Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução?

Tamanho: px
Começar a partir da página:

Download "Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução?"

Transcrição

1 Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução? Ana Puga e Ma=lde Viegas 29 de Maio 2012

2 Introdução inibição de potenciadores moleculares do cancro Não são eficazes, pois não destroem todas as células MASSA AMORFA E HOMOGÉNEA OS TUMORES NÃO SÃO MASSAS HOMOGÉNEAS.. u3lização de fármacos em doses suficientemente agressivas para induzir morte celular Toxicidade nos tecidos neoplásicos e nos saudáveis HIERARQUIA CELULAR

3 Introdução MODELOS DE PROGRESSÃO TUMORAL (a) Modelo Estocás3co (b) Modelo de Células Estaminais Cancerígenas CSCs Crescimento Tumoral Crescimento Tumoral Sem crescimento

4 Células Estaminais Auto - renovação CÉLULAS ESTAMINAIS FILHAS CÉLULA ESTAMINAL Diferenciação CÉLULAS DIFERENCIADAS PAPEL CENTRAL NO CANCRO?

5 Células Estaminais Cancerígenas DISSEMINAÇÃO RESISTÊNCIA ORIGEM Iden3ficadas em 1994 (Leucemia Mielóide Aguda) CÉLULAS ESTAMINAIS CANCERÍGENAS (CSCS) manutenção e renovação do tumor; progenitoras de clones de CSCs; progenitoras de células sem capacidade de iniciação tumoral. Compreensão dos mecanismos de carcinogénese; Ajuda no diagnós3co; Pesquisa para a adequação de novas terapias.

6 Farmacogenómica FARMACOGENÓMICA - RAMO DA FARMACOLOGIA QUE LIDA COM A INFLUÊNCIA DA VARIAÇÃO GENÉTICA NA RESPOSTA A FÁRMACOS design inteligente de fármacos específicos para um grupo de indivíduos, maior eficácia e efeitos adversos diminuídos FARMACOGENÓMICA E O CANCRO Alguns fármacos an3- tumorais apresentam baixos índices terapêu3cos citotóxicos inespecíficos, dose necessária para eliminar as células tumorais é muito próxima da dose tóxica para as células normais Estudos Farmacológicos aplicados ao cancro têm como objec3vo: a iden3ficação de polimorfismos e mutações associadas a tumores padrões de expressão gené3ca que poderão prever a eficácia e a tolerância aos tratamentos

7 Resistência das CSCs Polimorfismos germina=vos Mutações somá=cas Expressão de genes que conferem resistência Alterações nas vias de sinalização Resistência! Proliferação! Estudos de genómica, proteómica e bioinformá=ca Perfil de acção de fármacos Eficiência de terapias Marcadores

8 Factores de prognós=co VS. Factores predi=vos Factores de prognós=co indicam o resultado provável de uma doença num indivíduo, independentemente do tratamento a que este foi subme3do. Presença de receptores de estrogénio ou progesterona em cancro da mama: maior probabilidade de sobrevivência Factores predi=vos preveem o efeito de uma terapia específica num determinado doente com determinada patologia. Detecção do biomarcador CD133 em cancro colorrectal é indica3vo de baixa resposta a terapia com fluoroacil. Estas previsões vão desde alta expressão de genes de resistência de fármacos até probabilidade de reincidência do tumor

9 Quais os factores e vias de sinalização relacionadas com as CSCs? WNT, Notch e Hedgehog Factores de crescimento libertados no micro- ambiente Diferentes concentrações Auto- renovação ou diferenciação Nusse, 2008 Vias intrínsecas ao desenvolvimento embrionário e adulto de mamíferos Mutações no padrão epigené3co e genes codificantes Carcinogénese

10 WNT / β- Catenina Na presenca de Wnt Na ausência de Wnt Inibição da degradação da β- Catenina Transcrição de genes Degradação da β- Catenina Não ocorre transcrição de genes Fron3ers in Bioscience 9, , May 1, 2004 Mutação na APC Inac=vação do complexo PROLIFERAÇÃO DAS CSCs Mutação na β- catenina

11 Notch Proliferação, diferenciação celular e apoptose Clivagem do domínio intracelular induzindo a transcrição Se a γ- Secretase não exercer a sua função, não há transcrição (Delta) Possível alvo terapêu=co Inibição sistémica

12 Notch- 1 mutado em 60% dos casos de leucemia linfoblás=ca aguda das células T Mutações missense Delecções/inserções Ac=vação da via independente de ligando Hipersensibilidade em resposta ao ligando Inibir ac=vidade da γ- secretase GSI Resposta diferencial consoante o perfil gené=co das CSCs do paciente! (Delta) Ac=vação independente de ligando Hipersensibilidade Alteração do domínio extracelular Alteração da ac=vidade da γ- Secretase

13 Hedgehog células estaminais células progenitoras em tecidos adultos Danos e mutações nos componentes desta cascata em alguns tecidos estão associados a tumorogénese O ligando Hh liga- se à molécula Ptc e o sinal é traduzido pela molécula Smo. Na ausência de ligando, a Ptc inibe a Smo e ac3va o repressor Gli, não havendo expressão Na presença de ligando, há expressão Antagonistas Smo An=corpos neutralizantes do ligando Hh

14 Polimorfismos ESTUDO NOVO FÁRMACO POLIMORFISMOS DA POPULAÇÃO FARMACOGENÉTICA/FARMACOGENÓMICA Grande Objec=vo: Mapeamento gené3co individual e terapia direccionada Menores riscos de toxicidade e de intolerância

15 Polimorfismos I. POLIMORFISMOS EM ENZIMAS QUE METABOLIZAM FÁRMACOS ANTI- CANCRO Tiopurina e Tiopurina S- me=ltransferase (TPTM) Incorporação de nucleó3dos de 3oguanina (resultantes do metabolismo) quer em DNA quer em RNA Catalisa a s- me3lação de agentes de 3opurina AGENTES ANTI- CANCRO (Aza3opurina, 6- mercaptopurina e 3oguanina) Mutação iden3ficada em 1980; Caracterís3ca autossómica recessiva; Herdada gene3camente em 1/300 dos casos; Alelos TPMT*2, TPMT*3A e TPMT*3 responsáveis por 90% dos casos de insuficiência enzimá3ca Pacientes com deficiência na TPTM acumulam quan3dades excessivas de nucleó3dos de 3oguanina nos tecidos hematopoé3cos, levando a níveis de toxicidade fatais

16 Polimorfismos I. POLIMORFISMOS EM ENZIMAS QUE METABOLIZAM FÁRMACOS ANTI- CANCRO 5- Fluoroacil e Dihidropirimidina desidrogenase (DPD) 50% dos alelos não funcionais de DPYD apresentam uma transição G- A no exão 14, o que leva a produção de uma proteína truncada; Até 2004, eram conhecidas 32 mutações e polimorfismos Metaboliza mais de 80% do 5 Fluoroacil (5FU) Ainda não existe consenso entre a relação do genó3po DPYD e os fenó3pos existentes, sendo um assunto ainda em inves3gação Pacientes com deficiência completa ou parcial em DPD têm reduzidas capacidades de degradação deste fármaco, podendo sofrer de intoxicações severas a nível gastroines3nal, hematopoé3co e cerebral

17 Polimorfismos I. POLIMORFISMOS EM ENZIMAS QUE METABOLIZAM FÁRMACOS ANTI- CANCRO Agentes an=- cancro e gluta=ona s- transferases (GSTs) Os genes que codificam estas proteínas exibem elevados níveis de polimorfismos Catalisa a conjugação da gluta3ona a electrófilos endógenos e xenobió3cos Polimorfismos são encontrados nas GST- P1 e a GST- A, estão associados a resistência a fármacos u3lizados no combate a tumores Exemplo: subs3tuição Ile105Val em GST- P1 maior resistência ao combate ao cancro; dupla delecção de GSTT1 menor resistência ao combate ao cancro

18 Polimorfismos I. POLIMORFISMOS EM ENZIMAS QUE METABOLIZAM FÁRMACOS ANTI- CANCRO Irinotecan e UDP- glucoruniltransferase é conver3do pela carboxilesterase a SN38 (forma ac3va do irinotecan) UDP- glucoruniltransferase 1A1 (UGT1A1) é a enzima responsável pela reacção de conjugação do SN38 com glicuronídeo Polimorfismos Iden=ficados: Genes codificantes das carboxilesterase; Membros da superfamília dos citocromos CYP3A4; Mutações presentes na região codificante da proteína UGT1A1; Diferenças do número de repe3ções TA na região promotora de UGT1A1. A toxicidade do Irinotecan está relaccionada com a quan3dade de SN38 no organismo O METABOLISMO INCOMPLETO DE SN38 ESTÁ CORRELACIONADO COM SETE REPETIÇÕES TA

19 Polimorfismos II. POLIMORFISMOS QUE PODEM INFLUENCIAR O EFEITO DOS FÁRMACOS ANTI- CANCRO PROTEÍNAS TRANSPORTADORAS DE MEMBRANA Mudanças devidas a polimorfismos gené3cos estão associadas a perturbações nos perfis farmacociné3cos, o que poderá levar a diferenças da eficiência do fármaco ou efeitos adversos mais acentuados Área ainda pouco estudada, no entanto, bastante importante quer em tecidos neoplásicos, quer em tecidos normais.

20 Polimorfismos II. POLIMORFISMOS QUE PODEM INFLUENCIAR O EFEITO DOS FÁRMACOS ANTI- CANCRO Glicoproteína- P (ABCB1) primeiro transportador ABC a ser iden3ficado; codificado pelo gene ABCB1; responsável pela resistência a múl3plas fármacos; importante transportador de muitos compostos lipo{licos e fármacos an3- cancro. proteína está envolvida na protecção das células contra a citoxicidade de determinados xenobió3cos Altos níveis de expressão associados com um pior prognós3co de tratamento em neoplasias gástricas polimorfismos no exão 26 do gene codificante do ABCB1 estão associados com dificuldades na absorção e na metabolização de fármacos a nível do duodeno polimorfismo no codão 12 do gene ABCB1 associado com a farmacociné3ca do Irinotecan

21 Polimorfismos II. POLIMORFISMOS QUE PODEM INFLUENCIAR O EFEITO DOS FÁRMACOS ANTI- CANCRO Transportador ABCG2 (BCRP) Dímero ou de tetrámero de modo a ser funcional ; Codificado pelo gene ABCG2; Protecção das células dos efeitos citotóxicos de xenobió3cos RATOS KO - ABCG2 suscep3bilidade acrescida a variados compostos farmacêu3cos; redução demarcada das populações de células estaminais. encontrado em níveis de sobre- expressão em diversas linhas celulares malignas; a sua sobre- expressão pode dar origem a resistência mul3- fármacos tanto em tumores sólidos como em leucemias.

22 Polimorfismos II. POLIMORFISMOS QUE PODEM INFLUENCIAR O EFEITO DOS FÁRMACOS ANTI- CANCRO Transportador ABCC1 codificada pelo gene ABCC1; efluxo de conjugados de gluta3ona, de fármacos an3- neoplásicas; resistência mul3- fármacos a variados cancros, como pulmão, bexiga e mama; grande afinidade para compostos hidro{licos carregados nega3vamente. Polimorfismos no gene ABCC1 Associados com a resposta à quimioterapia em leucemia mielóide aguda outros transportadores ABC foram mencionados por conferir resistência in vivo a fármacos an3- neoplásicos, par3cularmente os da sub- família ABCC, também designados por MRPs (mul8 drug resistance associated proteins)

23 Melhoramentos de estudos farmacogenómicos Modelo estocás=co vs. Modelo hierárquico Métodos de imagem mais eficientes RECIST (Response Evalua-on Criteria in Solid Tumors ) Avaliação do sucesso da terapia com base no volume da massa tumoral Sondas (CD133 + CD44 + ) + PET (Positron Electron Imaging) + MRI (Magne=c Ressonance Imaging) Oncogenicidade assenta nas CSCs

24 Melhoramentos de estudos farmacogenómicos Detecção de mutações somá=cas e germina=vas Mutações germina=vas ocorrem aquando da cópia de DNA precedente à meiose. Todos os gâmetas e células daí procedentes terão a mesma mutação, ou seja, é transmi3da à descendência. Colheita e análise de sangue Mutações somá=cas ocorrem durante a mitose. As células clone terão a mesma mutação e, por isso, esta estará presente num raio mais ou menos extenso em volta da célula inicial. Biópsia de tecido cancerígeno Estudo das CSCs resultados pouco fiáveis devido à baixa concentração de CSCs

25 Melhoramentos de estudos farmacogenómicos Focando na detecção e estudo das CSCs Circula=ng Tumor Cells (cancro metas3zado) Disseminated Tumor Cells (medula óssea e sangue) Semelhante a CSCs - Recolha An=corpos específicos + Laser Microdissec=on Extracção de CSCs Culturas in vitro Presença de biomarcadores Microarrays

26 Em suma 1. Iden=ficação de CSCs modelo hierárquico 2. Iden=ficação das vias fundamentais para auto- renovação 3. Iden=ficação de polimorfismos e reconhecimento da sua importância 4. Aplicação de conhecimento reunido para design de novas terapêu=cas

Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução?

Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução? Farmacologia Molecular e Celular (MBQ) Farmacogenómica e células cancerígenas estaminais: Um panorama em evolução? Entrega: 27 Abril 2012 Apresentação: 29 de Maio 2012 Ana Puga Matilde Viegas Índice Resumo.

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

tica/genômica Farmacogenética/ Resposta a medicamentos Farmacogenômica Farmacogenômica O futuro com a terapia individualizada Metabolismo e eliminação

tica/genômica Farmacogenética/ Resposta a medicamentos Farmacogenômica Farmacogenômica O futuro com a terapia individualizada Metabolismo e eliminação 1º Simpósio Dr. Verner Willrich de Medicina Laboratorial Farmacogenética/ tica/genômica Farmacogenômica G. Mendel 1822-1884 Watson & Crick 1953 Terapia Personalizada Novos Fármacos (genômica) O futuro

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

Carcinogénese ambiental, tabaco, bactérias e vírus

Carcinogénese ambiental, tabaco, bactérias e vírus Carcinogénese ambiental, tabaco, bactérias e vírus (acompanhem com os slides!!) O tabaco, vírus e bactérias são exemplos. Os carcinogéneos ambientais são muitos mais do que estes. O que este esquema pretende

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

O QUE É? O NEUROBLASTOMA. Coluna Vertebral. Glândula supra-renal

O QUE É? O NEUROBLASTOMA. Coluna Vertebral. Glândula supra-renal O QUE É? O NEUROBLASTOMA Coluna Vertebral Glândula supra-renal O NEUROBLASTOMA O QUE SIGNIFICA ESTADIO? O QUE É O NEUROBLASTOMA? O neuroblastoma é um tumor sólido maligno, o mais frequente em Pediatria

Leia mais

Aula desgravada de Biopatologia DOENÇAS DEGENERATIVAS MITOCONDRIAIS E LISOSSÓMICAS INTRODUÇÃO

Aula desgravada de Biopatologia DOENÇAS DEGENERATIVAS MITOCONDRIAIS E LISOSSÓMICAS INTRODUÇÃO Aula desgravada de Biopatologia DOENÇAS DEGENERATIVAS MITOCONDRIAIS E LISOSSÓMICAS Leccionada por: Prof. Paula Duarte INTRODUÇÃO Grandes grupos de doenças: - degenerativas - inflamatórias - neoplásicas

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

1º modelo: doença degenerativa

1º modelo: doença degenerativa 2ª Aula de Biopatologia 18/09/2006 Medicina molecular: Da nova Biologia à Clínica Nesta aula vamos falar de três modelos de relevância entre a biologia básica e a clínica. 1º modelo: doença degenerativa

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Faculdade de Medicina da Universidade do Porto

Faculdade de Medicina da Universidade do Porto Faculdade de Medicina da Universidade do Porto Instabilidade Genética e Cancerização Prof. José Carlos Machado 5 Março 2007 Hoje vamos falar sobre instabilidade genética e cancerização. Há uma lógica de

Leia mais

TIPOS DE MUTAÇÕES UNIDADE DE DOENÇAS METABÓLICAS- HOSPITAL SANT JOAN DE DÉU

TIPOS DE MUTAÇÕES UNIDADE DE DOENÇAS METABÓLICAS- HOSPITAL SANT JOAN DE DÉU TIPOS DE MUTAÇÕES Para uma melhor leitura e compreensão deste módulo, recomendamos a consulta de um artigo anterior, onde se explica como se formam as proteínas a partir do DNA. Muitas das terapias que

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Apoptose em Otorrinolaringologia

Apoptose em Otorrinolaringologia Apoptose em Otorrinolaringologia Teolinda Mendoza de Morales e Myrian Adriana Pérez García Definição A apoptose é um processo biológico existente em todas as células de nosso organismo, conhecida desde

Leia mais

Parte III: Manipulação da informação

Parte III: Manipulação da informação Parte III: Manipulação da informação Novos alvos terapêuticos É possível fazer uma classificação molecular dos tumores e correlacionar com prognóstico. E agora? Leucémias agudas : LMA (L. Mieloblástica

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

netxplica.com Biologia e Geologia :: 11.º Ano

netxplica.com Biologia e Geologia :: 11.º Ano VERSÃO 1 Teste de Avaliação de Biologia e Geologia 11.º Ano de Escolaridade Crescimento e Renovação Celular Duração do Teste: 120 minutos Indicações: Na folha de respostas, indica de forma legível a versão

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais

Resposta imunológica a. Ronei Luciano Mamoni

Resposta imunológica a. Ronei Luciano Mamoni Resposta imunológica a tumores Ronei Luciano Mamoni Tumores Conceitos gerais Neoplasias conceito Neoplasia (neo= novo + plasia = tecido) é o termo que designa alterações celulares que acarretam um crescimento

Leia mais

Carlos Sinogas - Biotecnologia 2014/15

Carlos Sinogas - Biotecnologia 2014/15 Terapia genética Técnica para corrigir efeitos de genes responsáveis por patologias Métodos Inserção de gene normal para substituição de gene não funcional Correcção do gene anormal (mutações especí?icas,

Leia mais

Biologia 12.º Ano. - Património Genético -

Biologia 12.º Ano. - Património Genético - Biologia 12.º Ano - Património Genético - Genética Humana, Organização e regulação do material genético, Alterações do material genético e Genética do Cancro Autor: Francisco Cubal I- Genética Humana Os

Leia mais

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama Câncer de Mama Princípios Básicos História Natural Epidemiologia IZABELLA SERAPHIM PITANGA Mastologista do Núcleo da Mama O QUE É CÂNCER? Câncer é o nome dado a um conjunto de mais de 100 doenças que têm

Leia mais

O QUE É? A LEUCEMIA MIELOBLÁSTICA AGUDA

O QUE É? A LEUCEMIA MIELOBLÁSTICA AGUDA O QUE É? A LEUCEMIA MIELOBLÁSTICA AGUDA A LEUCEMIA MIELOBLÁSTICA AGUDA O QUE É A LEUCEMIA MIELOBLÁSTICA AGUDA? A Leucemia Mieloblástica Aguda (LMA) é o segundo tipo de leucemia mais frequente na criança.

Leia mais

CANCRO ESTÔMAGO 90% esporádico 10%familiar 1%, no máximo 3% -agregação devida a um defeito genético que pode ou não ser conhecido.

CANCRO ESTÔMAGO 90% esporádico 10%familiar 1%, no máximo 3% -agregação devida a um defeito genético que pode ou não ser conhecido. FACULDADE DE MEDICINA DA UNIVERSIDADE DO PORTO CANCRO GÁSTRICO FAMILIAR PROFESSORA DRA. FÁTIMA CARNEIRO 26/03/07 CANCRO FAMILIAR VS. CANCRO HEREDITÁRIO 1 Familiar há uma agregação numa família de um número

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular Fundação Faculdade Federal de Ciências Médicas de Porto Alegre Disciplina de Genética Humana Curso de Medicina Estudo Dirigido: Ciclo Celular 1. Qual o papel de G0 no ciclo celular? Células ativas em divisão

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Tipos de enxertos. Tipos de Enxertos: Tipos de Enxertos: O que é um transplante? Imunologia dos Transplantes. Singênicos

Tipos de enxertos. Tipos de Enxertos: Tipos de Enxertos: O que é um transplante? Imunologia dos Transplantes. Singênicos O que é um transplante? Imunologia dos Transplantes Prof.Dr. Gilson Costa Macedo Processo de retirada de células, tecidos ou órgãos, chamados enxertos, de um indivíduo e a sua inserção em um indivíduo

Leia mais

Pesquisa 78 Relatório Anual INCA 2004 Pesquisa

Pesquisa 78 Relatório Anual INCA 2004 Pesquisa A produção do conhecimento científico, a formação de pesquisadores e a promoção do intercâmbio entre instituições nacionais e estrangeiras têm crescido nos últimos anos no INCA, onde são desenvolvidas

Leia mais

Reprogramação Celular. Pítia Ledur pitialedur@gmail.com

Reprogramação Celular. Pítia Ledur pitialedur@gmail.com Reprogramação Celular Pítia Ledur pitialedur@gmail.com Reprogramação Celular O que é isso? ipsc = induced pluripotent stem cells Shinya Yamanaka Reprogramação Celular O que é isso? ipsc = induced pluripotent

Leia mais

Toxicologia in vitro: Principais modelos utilizados

Toxicologia in vitro: Principais modelos utilizados Toxicologia in vitro: Principais modelos utilizados Alexandre Bella Cruz Rilton Alves de Freitas Toxicologia in vitro: Principais modelos utilizados Objetivo Conhecer Métodos para Avaliação de Genotoxicidade

Leia mais

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado.

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Profª Ana Luisa Miranda Vilela CICLO CELULAR e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Grande número de células se dividem continuamente, substituindo as que

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE NISE HITOMI YAMAGUCHI ONCOLOGISTA E IMUNOLOGISTA UNIVERSIDADE DE SÃO PAULO MINISTÉRIO DA SAÚDE-ESTADO DE SÃO PAULO ENERGIA NUCLEAR DIAGNÓSTICO NA MEDICINA

Leia mais

PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS? PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS

PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS? PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS E O ESPAÇO DA ATIVIDADE FÍSICA PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS Amar é descobrir que a deficiência do próximo faz parte do perfeito mosaico

Leia mais

Com Ciência - Células-tronco: a promessa da medicina regenerativa

Com Ciência - Células-tronco: a promessa da medicina regenerativa Página 1 de 5 Editorial A esperança celular Carlos Vogt Reportagens Pesquisa brasileira em CT já apresenta resultados Em meio à discussão ética, a pesquisa avança em todo o mundo Faltam leis, sobra polêmica

Leia mais

PROGRAMA DE DISCIPLINA: BIOQUÍMICA

PROGRAMA DE DISCIPLINA: BIOQUÍMICA PROGRAMA DE DISCIPLINA: BIOQUÍMICA Departamento de Ciências Fisiológicas Carga horária total: 188h Ano letivo: 2012 - Série: 1º ano - Curso de Medicina Coordenador: Professor Doutor Wagner Ricardo Montor

Leia mais

Morte Celular Programada (Apoptose)

Morte Celular Programada (Apoptose) UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR Morte Celular Programada (Apoptose) Profa. Dra. Nívea Macedo APOPTOSE A morte celular desempenha

Leia mais

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Departamento de Biologia Celular e Molecular Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Tema: Bases Moleculares do Câncer e Ação A

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

24/8/2013 ALIMENTOS ORGÂNICOS ALIMENTOS ORGÂNICOS

24/8/2013 ALIMENTOS ORGÂNICOS ALIMENTOS ORGÂNICOS TRANSGÊNICOS Os alimentos transgênicos são geneticamente modificados com o objetivo de melhorar a qualidade e aumentar a produção e a resistência às pragas. Pontos positivos - Aumento da produção - Maior

Leia mais

TUMOR-BUSTING. Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro.

TUMOR-BUSTING. Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro. TUMOR-BUSTING Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro. VÍRUS Isolar nas terapias Células tumorais Evitar danos Células normais Eliminar muitos efeitos colaterais nocivos

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

O QUE É? O LINFOMA DE HODGKIN

O QUE É? O LINFOMA DE HODGKIN O QUE É? O LINFOMA DE HODGKIN Gânglio Linfático O LINFOMA DE HODGKIN O QUE É O LINFOMA DE HODGKIN? O linfoma de Hodgkin é um cancro do sistema linfático, que surge quando as células linfáticas se alteram

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Introdução 50.000 novos casos por ano DNA microarray imuno-histoquímica (IHQ) tissue microarray (TMA) técnicas alternativas de construção de TMA

Introdução 50.000 novos casos por ano DNA microarray imuno-histoquímica (IHQ) tissue microarray (TMA) técnicas alternativas de construção de TMA Introdução No Brasil o câncer de mama é a neoplasia maligna mais freqüente, com cerca de 50.000 novos casos por ano. Na última década, avanços na área da patologia molecular permitiram o reconhecimento

Leia mais

Descrição do esfregaço

Descrição do esfregaço Descrição do esfregaço Série vermelha: microcitose e hipocromia acentuadas com hemácias em alvo. Policromasia discreta. Série branca: sem anormalidades morfológicas Série plaquetária: sem anormalidades

Leia mais

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015 UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES ONCOGÊNESE O QUE É O CÂNCER Câncer é o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado (maligno) de células

Leia mais

Denominação geral dos tumores

Denominação geral dos tumores Imunologia dos tumores Denominação geral dos tumores Carcinomas - derivados de células epiteliais (rim, fígado, epitélio gastro-intestinal) Sarcomas - originários de fibroblastos, células musculares e

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil Grupo de Protecção e Segurança Radiológica 1st Workshop for Stakeholders - 6 de Dezembro de 2013 Radioactividade A radioactividade existe desde a formação do Universo, e os seres humanos viveram sempre

Leia mais

INTRODUÇÃO. Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos.

INTRODUÇÃO. Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos. CANCRO INTRODUÇÃO Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos. Dividindo-se rapidamente, estas células tendem a ser muito agressivas e incontroláveis. O QUE É CANCRO Cancro

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

a) A diversidade de anticorpos é derivada da recombinação das regiões, e.

a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Questão 1 Preencha as lacunas a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Verdadeiro ou falso. Se falso, altere a declaração de modo a torná-la verdadeira. b) A exposição

Leia mais

Redações vencedoras I Concurso de Redação

Redações vencedoras I Concurso de Redação Redações vencedoras I Concurso de Redação 1 Lugar Aluno: Julia Stefani Moraes Professora: Regina M. Macedo de Melo Castro Informação: A melhor maneira de combater o câncer Penso que falar sobre este assunto

Leia mais

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Princípios de Oncologia Clínica Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Histórico 1900 Termo Quimioterapia Dr. Paul Ehrlich (1854-1915) Anos 40 Segunda Guerra Mundial Ilha de Bali 1943

Leia mais

PAPERPET. Caio Mayrink Maio/2011

PAPERPET. Caio Mayrink Maio/2011 PAPERPET Caio Mayrink Maio/2011 RAD51 G135C POLYMORPHISM IS ASSOCIATED WITH BREAST CANCER SUSCEPTIBILITY: A META-ANALYSIS INVOLVING 22,399 SUBJECTS Haiming Sun, Jing Bai, Feng Chen, Yan Jin, Yang Yu, Lianhong

Leia mais

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Hospital A.C.Camargo, um dos principais centros de diagnóstico, tratamento, ensino e pesquisa sobre o câncer da América Latina. Pesquisadores que

Leia mais

Células estaminais e medicina regenerativa

Células estaminais e medicina regenerativa Faculdade de Medicina da Universidade do Porto Biopatologia 2006/2007 11ª Aula Teórica: 27/11/06 Aula dada por: Dr. Raquel Almeida Células estaminais e medicina regenerativa Hoje eu vou falar de células

Leia mais

Complexo principal de histocompatibilidade

Complexo principal de histocompatibilidade Complexo principal de histocompatibilidade Todas as espécies possuem um conjunto de genes denominado MHC, cujos produtos são de importância para o reconhecimento intercelular e a discriminação do que é

Leia mais

MARCADORES TUMORAIS EM DESTAQUE

MARCADORES TUMORAIS EM DESTAQUE Adriana Helena Sedrez Farmacêutica Bioquímica Especialista em Microbiologia Clínica pela PUC-PR Coordenadora do setor de Hematologia Clínica, responsável pelo Atendimento ao Cliente e gerente de Recursos

Leia mais

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo Aula - Terapia Gênica Unidade Curricular: Cultura de Células Animais Prof. Me. Leandro Parussolo O que é? O que não é? O que será? 1990 (EUA) - Primeiro protocolo clínico de Terapia Gênica em humanos 2

Leia mais

NEOPLASIAS. Prof. Dr. Fernando Ananias

NEOPLASIAS. Prof. Dr. Fernando Ananias NEOPLASIAS Prof. Dr. Fernando Ananias Neoplasia = princípio básico CLASSIFICAÇÃO DOS TUMORES Comportamento Benigno versus Maligno Crescimento lento rápido Semelhança com O tecido de origem (Diferenciação)

Leia mais

Objectivos gerais do ciclo de estudos:

Objectivos gerais do ciclo de estudos: Informações Gerais e Oferta Formativa de Cursos Avançados 1º Edição (2015-2019) Programa de Doutoramento em Ciências Biológicas Aplicadas à Saúde PhD program in Biological Sciences Applied to Health Objectivos

Leia mais

Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas. Rudolf Virchow, 1958

Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas. Rudolf Virchow, 1958 Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas Rudolf Virchow, 1958 CICLO CELULAR A vida das células é formada por dois períodos:

Leia mais

Imunossupressores e Agentes Biológicos

Imunossupressores e Agentes Biológicos Imunossupressores e Agentes Biológicos Histórico Início da década de 1960 Transplantes Prof. Herval de Lacerda Bonfante Departamento de Farmacologia Doenças autoimunes Neoplasias Imunossupressores Redução

Leia mais

Genética III: Genética Humana

Genética III: Genética Humana Genética III: Genética Humana 1. Genética Humana As árvores genealógicas são usadas para mostrar a herança de doenças genéticas humanas. Uma árvore genealógica na qual é possível rastrear o padrão de herança

Leia mais

Mandado de segurança contra ato do Secretário Municipal de Saúde RITUXIMABE PARA LINFOMA NÃO-HODGKIN FOLICULAR TRANSFORMADO EM DIFUSO

Mandado de segurança contra ato do Secretário Municipal de Saúde RITUXIMABE PARA LINFOMA NÃO-HODGKIN FOLICULAR TRANSFORMADO EM DIFUSO Data: 08/12/2012 Nota Técnica 2012 Juízo da 4ª Vara de Fazenda Pública Municipal Juiz Renato Dresh Numeração Única: 3415341-21.201 Impetrante Marlene Andrade Montes Medicamento Material Procedimento Cobertura

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

Pode ser difícil para si compreender o seu relatório patológico. Pergunte ao seu médico todas as questões que tenha e esclareça todas as dúvidas.

Pode ser difícil para si compreender o seu relatório patológico. Pergunte ao seu médico todas as questões que tenha e esclareça todas as dúvidas. Perguntas que pode querer fazer Pode ser difícil para si compreender o seu relatório patológico. Pergunte ao seu médico todas as questões que tenha e esclareça todas as dúvidas. Estas são algumas perguntas

Leia mais

Mutações e Polimorfismos gênicos

Mutações e Polimorfismos gênicos DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos psantos@catolica-es.edu.br O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual

Leia mais

- Ambulatório: Termo usado geralmente em regime de tratamentos não obriga a estar acamado ou em observação;

- Ambulatório: Termo usado geralmente em regime de tratamentos não obriga a estar acamado ou em observação; A - Ambulatório: Termo usado geralmente em regime de tratamentos não obriga a estar acamado ou em observação; - Ajudas técnicas: segundo a ISO (Organização Internacional de Normalização entidade internacional

Leia mais

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER A EVOLUÇÃO DA LUTA CONTRA O CÂNCER Vanessa Gabriela Martins Pereira, Thaís Nogueira Silva, Laísa de Fátima Rangel, Karen Dias Ferreira, Hadassa Cristina Souza dos Santos, Gisele Aparecida de Castro Moreira,

Leia mais

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora.

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora. QUESTÃO 1 "Ceará joga fora opção alimentar" Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabeça de lagosta não são aproveitadas sendo lançadas ao mar. "0 estudo sobre hidrólise enzimática

Leia mais

COMUNICAÇÃO CELULAR. Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto

COMUNICAÇÃO CELULAR. Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto COMUNICAÇÃO CELULAR Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto O que é comunicação celular? As células possuem um sistema responsável por: Geração Transmissão Recepção Resposta. Uma

Leia mais

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE Cláudio Martin Jonsson Vera Lúcia Castro Jaguariúna, outubro 2005. O modelo de agricultura utilizado atualmente visa

Leia mais

Introdução: Objetivo. Materiais e métodos:

Introdução: Objetivo. Materiais e métodos: Estudo das alterações citogenéticas em pacientes com suspeita clínica de síndrome mieloproliferativa e em pacientes com leucemia mielóide crônica em uso de imatinib. Experiência do laboratório Sérgio Franco

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Considerando as informações básicas sobre as células e os tecidos envolvidos no processo de formação dos dentes, responda:

Considerando as informações básicas sobre as células e os tecidos envolvidos no processo de formação dos dentes, responda: 2º Processo Seletivo/2004 3º DIA BIOLOGIA 5 05. Cientistas do King s College, de Londres, receberam recursos da ordem de R$ 2,6 milhões para ajudá-los a desenvolver dentes humanos a partir de células-tronco.

Leia mais

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia urso Área Disciplinar icenciatura em iências Biomédicas oxicologia () no lectivo 203/204 Docente ema Duração Mestre Dr. uis Silva Santos. onceitos erais em oxicologia 6 horas () : onceitos gerais em oxicologia

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

O QUE É? O HEPATOBLASTOMA

O QUE É? O HEPATOBLASTOMA O QUE É? O HEPATOBLASTOMA Fígado O HEPATOBLASTOMA O QUE SIGNIFICA ESTADIO? O QUE É O HEPATOBLASTOMA? O hepatoblastoma é o tipo de tumor maligno do fígado mais frequente na criança; na maioria dos casos

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais