova de Ingresso 2006 Nome:... I A vida, na sua multiforme diversidade, tem uma origem comum, se bem que complexa. A vida e o planeta onde ela nasceu formam um todo integrado,

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015

Transcrição do DNA. Dogma central. O fluxo da informação é unidirecional. Refutação definitiva da herança dos caracteres adquiridos 26/04/2015 Transcrição do DNA José Francisco Diogo da Silva Junior Mestrando CMANS/UECE Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos 1 A iniciação

Leia mais

Genética de Bactérias

Genética de Bactérias Genética de Bactérias Descrição de mutantes Mecanismos de recombinação Mapeamento de genes Considerações iniciais Microrganismos no contexto da Genética 1940 com Beadle & Tatum mutantes auxotróficos em

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

AU01. Aspectos Genéticos da Mitose e Meiose. Emanuele Cristina Pesenti. Doutoranda PPG-GEN

AU01. Aspectos Genéticos da Mitose e Meiose. Emanuele Cristina Pesenti. Doutoranda PPG-GEN AU01 Aspectos Genéticos da Mitose e Meiose Emanuele Cristina Pesenti Doutoranda PPG-GEN emanuelepesenti@gmail.com Resumo Cromossomos Eucarióticos: Intrudução acerca da estrutura e organização dos cromossomos

Leia mais

Direção da Síntese DNA mrna Proteínas

Direção da Síntese DNA mrna Proteínas Direção da Síntese DNA mrna Proteínas Discentes: Ana Carolina Q. D. Medina 9215722 Carlos S. Vasconcellos 8928552 Celso A. de Souza Júnior 8928718 Orlando Campovilla 8523404 Docente: Júlio César Borges

Leia mais

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Replicação do DNA Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Processo de replicação do DNA. Mediado por diversas enzimas Principais enzimas

Leia mais

Hospedeiros e vetores de clonagem

Hospedeiros e vetores de clonagem UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Hospedeiros e vetores de clonagem Prof. Dr. Silas Pessini Rodrigues

Leia mais

. a d iza r to u a ia p ó C II

. a d iza r to u a ia p ó C II II Sugestões de avaliação Ciências 8 o ano Unidade 3 5 Unidade 3 Nome: Data: 1. As bactérias não têm núcleo nem DNA. Você concorda com essa afirmação? Justifique. 2. Uma mulher de 40 anos de idade está

Leia mais

Replicação do DNA & Transposons

Replicação do DNA & Transposons Replicação do DNA & Transposons Enzimas e Mecanismos Envolvidos na Replicação e Transposição do DNA Prof. Henrique S. Costa, M.Sc. Replicação do DNA e ciclo celular Replicação e Ciclo Celular estão intimamente

Leia mais

Bases Moleculares da Vida

Bases Moleculares da Vida Instituto de Química de São Carlos IQSC Universidade de São Paulo Bases Moleculares da Vida Disciplina: Bioquímica I Docente: Profa. Fernanda Sugestão de leitura: Cap. 1 do Lehninger Bioquímica Estudo

Leia mais

Electroforese de ácidos nucleicos

Electroforese de ácidos nucleicos Electroforese de ácidos nucleicos 1 A electroforese consiste em fazer migrar biomoléculas por uma matriz, sob a influência de um campo eléctrico, permitindo separá-las segundo as suas propriedades fisicoquímicas

Leia mais

Universidade Estadual de Maringá - UEM

Universidade Estadual de Maringá - UEM Universidade Estadual de Maringá - UEM Disciplina: Biologia Molecular 6855 T1 e T2 Ciências Biológicas Transcriptoma metodologia ORESTES Profa. Dra. Maria Aparecida Fernandez Estratégia ORESTES ESTs de

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Retrovírus Felinos. Fernando Finoketti

Retrovírus Felinos. Fernando Finoketti Retrovírus Felinos Fernando Finoketti Porto Alegre, Rio Grande do Sul, Brasil Maio de 2014 Retrovírus - Características Capsídeo icosaédrico. Possuem envelope. Genoma composto de duas moléculas idênticas

Leia mais

Clique para editar o estilo do título mestre

Clique para editar o estilo do título mestre sub 23/07/2014 1 23/07/2014 1 AU09 Estrutura título e Função mestre do Material Genético Nalini subtítulo Drieli Josviak mestre Doutorado drinaly@gmail.com 23/07/2014 2 23/07/2014 2 Material Genético:

Leia mais

Organização do Genoma

Organização do Genoma Organização do Genoma Bibliografia: The Cell A Molecular Approach (Fourth Edition) Geoffrey M. Cooper & Robert E. Hausman. ASM Press & Sinauer Associates, Inc. 2007. (Disponível para ser requisitado na

Leia mais

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4 Biologia 21. Associe os números das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna abaixo do desenho. A seguir, assinale a opção em que a seqüência coincida com o que foi

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

BIOLOGIA LISTA DE EXERCÍCIOS DE BIOLOGIA DE VIRUS E BACTÉRIA

BIOLOGIA LISTA DE EXERCÍCIOS DE BIOLOGIA DE VIRUS E BACTÉRIA BIOLOGIA Prof. Fred LISTA DE EXERCÍCIOS DE BIOLOGIA DE VIRUS E BACTÉRIA 1. (UDESC SC/2011) Assinale a alternativa incorreta a respeito das características gerais dos vírus. a) Muitos vírus são específicos

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

1.4 Metodologias analíticas para isolamento e identificação de micro-organismos em alimentos

1.4 Metodologias analíticas para isolamento e identificação de micro-organismos em alimentos Áreas para Submissão de Resumos (1) Microbiologia de Alimentos Trabalhos relacionados com micro-organismos associados aos alimentos: crescimento, identificação, biossíntese, controle, interação com o hospedeiro,

Leia mais

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos INSTITUTO SUPERIOR POLITÉCNICO DE COIMBRA / ESCOLA SUPERIOR AGRÁRIA Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos Data: 02 Maio 2012 Duração: 2 horas

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

Bioinformática Aplicada ao Estudo e Análise de Genes e Genomas. Prof. Dr. Alessandro de M. Varani Dep. de Tecnologia - UNESP, FCAV

Bioinformática Aplicada ao Estudo e Análise de Genes e Genomas. Prof. Dr. Alessandro de M. Varani Dep. de Tecnologia - UNESP, FCAV Bioinformática Aplicada ao Estudo e Análise de Genes e Genomas Prof. Dr. Alessandro de M. Varani Dep. de Tecnologia - UNESP, FCAV Conteúdo Introdução ao GenBank; Introdução ao GOLD (Genomes Online) Database;

Leia mais

DESVENDANDO O GENOMA HUMANO

DESVENDANDO O GENOMA HUMANO 2º EM Biologia Professor João DESVENDANDO O GENOMA HUMANO Um breve histórico da Genética Hereditariedade (1865); Localização dos genes nos cromossomos (1911); É proposta a molécula helicoidal de DNA (1953);

Leia mais