O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

Tamanho: px
Começar a partir da página:

Download "O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária."

Transcrição

1 Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

2

3

4 Introdução Agentes internos ou externos causam alterações nos genes ou nos cromossomas MUTAÇÕES (ex: anemia falciforme, trissomia 21) Tecnologia permite alterar o genoma dos indivíduos ENGENHARIA GENÉTICA (ex: gene da insulina é inserido em bactéria - OGM)

5 Mutações O que são? São alterações ou modificações súbitas, espontâneas, em genes ou cromossomas, podendo acarretar variação hereditária. As mutações podem ser génicas quando alteram a estrutura do DNA, num determinado gene, ou cromossómicas quando alteram a estrutura ou o número de cromossomas.

6 As mutações são espontâneas e podem ser silenciosas, ou seja, não alterar a proteína ou sua acção. Podem ainda ser letais, quando provocam a morte, ou ainda acarretar doenças ou anomalias. As mutações também promovem a evolução já que determinam aumento na variabilidade genética.

7 Onde / Como ocorrem? Por erros na replicação de DNA que antecede uma divisão celular (mitose ou meiose). Por erros relacionados com a individualização dos cromossomas, por exemplo no crossing-over, na separação de cromossomas ou de cromatídeos, durante uma divisão celular (meiose ou mitose)

8 Onde ocorrem? Nas células somáticas (durante a mitose) reflectindo-se nas células, desse indivíduo, descendentes da que sofreu a mutação (ex: tumores). Na formação dos gâmetas (meiose) - células da linhagem germinativa - e serão transmitidas hereditariamente.

9 Mutações génicas Alteram a sequência de nucleótidos de um gene (alteram uma ou mais bases do DNA), o que afectará a leitura durante a replicação ou durante a transcrição. Constitui-se assim um alelo, uma nova versão, do gene alterado.

10 Mutações génicas Substituição ocorre a troca de ocorre a troca de um ou mais pares de bases.

11 Mutações génicas Inserção e delecção acontece quando uma ou mais bases são adicionadas ou removidas, respectivamente, ao DNA, modificando a sequência de leitura da molécula durante a replicação ou a transcrição.

12 Mutações cromossómicas Também chamadas de aberrações cromossómicas, são alterações na estrutura ou no número de cromossomas normal da espécie. Podem ocorrer nos autossomas ou em cromossomas sexuais. Podem provocar anomalias e mal formações no organismo ou até a inviabilidade dele. 12 Dezembro 2005

13 Causas As mutações podem ocorrer espontaneamente na Natureza ou serem induzidas por exposição a agentes físicos e químicos (agentes mutagénicos) Agentesmutagénicos Físicos - raios X, radiação alfa, beta e gama e raios ultravioleta Químicos - colquicina, gás mostarda, nitrosaminas, constituintes do fumo do tabaco, etc. As células possuem a capacidade de reparar muitos dos erros do DNA causados pelos agentes mutagénicos. Quando o equilíbrio entre a mutagénese e a reparação se rompe surge a mutação.

14 Causas As mutações espontâneas ocorrem com frequência muito reduzida Quando a exposição é prolongada ou a intensidade dos agentes mutagénicos é elevada, aumenta a frequência das mutações. A exposição a agentes mutagénicos é, em alguns casos, natural e inevitável, como a exposição a fontes naturais de radiação solar, radioactividade de minerais, ( ) mas, a intensidade com que atingem os organismos provoca baixo nº de mutações. A exposição a agentes mutagénicos pode ser deliberada: - para fins médicos (Ex: raios X); - por hábitos (alimentares ou outros); - com fins bélicos (Ex: gás mostarda, armas nucleares)

15 Causas - mutação e cancro Alguns agentes mutagénicos provocam mutações em genes envolvidos no controlo da divisão celular sendo responsáveis pelo aparecimento de cancro (tumor ou neoplasia maligna). São pois, também, agentes carcinogénicos.

16 Causas - mutação e cancro PROTO-O COGE ES (genes envolvidos na síntese de proteínas que estimulam e controlam o crescimento e divisão celular. Estão inactivos em células que não se dividem.) Agentes mutagénicos O COGE ES (gene mutado responsável pela síntese de proteínas com maior actividade estimulando anormalmente a divisão celular) Cancro

17 Causas - mutação e cancro GE ES SUPRESSORES TUMORAIS / anti-oncogenes (genes envolvidos na síntese de proteínas que bloqueiam e controlam a divisão celular. Estão normalmente activos.) Agentes mutagénicos Gene mutado incapaz de bloquear a divisão celular que se realiza descontroladamente Cancro

18

Mutações e Polimorfismos gênicos

Mutações e Polimorfismos gênicos DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos psantos@catolica-es.edu.br O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual

Leia mais

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária.

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. MUTAÇÕES Mutações São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. As mutações podem ser génicas quando alteram a estrutura do DNA ou cromossómicas

Leia mais

Alterações do material genético

Alterações do material genético Alterações do material genético Alterações do material genético Agentes internos ou externos causam alterações nos genes ou nos cromossomas MUTAÇÕES (ex: anemia falciforme, trissomia 21) Tecnologia permite

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

As Mutações. Aumento da biodiversidade

As Mutações. Aumento da biodiversidade As Mutações Aumento da biodiversidade Mutações As mutações são espontâneas e podem ser silenciosas, ou seja, não alterar a proteína ou sua ação. Podem ainda ser letais, quando provocam a morte, ou ainda

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

1.- De Mendel a Morgan. Componentes básicos das células

1.- De Mendel a Morgan. Componentes básicos das células 1.- De Mendel a Morgan Componentes básicos das células Conceitos mendelianos de genética QUESTÂO: Existe uma base celular para as características hereditárias? Período 1850-1865: Charles Darwin e Gregor

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº . 3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº Valor: 10 Nota:. 1. (Uel 2015) Leia o texto a seguir. Quando se fala em divisão celular, não

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

Fenótipo: Factores ambientais

Fenótipo: Factores ambientais MUTAÇÕES Fenótipo: Factores ambientais Genoma Mutações: são alterações ou modificações súbitas em genes ou cromossomas, podendo provocar uma variação hereditária ou uma mudança no fenótipo. Pode produzir

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia urso Área Disciplinar icenciatura em iências Biomédicas oxicologia () no lectivo 203/204 Docente ema Duração Mestre Dr. uis Silva Santos. onceitos erais em oxicologia 6 horas () : onceitos gerais em oxicologia

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA DADOS DE IDENTIFICAÇÃO Campus: Uruguaiana Curso: Enfermagem Componente Curricular: Genética Humana Código: UR 1303 Pré requisito: UR 1103 Co- requisito: ---------- Professor: Michel Mansur Machado Carga

Leia mais

03. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da técnica de clonagem.

03. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da técnica de clonagem. 01. Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e, em humanos,

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

Fundamentos da Evolução

Fundamentos da Evolução Fundamentos da Evolução UNIDADE VIII EVOLUÇÃO CAPÍTULO 24 Aula 02 Teorias evolucionistas Teoria Sintética Fatores evolutivos TEORIA SINTÉTICA DA EVOLUÇÃO Neodarwinismo Século XX Combina seleção natural

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

?respondaessa O que acontece com o corpo com anemia?

?respondaessa O que acontece com o corpo com anemia? 26 2 DOENÇAS DO SANGUE O sangue é um tecido fundamental à manutenção de todos os demais tecidos e órgãos do organismo humano. O equilíbrio entre o ritmo de produção e de destruição das células do sangue,

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA MUTAÇÕES Eduardo Dias Embora um dos mais importantes requisitos do material genético seja a sua estabilidade, a capacidade de mudança também é necessária. As mutações gênicas são importantes para a evolução

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas.

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. 2 Habilidade: Conceituar mutações gênicas e cromossômicas, compreendendo como podem influenciar nossas vidas. 3 REVISÃO

Leia mais

Faculdade de Medicina da Universidade do Porto

Faculdade de Medicina da Universidade do Porto Faculdade de Medicina da Universidade do Porto Instabilidade Genética e Cancerização Prof. José Carlos Machado 5 Março 2007 Hoje vamos falar sobre instabilidade genética e cancerização. Há uma lógica de

Leia mais

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil Grupo de Protecção e Segurança Radiológica 1st Workshop for Stakeholders - 6 de Dezembro de 2013 Radioactividade A radioactividade existe desde a formação do Universo, e os seres humanos viveram sempre

Leia mais

O NÚCLEO E OS CROMOSSOMOS. Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com

O NÚCLEO E OS CROMOSSOMOS. Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com O NÚCLEO E OS CROMOSSOMOS Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com O NÚCLEO Estrutura presente apenas nas células eucariontes, onde se encontra o DNA genômico

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Aula 8 META Discutir os principais mecanismos geradores de mutação e suas conseqüências, assim como o papel dos mecanismos de reparo do DNA na manutenção da estabilidade e sobrevivência

Leia mais

TERAPIA GÊNICA. Brasília DF, Julho de 2010.

TERAPIA GÊNICA. Brasília DF, Julho de 2010. Apresentação desenvolvida pelas graduandas em Ciências Farmacêuticas: Ana Carolina Macedo Lima, Ariane Mugnano Castelo Branco, Caroline Cardoso Mendes Souza, Clarisse Danielli Silva Albergaria, Jéssica

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos Antonio Luiz Gomes Júnior Genotoxicidade Definição: é o setor da genética que estuda os processos que alteram

Leia mais

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores.

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores. BIO V7 CAP 19 19.01 O genótipo do casal III-2 e III-3 é X A X a x X a y. Fazendo o cruzamento os filhos podem ser: X A X a, X A Y, X a X a, X a Y. Como se pode observar qual é o masculino e qual é o feminino,

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º Avisos 1. Este documento apenas serve comoapoio parcial às aulas de Biologia 12.ºano Unidade 2 - leccionadas na Escola Secundária Morgado Mateus(Vila Real) pelo

Leia mais

ARBORICULTURA I. Propagação de Plantas

ARBORICULTURA I. Propagação de Plantas ARBORICULTURA I Propagação de Plantas O que é a propagação de plantas? É a multiplicação de indivíduos do reino vegetal, por métodos sexuados ou assexuados, por forma a obter na descendência um determinado

Leia mais

PRINCÍPIOS DE GENÉTICA MÉDICA

PRINCÍPIOS DE GENÉTICA MÉDICA PRINCÍPIOS DE GENÉTICA MÉDICA Conceitos Genética / Genômica Doença genética Hereditariedade Congênito DNA / Gene / Locus / Alelo Homozigoto / Heterozigoto Cromossomos Autossomos Sexuais Dominante / Recessivo

Leia mais

Tema 5. Crescimento e renovação celular. UNIDADE 1. Crescimento e renovação celular

Tema 5. Crescimento e renovação celular. UNIDADE 1. Crescimento e renovação celular Tema 5. Crescimento e renovação celular Crescimento e renovação celular Distinção entre DNA e RNA quanto às suas características estruturais e funcionais. Reconhecimento de que os organismos necessitam

Leia mais

O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. denominado interfase (núcleo interfásico).

O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. denominado interfase (núcleo interfásico). NÚCLEO E DIVISÃO CELULAR NÚCLEO E DIVISÃO CELULAR O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. Período em que a célula não se encontra em divisão é denominado

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado Biologia-Geologia 11ºano Novembro de 2006 Científico-Humanísticos Curso Ciências e Tecnologias A hemoglobina Cada molécula de hemoglobina consiste em dois pares separados de globinas alfa e beta (cadeias

Leia mais

Núcleo e ciclo celular

Núcleo e ciclo celular Módulo 2 Unidade 4 Núcleo e ciclo celular Para início de conversa... Você já reparou que para que todas as coisas funcionem corretamente é preciso que haja organização? É preciso que algumas pessoas comandem,

Leia mais

Mecanismos de variabilidade genética em agentes fitopatogênicos

Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Coevolução hospedeiro - patógeno Parasitismo estratégia de vida de conexão

Leia mais

GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular

GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular Curso: Nutricius Vitae GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular www.hgsc.bcm.tmc.edu/graphics/genome3.jpg Profª. Cibele Velloso Rodrigues 2009 e-mail: cvbiogenet@yahoo.com.br Conteúdo

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Mutações somáticas x Mutações germinativas Tipos de mutações MUTAÇÃO GENÔMICA:

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre Disciplina: Biologia Educacional Curso: Pedagogia 2 Semestre Texto 2: GENÉTICA HEREDITARIEDADE A genética é um a ciência que estuda o material hereditário e os mecanismos de sua transmissão de geração

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr.

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr. DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS Prof. Olayr Modesto Jr. INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas

Leia mais

Genética. Leis de Mendel

Genética. Leis de Mendel Genética Leis de Mendel DEFINIÇÕES GENES: Pedaços de DNA síntese de determinada proteína. LOCUS GÊNICO: É o local ocupado pelo gene no cromossomo. GENES ALELOS: Situam-se no mesmo Locus Gênico. HOMOZIGOTOS:

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3.

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. CONHECIMENTO ESPECÍFICO SOBRE O CÂNCER NÃO AUMENTA CONSCIENTIZAÇÃO. Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. 1 Voluntária Iniciação Científica PVIC/UEG 2 Pesquisadora Orientadora

Leia mais

Técnicas de manipulação cromossomica

Técnicas de manipulação cromossomica Técnicas de manipulação cromossomica Introdução Genética Contribuição Aquacultura Moderna Utilização de técnicas usadas em biotecnologia e engenharia genética Facilmente aplicadas nos peixes: Geralmente,

Leia mais

Escola Estadual Dr. Pedro Afonso de Medeiros

Escola Estadual Dr. Pedro Afonso de Medeiros Escola Estadual Dr. Pedro Afonso de Medeiros Professora Amara Maria Pedrosa Silva Aluno(a) nº: Aluno(a) nº: Aluno(a) nº: Série: 3ª Curso Turma: Data: / / Trabalho de Biologia 2ª Unidade QUESTÃO 001 (UFMS)

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Módulo Intérfase. Tarefa de Fixação 1) Analise o esquema a seguir e depois RESPONDA as questões propostas.

Módulo Intérfase. Tarefa de Fixação 1) Analise o esquema a seguir e depois RESPONDA as questões propostas. Módulo Intérfase Exercícios de Aula 1) A interfase é a fase em que ocorre o repouso celular. A afirmativa está: a) correta, porque praticamente não há atividade metabólica celular. b) correta, pois ocorrem

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Sumário Capítulo 12 Mutações gênicas e cromossômicas...1 Capítulo 13 Desvendando o genoma humano...4 Capítulo 14 Câncer Genética do controle celular aberrante...5 Capítulo 12

Leia mais

PLANEJAMENTO ANUAL / TRIMESTRAL 2013 Conteúdos Habilidades Avaliação

PLANEJAMENTO ANUAL / TRIMESTRAL 2013 Conteúdos Habilidades Avaliação SGAS Q. 906 Conj. E C.P. 30 Fone: (061) 3443-7878 Disciplina: Biologia Trimestre: 1º Professor(a): Elizangela (B1), Guilherme (B) Série: 3º Turmas: 301, 30, 303, 304 PLANEJAMENTO ANUAL / TRIMESTRAL 013

Leia mais

EFEITOS BIOLÓGICOS PROVOCADOS PELA RADIAÇÃO IONIZANTE EM SERES HUMANOS

EFEITOS BIOLÓGICOS PROVOCADOS PELA RADIAÇÃO IONIZANTE EM SERES HUMANOS EFEITOS BIOLÓGICOS PROVOCADOS PELA RADIAÇÃO IONIZANTE EM SERES HUMANOS EDVAN ANTONIO DOGIVAL Discente do Curso de Radiologia das Faculdades Integradas de Três Lagoas AEMS KLEITON TEODORO DOS SANTOS Discente

Leia mais

Redações vencedoras I Concurso de Redação

Redações vencedoras I Concurso de Redação Redações vencedoras I Concurso de Redação 1 Lugar Aluno: Julia Stefani Moraes Professora: Regina M. Macedo de Melo Castro Informação: A melhor maneira de combater o câncer Penso que falar sobre este assunto

Leia mais

ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS. Bruna Lima Barbosa

ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS. Bruna Lima Barbosa ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS Bruna Lima Barbosa INTRODUÇÃO Os cromossomos podem variar: Tamanho; Posição do centrômero; Quantidade de DNA; Heterocromatina; Número ou posição de bandas

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto Exercícios Genética e sistema imunitário Professora: Ana Paula Souto Nome: n o : Turma: 1) Cite as diferenças entre mitose e meiose. Relacione o número de cromossomos da célulamãe com o das células-filhas.

Leia mais

PlanetaBio Resolução de Vestibulares FUVEST 2006 2ª fase www.planetabio.com

PlanetaBio Resolução de Vestibulares FUVEST 2006 2ª fase www.planetabio.com 1-O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. Com relação a esse ambiente: a) Indique os consumidores primários. b) Dentre

Leia mais

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade A A Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade 2 A A Habilidade: Conhecer sobre células- troncos, projeto genoma e engenharia genética. 3 A A Células-tronco Autorrenovação e diferenciação

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Herança Multifatorial Herança Monogênica Herança Cromossômica Padrões de Herança Distúrbios Monogênicos São determinados por um

Leia mais

Mutações Cromossômicas Estruturais

Mutações Cromossômicas Estruturais Genética Básica Mutações Cromossômicas Estruturais Aline Intorne Definição: Mudança substancial na estrutura do cromossomo, possivelmente, afetando mais do que um único gene. Segmentos de cromossomos podem

Leia mais

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I Leia o texto abaixo com atenção. Considere que, nos pombos, a ausência de s é condicionada geneticamente. Nos cruzamentos que um criador realizava, ele observou

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA -> mutação -> doença Mutação em regiões controladoras e codificantes Mecanismos de Reparo Fita simples

Leia mais

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII Título do Podcast Área Segmento Duração Por que você se parece com sua avó? A genética vai ajudá-lo a entender como isso é possível! Ciências Ciências da Natureza

Leia mais

INF 1771 Inteligência Artificial

INF 1771 Inteligência Artificial Edirlei Soares de Lima INF 1771 Inteligência Artificial Aula 04 Algoritmos Genéticos Introdução Algoritmos genéticos são bons para abordar espaços de buscas muito grandes e navegálos

Leia mais

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular.

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular. Módulo Núcleo Exercícios de Aula 1) O envelope nuclear encerra o DNA e define o compartimento nuclear. Assinale a afirmativa INCORRETA sobre o envelope nuclear. a) É formado por duas membranas concêntricas

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

netxplica.com Biologia e Geologia :: 11.º Ano

netxplica.com Biologia e Geologia :: 11.º Ano VERSÃO 1 Teste de Avaliação de Biologia e Geologia 11.º Ano de Escolaridade Crescimento e Renovação Celular Duração do Teste: 120 minutos Indicações: Na folha de respostas, indica de forma legível a versão

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais