Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Nome: Curso: Nº. 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h."

Transcrição

1 1 Nome: Curso: Nº 1 º Teste Engenharia Genética 22 de Novembro de 2012 Duração: 2h. As proteínas sensoras dos sistemas reguladores de dois components são usadas por bactérias para detectar e responder a alterações ambientais. A bactéria Pseudomonas aeruginosa PA14 tem pelo menos 60 dessas proteínas sensoras que contribuem para a sua enorme capacidade de adaptação a múltiplos ambientes incluindo o humano. Peixes da espécie Danio rerio são usadas como modelo de infecção para Pseudomonas pois estas bactérias são capazes de estabelecer infecções agudas causando a morte do animal. 1- Suponha que dispõe de mutantes por transposição em cada uma das 60 proteínas sensoras. Diga como pode avaliar o grau de virulência desses mutantes, descrevendo a experiência, incluindo o(s) controlo(s) e o tipo de resultados que espera obter. (1,0 valor) 2- Da experiência anterior identificou-se o gene kinb como sendo importante na virulência de Pseudomonas aeruginosa PA14. Sabendo que a sequência de nucleótidos do genoma deste organismo é conhecida, pode-se facilmente obter a sequência de nucleótidos e de aminoácidos de KinB. Explique como pode prever in silico a localização celular desta proteína bem como a existência de domínios conservados. (1,0 valor)

2 2 3- De seguida, pretende confirmar a atenuação da virulência do mutante de transposição para kinb, mas usando um mutante de eliminação. Para tal, pode usar o vector pk18mob (lacz +, mob +, canamicina R ) e a cassete aacc1 (gentamicina R ) para o construir. a) Descreva todos os passos para a clonagem, no vector indicado, das regiões flanqueantes do gene kinb e cassete de substituição. (1,5 valores) b) A transformação de P. aeruginosa PA14 com a molécula de DNA recombinante preparada em a) pode ser efectuada por electrotransformação. Descreva o princípio teórico desta técnica e o modo como faria a selecção das colónias recombinantes. (1,0 valor)

3 3 c) Como poderá confirmar o mutante de eliminação para o gene kinb através do uso da técnica de hibridação de Southern? (2,0 valores) 4- Para confirmar que a atenuação da virulência do mutante de eliminação construído se deve exclusivamente à ausência deste gene, é necessário efectuar uma experiência de complementação in trans. a) A primeira decisão a tomar é a escolha de um vector de clonagem apropriado. Quais são as características que esse vector deverá conter atendendo a que pretende produzir a proteína KinB em P. aeruginosa? (1,0 valor)

4 b) Descreva a clonagem do gene kinb no vector referido em 4a). (1,5 valores) 4 c) Que experiência faria e qual o resultado que deve obter para demonstrar que o mutante de eliminação para kinb não apresenta qualquer outra mutação. (1,0 valor) 5- Sendo uma proteína sensora, KinB autofosforila num resíduo de histidina antes de efectuar a transdução de sinal para a proteína reguladora de resposta. Para confirmar que H385 é o alvo directo de autofosforilação, este aminoácido foi substituído por uma alanina usando técnicas de mutagénese dirigida. Refira qual o material biológico necessário e quais os principais passos do procedimento experimental até à correcta identificação do gene alterado. (2,0 valores)

5 5 6- Testou-se o efeito da mutação do gene kinb na produção do pigmento piocianina e de elastase. Os resultados encontram-se nos seguintes gráficos: a) Qual a importância da proteína KinB em ambos os fenótipos testados? (1,0 valor) b) Qual o efeito da modificação do resíduo de histidina H385A de KinB em ambos os fenótipos? (1,0 valor) 7- Seleccione a resposta correcta através de um círculo (0,5 valores cada): 1- No processo de inactivação por inserção: a) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica inactivo e as colónias de E. coli mantêm-se brancas b) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica inactivo e as colónias de E. coli tornam-se azuis c) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica activo e as colónias de E. coli mantêm-se brancas d) Se houver inserção de um fragmento de DNA, o gene da beta-galactosidase fica activo e as colónias de E. coli tornam-se azuis

6 2- A função da transcriptase reversa na clonagem de DNA eucariótico em células procarióticas é: a) Sintetizar cdna a partir de mrna eucariótico b) Processar o precursor do mrna c) Sintetizar mrna a partir de DNA d) Sintetizar DNA bacteriano a partir de DNA eucariótico 6 3- Para que uma sonda de DNA hibride é necessário que: a) As cadeias de DNA alvo sejam homólogas, tendo regiões com sequências iguais ou semelhantes b) As cadeias de DNA alvo sejam fragmentadas por uma exonuclease c) As cadeias de DNA alvo não sejam homólogas d) O DNA alvo seja complementar ao RNA 4- Durante a reacção de PCR, a Taq polimerase inicia a síntese de DNA: a) No final das cadeias simples de RNA b) Em qualquer cadeia aberta c) Em iniciadores de RNA ligados ao gene de interesse d) Em iniciadores de DNA ligados ao gene de interesse 5- Para que a amplificação de DNA ocorra qual dos seguintes compostos tem de estar presente? a) Ribonucleótidos b) Iniciadores de RNA c) Desoxinucleótidos d) Primase 6- Considere a sequência 5 ATGCCTGGACCTTAACGCGCCTAGGTATCTTGA3. Suponha que necessita de iniciadores 10-mer para PCR. Essas sequências serão: a) ATGCCTGGAC e GGTATCTTGA b) ATGCCTGGAC e TCAAGATACC c) TACGGACCTG e TCAAGATACC d) ATGCCTGGAC e CCATAGAACT 7- Uma bactéria capaz de obter DNA livre a partir do meio externo diz-se: a) Competente b) Lisogénica c) Infectada d) Incompetente 8- O gene da transposase codifica para uma enzima que: a) Facilita a recombinação homóloga b) Facilita a replicação viral dentro de um genoma c) Facilita a integração em determinados locais de elementos transponíveis d) Facilita a complementação homóloga 9- Os elementos P são transposões de: a) Drosophila melanogaster b) Caenorhabditis elegans c) Escherichia coli d) Drosophila elementi 10) Pequenos fragmentos de DNA que codificam enzimas capazes de cortar esse segmento de DNA e de o introduzir noutro local denominam-se: a) Plasmídeos b) Nucleóides c) Transposões d) DNA topoisomerases

7 7 11) O RNA de interferência é um mecanismo para o silenciamento da expressão de genes ao nível da: a) Replicação b) Transcrição c) Tradução d) Pós-transcrição, mas pré-tradução 12) A proteína que actua como uma endonuclease nos passos iniciais do processamento dos precursores de RNAi denomina-se: a) Phaser b) Sizer c) Dicer d) RNase Respostas Adicionais

1 º Teste de Engenharia Genética 7 de Novembro de 2015; Duração máxima: 2h

1 º Teste de Engenharia Genética 7 de Novembro de 2015; Duração máxima: 2h 1 Nome: Curso: Nº 1 º Teste de Engenharia Genética 7 de Novembro de 2015; Duração máxima: 2h As infecções contraídas em hospitais devido a bactérias resistentes a múltiplas drogas (MDR) são um dos maiores

Leia mais

2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min

2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min Nome: Curso: Nº 2 º Exame Engenharia Genética 31 de Janeiro de 2014 Duração: 2h30min Bordetella pertussis é o agente causador da tosse convulsa, uma doença respiratória humana altamente infecciosa e transmissível.

Leia mais

1 º Exame Engenharia Genética 11 de Janeiro de 2013 Duração: 2h30min.

1 º Exame Engenharia Genética 11 de Janeiro de 2013 Duração: 2h30min. Nome: Curso: Nº 1 º Exame Engenharia Genética 11 de Janeiro de 2013 Duração: 2h30min. A bactéria Edwardsiella tarda causa septicémia hemorrágica em peixes bem como infecções gastrointestinais em humanos.

Leia mais

Bases e aplicações. da tecnologia do DNA recombinante

Bases e aplicações. da tecnologia do DNA recombinante Bases e aplicações da tecnologia do DNA recombinante Por quê entender a Tecnologia do DNA recombinante? y y Doenças: diagnóstico, prognóstico e tratamento Compreensão dos mecanismos biológicos y y y organismos

Leia mais

1 º Exame de Engenharia Genética/ Biotecnologia Molecular 9 de Janeiro de 2016 (Duração: 2h30min).

1 º Exame de Engenharia Genética/ Biotecnologia Molecular 9 de Janeiro de 2016 (Duração: 2h30min). Nome: Curso: Nº 1 º Exame de Engenharia Genética/ Biotecnologia Molecular 9 de Janeiro de 2016 (Duração: 2h30min). As infecções da corrente sanguínea são muitas vezes causadas por estirpes patogénicas

Leia mais

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial.

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial. GENÉTICA BACTERIANA GENOMA BACTERIANO Cromossoma (nucleóide) Informação genética essencial. Ácido desoxirribonucléico (DNA). Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello

Leia mais

Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI

Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI Sessão 1: Os Princípios e as Técnicas da Biologia Molecular do Séc XXI Menu do dia: -DNA RNA proteína - Sequenciação de genomas (Clonagem, electroforese em gel) - Transcritoma (Microarrays) - Organismos

Leia mais

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS

UNIVERSIDADE FEDERAL DE OURO PRETO INSTITUTO DE CIÊNCIAS EXATAS E BIOLÓGICAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Monitoria da disciplina de Biologia Molecular (CBI 613) Monitor responsável: Bruno Jhônatan Costa Lima (13.2.2032) Assunto: Síntese proteica e regulação da expressão gênica GENES E CROMOSSOMOS 1. Identifique

Leia mais

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e

Perguntas para o roteiro de aula. 1) Descreva as principais características estruturais gerais das moléculas de DNA e Perguntas para o roteiro de aula Professora: Drª Marilda S. Gonçalves Propriedades físico-químicas dos ácidos nucléicos 1) Descreva as principais características estruturais gerais das moléculas de DNA

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

Genética Bacteriana. Julliane Dutra Medeiros

Genética Bacteriana. Julliane Dutra Medeiros Genética Bacteriana Julliane Dutra Medeiros 1 A célula bacteriana 2 Relembrando conceitos... Genoma informação genética de uma célula (cromossomo e plasmídeos) Estruturas contendo DNA que transportam fisicamente

Leia mais

Seleção de clones e screening de bibliotecas genômicas

Seleção de clones e screening de bibliotecas genômicas UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Seleção de clones e screening de bibliotecas genômicas Prof. Dr. Silas

Leia mais

1.3 Explique a razão pela qual, na ausência de lactose, as enzimas necessárias à degradação desta molécula não se produzem.

1.3 Explique a razão pela qual, na ausência de lactose, as enzimas necessárias à degradação desta molécula não se produzem. A g r u p a m e n t o d e E s c o l a s A n t ó n i o S é r g i o - V. N. Gaia E S C O L A S E C U N D Á R I A / 3 A N T Ó N I O S É R G I O BIOLOGIA Módulo 2 12º CTec CURSO CIENTÍFICO-HUMANÍSTICO DE CIÊNCIAS

Leia mais

GENÉTICA E BIOTECNOLOGIA

GENÉTICA E BIOTECNOLOGIA GENÉTICA E BIOTECNOLOGIA CONTROLO DA REPLICAÇÃO DE PLASMÍDEOS Trabalho elaborado por: Andrêa Gouvêa andrealeitegouvea@yahoo.com Ivânia Pereira Lara Bolito Magali Barbosa Grupo 8 biotecnologia A biotecnologia

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula 26 Genética

Prof. Marcelo Langer. Curso de Biologia. Aula 26 Genética Prof. Marcelo Langer Curso de Biologia Aula 26 Genética MATERIAL GENÉTICO A primeira atividade é a de orientação do DNA para formar a proteína, que será responsável pela característica genética. DNA é

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

REGULAÇÃO DO MATERIAL GENÉTICO

REGULAÇÃO DO MATERIAL GENÉTICO REGULAÇÃO DO MATERIAL GENÉTICO Prof. Ana Rita Rainho Controlo da actividade celular Se todas as células de um organismo possuem a mesma informação genética, qual o mecanismo que permite às células diferenciar-se?

Leia mais

Unidade 5 Cresc. e renovação celular V ALTERAÇÕES DO MATERIAL GENÉTICO

Unidade 5 Cresc. e renovação celular V ALTERAÇÕES DO MATERIAL GENÉTICO 1 Unidade 5 Cresc. e renovação celular V ALTERAÇÕES DO MATERIAL GENÉTICO 2 E se ocorrerem erros durante a síntese proteica?? A possibilidade que a célula tem de manter a informação do seu DNA nas células-filhas

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste Nome do Aluno: Nº: Curso: BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2011_2012_2º Teste 11/01/2012 (Duração: 1,5 h) Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc.

Regulação da expressão gênica em Procariotos. John Wiley & Sons, Inc. Regulação da expressão gênica em Procariotos Cada célula tem todos os genes, mas em um tecido apenas parte deles está ativa REGULAÇÃO DA EXPRESSÃO GÊNICA Diferenciação celular: diferentes tipos celulares

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011 BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_2º Teste 12/01/2011 (Duração: 1,5 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Relembrando: Material genético

Relembrando: Material genético REGULAÇÃO GÉNICA Relembrando: Material genético O MATERIAL GENÉTICO é o suporte físico do conjunto de padrões de informações hereditárias, transmitidas ao longo das gerações. GENE é a unidade de informação

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética.

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética. UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética Biologia 12º ano UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação

Leia mais

Departamento de Genética Nilce M. Martinez Rossi

Departamento de Genética Nilce M. Martinez Rossi ORGANIZAÇÃO E FUNCIONALIDADE DO GENOMA HUMANO Departamento de Genética Nilce M. Martinez Rossi Fenótipo = GENÓTIPO + Ambiente O que é o genoma? Projetos Genoma Genoma: sequencia de DNA de todos os cromossomos

Leia mais

GENOMAS. Prof. Dr. Marcelo Ricardo Vicari

GENOMAS. Prof. Dr. Marcelo Ricardo Vicari GENOMAS Prof. Dr. Marcelo Ricardo Vicari Definições: Genoma: Conjunto completo de genes e das sequências de DNA de um organismo Transcriptoma: Conjunto completo de genes expressos sob certas condições

Leia mais

Lição nº1. 17 (T1) e 18 (T2) de Setembro

Lição nº1. 17 (T1) e 18 (T2) de Setembro GENÉTICA e BIOLOGIA MOLECULAR (componente Biologia Molecular) DBV- Secção de Genética e Dinâmica de Populações Faculdade de Ciências de Lisboa Ano lectivo de 07/08 SUMÁRIOS Lição nº1 17 (T1) e 18 (T2)

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

Exercícios de revisão

Exercícios de revisão Exercícios de revisão Mutações Génicas 1. O gene responsável pela codificação da hemoglobina S apresenta uma mutação pontual por substituição de um nucleótido na cadeia 3 5 do DNA, cujo nucleótido T é

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Genoma! O genoma de um organismo

Leia mais

TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3

TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3 TECNOLOGIA DO DNA RECOMBINANTE: HISTÓRICO, ENZIMAS DE RESTRIÇÃO E VETORES Aula 3 LGN0232 Genética molecular Maria Carolina Quecine Departamento de Genética mquecine@usp.br Homo sapiens: UMA ESPÉCIE TECNOLÓGICA

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais

7.012 Conjunto de Problemas 4

7.012 Conjunto de Problemas 4 Nome Seção 7.012 Conjunto de Problemas 4 Pergunta 1 Você está estudando a síntese do aminoácido triptofano em bactérias. As enzimas TrpA, TrpB, TrpC, TrpD, TrpE e AroH são essenciais para a síntese desse

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 2º S_2014_2015_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 2º S_2014_2015_2º Teste BIOQUÍMICA E BIOLOGIA MOLECULAR 2º S_2014_2015_2º Teste 6/06/2015 (Duração: 1h,30 m) Nome do Aluno: Nº: Curso: Cada uma das questões tem a cotação de 0,5 valores. Nas questões de escolha múltipla será

Leia mais

Vírus, um grupo a parte.

Vírus, um grupo a parte. Vírus, um grupo a parte. Vírus, um grupo a parte. Estrutura típica de um vírus: 01)Observe a figura a seguir, onde está representado, esquematicamente, o vírus HIV e analise as proposições quanto à sua

Leia mais

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos?

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos? O que significam as siglas? R: Ácido desoxirribonucleico. A molécula de tem mensagens codificadas em sequências de que contêm bases púricas e pirimídicas. R: nucleótidos Qual o nome das bases pirimídicas?.

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2016_2017_2º Teste

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2016_2017_2º Teste BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2016_2017_2º Teste 7/01/2017 (Duração: 1h,30 m) Nome do Aluno: Nº: Curso: Cada uma das questões tem a cotação de 0,5 valores. Nas questões de escolha múltipla será

Leia mais

introdução ao curso

introdução ao curso introdução ao curso http://www.ifsc.usp.br/~rdemarco/ffi0760/ffi0760.htm Cronograma aulas teóricas Aulas teóricas (Segundas-feiras - Sala 146) 30/07-introdução ao curso. 06/08-Busca em bancos de dados

Leia mais

Actividade prática: Constrói os teus Kits de Genética!

Actividade prática: Constrói os teus Kits de Genética! Actividade prática: Constrói os teus Kits de Genética! Mais uma vez vais vestir a tua bata de cientista e investigador e preparar o teu dia a dia no laboratório. Hoje é um dia especial, vais receber a

Leia mais

1. O QUE É A ENGENHARIA GENÉTICA?

1. O QUE É A ENGENHARIA GENÉTICA? 1. O QUE É A ENGENHARIA GENÉTICA? Termos sinónimos: Manipulação genética, clonagem de genes, tecnologia do DNA recombinante, modificação genética, nova genética. Áreas de acção: Investigação básica - função

Leia mais

PS 4 Soluções Pergunta 1

PS 4 Soluções Pergunta 1 PS 4 Soluções Pergunta 1 Você está estudando a síntese do aminoácido triptofano em bactérias. As enzimas TrpA, TrpB, TrpC, TrpD, TrpE e AroH são essenciais para a síntese desse aminoácido. Bactérias do

Leia mais

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin

Organização Gênica de Eucariotos. Prof. Odir A. Dellagostin Organização Gênica de Eucariotos Prof. Odir A. Dellagostin Classificação dos seres vivos Domínio Eukarya Reinos Protistas (protozoários e leveduras) Fungi (fungos) Plantae (vegetais) Animalia (animais)

Leia mais

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017

Princípios Básicos de Genética Molecular Parte II. Profª Ana Claudia 17/02/2017 Princípios Básicos de Genética Molecular Parte II Profª Ana Claudia 17/02/2017 Estrutura do material genético Estrutura de Genomas e variabilidade Replicação Transcrição Tradução Regulação da Expressão

Leia mais

VÍRUS: A ESTRUTURA DO HIV E SEU CICLO DE VIDA

VÍRUS: A ESTRUTURA DO HIV E SEU CICLO DE VIDA VÍRUS: A ESTRUTURA DO HIV E SEU CICLO DE VIDA O vírus HIV possui duas moléculas de RNA envoltas por cápsulas proteicas (capsídeo), formando o nucleocapsídeo. Além do material genético, possui algumas enzimas,

Leia mais

Prof. Dr. Bruno Lazzari de Lima. Replicação do DNA

Prof. Dr. Bruno Lazzari de Lima. Replicação do DNA Prof. Dr. Bruno Lazzari de Lima Replicação do DNA Introdução Sistemas vivos tem a capacidade de fazer cópias de si mesmos. Capacidade associada ao material genético hereditário. Compreensão do processo

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Aplicações. Enzimas de restrição

Aplicações. Enzimas de restrição Engenharia genética - Capacidade de manipular ácidos núcleicos de forma bem definida e controlada. As ferramentas que o permitem são as enzimas capazes de actuarem sobre ácidos núcleicos. Enzimas de restrição

Leia mais

Ficha de Avaliação Sumativa Versão 2

Ficha de Avaliação Sumativa Versão 2 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 2 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

DOGMA CENTRAL DA BIOLOGIA MOLECULAR

DOGMA CENTRAL DA BIOLOGIA MOLECULAR Transcrição do DNA DOGMA CENTRAL DA BIOLOGIA MOLECULAR Replicação DNA Transcrição RNA Tradução PROTEÍNA Transcrição Processo pelo qual o DNA é copiado numa molécula de RNA (mrna, rrna e trna). Todos os

Leia mais

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote))

((lambda (h q) (list h (list q h) (list q q))) (quote (lambda (h q) (list h (list q h) (list q q)))) (quote quote)) The depressing truth Ultimately, it all comes down to 3 facts: 1.All things eventually disappear. 2.Making copies can delay this. 3.With limited resources, what is left is that which makes good copies

Leia mais

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula.

Pergunta 1. A fim de ser localizado na membrana plasmática, o SF-R deve primeiro passar por várias etapas dentro da célula. Pergunta 1 Parte A Você está estudando um receptor chamado Receptor do Fator de Tamanho ou SF-R em um eucariota haplóide. Abaixo encontra-se um diagrama esquemático da proteína SF-R: A fim de ser localizado

Leia mais

Profa. Dra. Viviane Nogaroto

Profa. Dra. Viviane Nogaroto ESTRUTURA DO GENE GENE: Região do DNA capaz de ser transcrita a fim de produzir uma molécula de RNA funcional ou uma proteína -inclui sequências codificadoras e regulatórias transcrição tradução DNA RNA

Leia mais

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila DNA RNA 17/04/2017 Genes (ou Gen) é uma parte do DNA capaz de sintetizar uma proteína específica. O DNA (Ácido Desoxiribonucleico) é formado pela união de nucleotídeos. Fosfato Ribose Glicídio do grupo

Leia mais

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs Clonagem Molecular Fragmentos de DNA de interesse Vetores: Plasmídeos Fagos Cosmídeos BACs/ YACs Hospedeiros: E.coli Levedura Células vegetais Células animais Enzimas: Enzimas de restrição DNA polimerases

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

Concurso Público para Técnico-Administrativo em Educação Edital 067/2016 Gabarito oficial preliminar Data: 05/03/2017 BIOLÓGO

Concurso Público para Técnico-Administrativo em Educação Edital 067/2016 Gabarito oficial preliminar Data: 05/03/2017 BIOLÓGO Conhecimentos Específicos Português Legislação N. de Informática Conhecimentos Específicos SERVIÇO PÚBLICO FEDERAL Tipo 1 Tipo 2 # Gab # Gab 1 D 1 A 2 B 2 C 3 C 3 D 4 A 4 B 5 C 5 C 6 B 6 C 7 C 7 D 8 D

Leia mais

Bases da análise genômica: estado da arte

Bases da análise genômica: estado da arte Bases da análise genômica: estado da arte Cesar Martins cmartins@ibb.unesp.br Departamento de Morfologia Instituto de Biociências UNESP Universidade Estadual Paulista Botucatu, SP Avanços nas tecnologias

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR)

AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR) AMPLIFICAÇÃO DO GENE DA PROTEÍNA E DO VÍRUS DENV ATRAVÉS DA TÉCNICA DE REAÇÃO EM CADEIA DA POLIMERASE (PCR) Beatriz Dantas Guimarães (1); Lucas Linhares de Locio (2); Herbert Crisóstomo dos Santos Araújo

Leia mais

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA

Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA TRANSCRIÇÃO - Pontos Principais: Transcrição é a primeira etapa da expressão do gene. Envolve a cópia da sequência de DNA de um gene para produzir uma molécula de RNA A transcrição é realizada por enzimas

Leia mais

Transposons. Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS

Transposons. Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS Emily Bruna Justino Transposons Sequências de DNA com a habilidade única de se mover como uma unidade discreta de uma posição a outra do genoma SEQUÊNCIAS SALTADORAS Esta habilidade em se realocar é chamada

Leia mais

Bases da análise genômica: estado da arte

Bases da análise genômica: estado da arte Bases da análise genômica: estado da arte Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP Avanços nas tecnologias

Leia mais

Replicação do DNA. Prof. Edimar

Replicação do DNA. Prof. Edimar Replicação do DNA Prof. Edimar PRINCIPAIS ENZIMAS ENVOLVIDAS (SISTEMA DE REPLICAÇÃO DO DNA) 1. DNA Polimerases 2. Endonucleases 3. Helicases 4. Topoisomerases 5. Primases 6. Telomerases ENDONUCLEASES HELICASE

Leia mais

Ficha de Avaliação Sumativa Versão 1

Ficha de Avaliação Sumativa Versão 1 Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Avaliação Sumativa Versão 1 Unidade 5 Crescimento e renovação celular A ficha de avaliação consiste

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Regulação da Expressão Gênica em Eucariotos

Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica em Eucariotos Regulação da Expressão Gênica Trajetória da expressão de um gene Principal ponto de regulação Núcleo Citoplasma mrna inativo DNA RNA transcrito mrna mrna PROTEÍNA

Leia mais

Modificação da informação genética (II)

Modificação da informação genética (II) Modificação da informação genética (II) Principais mecanismos que geram variabilidade genética nas bactérias e contribuem para o processo de evolução:. Mutação. Transposição. Transferência de genes ( veiculada

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010. (Duração: 2 h)

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010. (Duração: 2 h) BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010 (Duração: 2 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO DISCIPLINA DE BIOLOGIA 4º Teste de Avaliação (V1) 12ºano Turma A e B TEMA: Património Genético e Imunidade Nome: Nº Classificação:, valores A professora: (Isabel

Leia mais

Resumo - capítulo 7. Pedro Ivo Gomes de Faria

Resumo - capítulo 7. Pedro Ivo Gomes de Faria Resumo - capítulo 7 Pedro Ivo Gomes de Faria Sumário 1 Capítulo 7 - Tecnologia do DNA recombinante 2 1.1 Fragmentação, separação e sequenciamento de moléculas de DNA................................ 2 1.2

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

ENSINO DE BIOLOGIA CELULAR DEPARTAMENTO DE BIOLOGIA CELULAR ICB USP

ENSINO DE BIOLOGIA CELULAR DEPARTAMENTO DE BIOLOGIA CELULAR ICB USP ENSINO DE BIOLOGIA CELULAR DEPARTAMENTO DE BIOLOGIA CELULAR ICB USP O Departamento ministra disciplinas de Biologia Celular, Biologia Tecidual e Biologia do Desenvolvimento para 14 cursos: Do ICB : Curso

Leia mais

A g r u p a m e n t o d e E s c o l a s A n t ó n i o S é r g i o V. N. G a i a E S C O L A S E C U N D Á R I A / 3 A N T Ó N I O S É R G I O GRUPO I

A g r u p a m e n t o d e E s c o l a s A n t ó n i o S é r g i o V. N. G a i a E S C O L A S E C U N D Á R I A / 3 A N T Ó N I O S É R G I O GRUPO I A g r u p a m e n t o d e E s c o l a s A n t ó n i o S é r g i o V. N. G a i a E S C O L A S E C U N D Á R I A / 3 A N T Ó N I O S É R G I O BIOLOGIA Módulo 2 12º CTec CURSO CIENTÍFICO-HUMANÍSTICO DE

Leia mais

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA

GENÉTICA DNA AMINOÁCIDOS PROTEÍNAS TRADUÇÃO TRANSCRIÇÃO MRNA GENÉTICA É a ciência que estuda a hereditariedade Estuda os gens, como eles transportam informações, são replicados e passados para as gerações subseqüentes de células ou transmitidos entre organismos

Leia mais

Prof. Msc. Cleysyvan Macedo

Prof. Msc. Cleysyvan Macedo Prof. Msc. Cleysyvan Macedo PRINCIPAIS CARACTERÍSTICAS DOS VÍRUS: Não possui estruturas celulares (membrana plasmática, citoplasma, etc.). São formado basicamente por uma cápsula protéica denominada capsômero

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2014 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 05/05/2014 HORA 10.00H - 12.00H

Leia mais

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA I - INTRODUÇÃO Atualmente é muito comum ouvirmos falar de clonagem em meios de comunicação que atingem o grande público. É também bastante comum assistirmos

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I E S C O L A S E C U N D Á R I A A N T Ó N I O S É R G I O 10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o 2 7-03- 201 4 GRUPO I 1 1 Os seres vivos

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B)

INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) INTRODUÇÃO ÀS TÉCNICAS DE CLONAGEM GÊNICA (PARTE B) Para produzir 5mg de somatostatina, são necessários 500.000 cérebros de carneiro, ou por engenharia genética 7,5kg de E. coli com gene enxertado deste

Leia mais

COMPETÊNCIAS MÍNINAS A ATINGIR PELO ALUNO

COMPETÊNCIAS MÍNINAS A ATINGIR PELO ALUNO TESTE DIAGNÓSTICO Biologia 12º ano Ano Lectivo 2008/09 COMPETÊNCIAS MÍNINAS A ATINGIR PELO ALUNO Identificar elementos de situações Problema A Problematizar e formular hipóteses B Interpretar actividades

Leia mais

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin

Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I. Prof. Odir Dellagostin Universidade Tiradentes Mestrado em Biotecnologia Industrial Biologia Molecular I Prof. Odir Dellagostin Woese 1978 3 domínios O QUE É UM GENE? Toda sequência nucleotídica necessária e suficiente para

Leia mais

MARCADORES MOLECULARES

MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação

Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Replicação do DNA Replicação do DNA. Experimentos de Meselson-Stahl demonstraram a natureza semi-conservativa da replicação Processo de replicação do DNA. Mediado por diversas enzimas Principais enzimas

Leia mais

Replicação dos Vírus. Células 26/04/2012. Ciclo celular. Vírus: não apresentam estrutura celular. ausência de metabolismo

Replicação dos Vírus. Células 26/04/2012. Ciclo celular. Vírus: não apresentam estrutura celular. ausência de metabolismo Replicação dos Vírus Profª Maria Luzia da Rosa e Silva Vírus: não apresentam estrutura celular ausência de metabolismo Entretanto, a produção de novas partículas (Replicação) Requer síntese de macromoléculas

Leia mais

Universidade dos Açores Prova de Ingresso 2006

Universidade dos Açores Prova de Ingresso 2006 Universidade dos Açores Prova de Ingresso 2006 Nome:... I A vida, na sua multiforme diversidade, tem uma origem comum, se bem que complexa. A vida e o planeta onde ela nasceu formam um todo integrado,

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais