O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

Save this PDF as:
Tamanho: px
Começar a partir da página:

Download "O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária."

Transcrição

1 Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

2

3

4 Introdução Agentes internos ou externos causam alterações nos genes ou nos cromossomas MUTAÇÕES (ex: anemia falciforme, trissomia 21) Tecnologia permite alterar o genoma dos indivíduos ENGENHARIA GENÉTICA (ex: gene da insulina é inserido em bactéria - OGM)

5 Mutações O que são? São alterações ou modificações súbitas, espontâneas, em genes ou cromossomas, podendo acarretar variação hereditária. As mutações podem ser génicas quando alteram a estrutura do DNA, num determinado gene, ou cromossómicas quando alteram a estrutura ou o número de cromossomas.

6 As mutações são espontâneas e podem ser silenciosas, ou seja, não alterar a proteína ou sua acção. Podem ainda ser letais, quando provocam a morte, ou ainda acarretar doenças ou anomalias. As mutações também promovem a evolução já que determinam aumento na variabilidade genética.

7 Onde / Como ocorrem? Por erros na replicação de DNA que antecede uma divisão celular (mitose ou meiose). Por erros relacionados com a individualização dos cromossomas, por exemplo no crossing-over, na separação de cromossomas ou de cromatídeos, durante uma divisão celular (meiose ou mitose)

8 Onde ocorrem? Nas células somáticas (durante a mitose) reflectindo-se nas células, desse indivíduo, descendentes da que sofreu a mutação (ex: tumores). Na formação dos gâmetas (meiose) - células da linhagem germinativa - e serão transmitidas hereditariamente.

9 Mutações génicas Alteram a sequência de nucleótidos de um gene (alteram uma ou mais bases do DNA), o que afectará a leitura durante a replicação ou durante a transcrição. Constitui-se assim um alelo, uma nova versão, do gene alterado.

10 Mutações génicas Substituição ocorre a troca de ocorre a troca de um ou mais pares de bases.

11 Mutações génicas Inserção e delecção acontece quando uma ou mais bases são adicionadas ou removidas, respectivamente, ao DNA, modificando a sequência de leitura da molécula durante a replicação ou a transcrição.

12 Mutações cromossómicas Também chamadas de aberrações cromossómicas, são alterações na estrutura ou no número de cromossomas normal da espécie. Podem ocorrer nos autossomas ou em cromossomas sexuais. Podem provocar anomalias e mal formações no organismo ou até a inviabilidade dele. 12 Dezembro 2005

13 Causas As mutações podem ocorrer espontaneamente na Natureza ou serem induzidas por exposição a agentes físicos e químicos (agentes mutagénicos) Agentesmutagénicos Físicos - raios X, radiação alfa, beta e gama e raios ultravioleta Químicos - colquicina, gás mostarda, nitrosaminas, constituintes do fumo do tabaco, etc. As células possuem a capacidade de reparar muitos dos erros do DNA causados pelos agentes mutagénicos. Quando o equilíbrio entre a mutagénese e a reparação se rompe surge a mutação.

14 Causas As mutações espontâneas ocorrem com frequência muito reduzida Quando a exposição é prolongada ou a intensidade dos agentes mutagénicos é elevada, aumenta a frequência das mutações. A exposição a agentes mutagénicos é, em alguns casos, natural e inevitável, como a exposição a fontes naturais de radiação solar, radioactividade de minerais, ( ) mas, a intensidade com que atingem os organismos provoca baixo nº de mutações. A exposição a agentes mutagénicos pode ser deliberada: - para fins médicos (Ex: raios X); - por hábitos (alimentares ou outros); - com fins bélicos (Ex: gás mostarda, armas nucleares)

15 Causas - mutação e cancro Alguns agentes mutagénicos provocam mutações em genes envolvidos no controlo da divisão celular sendo responsáveis pelo aparecimento de cancro (tumor ou neoplasia maligna). São pois, também, agentes carcinogénicos.

16 Causas - mutação e cancro PROTO-O COGE ES (genes envolvidos na síntese de proteínas que estimulam e controlam o crescimento e divisão celular. Estão inactivos em células que não se dividem.) Agentes mutagénicos O COGE ES (gene mutado responsável pela síntese de proteínas com maior actividade estimulando anormalmente a divisão celular) Cancro

17 Causas - mutação e cancro GE ES SUPRESSORES TUMORAIS / anti-oncogenes (genes envolvidos na síntese de proteínas que bloqueiam e controlam a divisão celular. Estão normalmente activos.) Agentes mutagénicos Gene mutado incapaz de bloquear a divisão celular que se realiza descontroladamente Cancro

18

Mutações e Polimorfismos gênicos

Mutações e Polimorfismos gênicos DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos psantos@catolica-es.edu.br O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual

Leia mais

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária.

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. MUTAÇÕES Mutações São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. As mutações podem ser génicas quando alteram a estrutura do DNA ou cromossómicas

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Alterações do material genético

Alterações do material genético Alterações do material genético Alterações do material genético Agentes internos ou externos causam alterações nos genes ou nos cromossomas MUTAÇÕES (ex: anemia falciforme, trissomia 21) Tecnologia permite

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

As Mutações. Aumento da biodiversidade

As Mutações. Aumento da biodiversidade As Mutações Aumento da biodiversidade Mutações As mutações são espontâneas e podem ser silenciosas, ou seja, não alterar a proteína ou sua ação. Podem ainda ser letais, quando provocam a morte, ou ainda

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº . 3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº Valor: 10 Nota:. 1. (Uel 2015) Leia o texto a seguir. Quando se fala em divisão celular, não

Leia mais

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA DADOS DE IDENTIFICAÇÃO Campus: Uruguaiana Curso: Enfermagem Componente Curricular: Genética Humana Código: UR 1303 Pré requisito: UR 1103 Co- requisito: ---------- Professor: Michel Mansur Machado Carga

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

1.- De Mendel a Morgan. Componentes básicos das células

1.- De Mendel a Morgan. Componentes básicos das células 1.- De Mendel a Morgan Componentes básicos das células Conceitos mendelianos de genética QUESTÂO: Existe uma base celular para as características hereditárias? Período 1850-1865: Charles Darwin e Gregor

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

03. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da técnica de clonagem.

03. Em fevereiro deste ano, um grupo de pesquisadores divulgou ao mundo a ovelha Dolly, obtido por meio da técnica de clonagem. 01. Clones são seres vivos obtidos pelo desenvolvimento de células retiradas de indivíduos já existentes. A clonagem é um processo que vem sendo desenvolvido rapidamente com vários organismos e, em humanos,

Leia mais

Fundamentos da Evolução

Fundamentos da Evolução Fundamentos da Evolução UNIDADE VIII EVOLUÇÃO CAPÍTULO 24 Aula 02 Teorias evolucionistas Teoria Sintética Fatores evolutivos TEORIA SINTÉTICA DA EVOLUÇÃO Neodarwinismo Século XX Combina seleção natural

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

TERAPIA GÊNICA. Brasília DF, Julho de 2010.

TERAPIA GÊNICA. Brasília DF, Julho de 2010. Apresentação desenvolvida pelas graduandas em Ciências Farmacêuticas: Ana Carolina Macedo Lima, Ariane Mugnano Castelo Branco, Caroline Cardoso Mendes Souza, Clarisse Danielli Silva Albergaria, Jéssica

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

ARBORICULTURA I. Propagação de Plantas

ARBORICULTURA I. Propagação de Plantas ARBORICULTURA I Propagação de Plantas O que é a propagação de plantas? É a multiplicação de indivíduos do reino vegetal, por métodos sexuados ou assexuados, por forma a obter na descendência um determinado

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Mutações Cromossômicas Estruturais

Mutações Cromossômicas Estruturais Genética Básica Mutações Cromossômicas Estruturais Aline Intorne Definição: Mudança substancial na estrutura do cromossomo, possivelmente, afetando mais do que um único gene. Segmentos de cromossomos podem

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

Fenótipo: Factores ambientais

Fenótipo: Factores ambientais MUTAÇÕES Fenótipo: Factores ambientais Genoma Mutações: são alterações ou modificações súbitas em genes ou cromossomas, podendo provocar uma variação hereditária ou uma mudança no fenótipo. Pode produzir

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Módulo Intérfase. Tarefa de Fixação 1) Analise o esquema a seguir e depois RESPONDA as questões propostas.

Módulo Intérfase. Tarefa de Fixação 1) Analise o esquema a seguir e depois RESPONDA as questões propostas. Módulo Intérfase Exercícios de Aula 1) A interfase é a fase em que ocorre o repouso celular. A afirmativa está: a) correta, porque praticamente não há atividade metabólica celular. b) correta, pois ocorrem

Leia mais

Roteiro de Aula Prática 3º ano Prática 16 Alterações Cromossômicas

Roteiro de Aula Prática 3º ano Prática 16 Alterações Cromossômicas Roteiro de Aula Prática 3º ano Prática 16 Alterações Cromossômicas Pergunta: Os cromossomos ou o conjunto deles podem ser alterados? Como isso acontece e quais são as consequências? Objetivos: Diferenciar

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º Avisos 1. Este documento apenas serve comoapoio parcial às aulas de Biologia 12.ºano Unidade 2 - leccionadas na Escola Secundária Morgado Mateus(Vila Real) pelo

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

Mecanismos de variabilidade genética em agentes fitopatogênicos

Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Coevolução hospedeiro - patógeno Parasitismo estratégia de vida de conexão

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS. Bruna Lima Barbosa

ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS. Bruna Lima Barbosa ALTERAÇÕES CROMOSSÔMICAS ESTRUURAIS E NUMÉRICAS Bruna Lima Barbosa INTRODUÇÃO Os cromossomos podem variar: Tamanho; Posição do centrômero; Quantidade de DNA; Heterocromatina; Número ou posição de bandas

Leia mais

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia urso Área Disciplinar icenciatura em iências Biomédicas oxicologia () no lectivo 203/204 Docente ema Duração Mestre Dr. uis Silva Santos. onceitos erais em oxicologia 6 horas () : onceitos gerais em oxicologia

Leia mais

Escola Estadual Dr. Pedro Afonso de Medeiros

Escola Estadual Dr. Pedro Afonso de Medeiros Escola Estadual Dr. Pedro Afonso de Medeiros Professora Amara Maria Pedrosa Silva Aluno(a) nº: Aluno(a) nº: Aluno(a) nº: Série: 3ª Curso Turma: Data: / / Trabalho de Biologia 2ª Unidade QUESTÃO 001 (UFMS)

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Herança Multifatorial Herança Monogênica Herança Cromossômica Padrões de Herança Distúrbios Monogênicos São determinados por um

Leia mais

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil Grupo de Protecção e Segurança Radiológica 1st Workshop for Stakeholders - 6 de Dezembro de 2013 Radioactividade A radioactividade existe desde a formação do Universo, e os seres humanos viveram sempre

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

O NÚCLEO E OS CROMOSSOMOS. Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com

O NÚCLEO E OS CROMOSSOMOS. Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com O NÚCLEO E OS CROMOSSOMOS Maximiliano Mendes - 2015 http://www.youtube.com/maxaug http://maxaug.blogspot.com O NÚCLEO Estrutura presente apenas nas células eucariontes, onde se encontra o DNA genômico

Leia mais

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA MUTAÇÕES Eduardo Dias Embora um dos mais importantes requisitos do material genético seja a sua estabilidade, a capacidade de mudança também é necessária. As mutações gênicas são importantes para a evolução

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores.

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores. BIO V7 CAP 19 19.01 O genótipo do casal III-2 e III-3 é X A X a x X a y. Fazendo o cruzamento os filhos podem ser: X A X a, X A Y, X a X a, X a Y. Como se pode observar qual é o masculino e qual é o feminino,

Leia mais

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre Disciplina: Biologia Educacional Curso: Pedagogia 2 Semestre Texto 2: GENÉTICA HEREDITARIEDADE A genética é um a ciência que estuda o material hereditário e os mecanismos de sua transmissão de geração

Leia mais

PRINCÍPIOS DE GENÉTICA MÉDICA

PRINCÍPIOS DE GENÉTICA MÉDICA PRINCÍPIOS DE GENÉTICA MÉDICA Conceitos Genética / Genômica Doença genética Hereditariedade Congênito DNA / Gene / Locus / Alelo Homozigoto / Heterozigoto Cromossomos Autossomos Sexuais Dominante / Recessivo

Leia mais

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas.

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. 2 Habilidade: Conceituar mutações gênicas e cromossômicas, compreendendo como podem influenciar nossas vidas. 3 REVISÃO

Leia mais

4. (Unifesp 2012) Durante a prófase I da meiose, pode ocorrer o crossing over ou permuta gênica entre os cromossomos das células reprodutivas.

4. (Unifesp 2012) Durante a prófase I da meiose, pode ocorrer o crossing over ou permuta gênica entre os cromossomos das células reprodutivas. 1. (Fuvest 2013) Nas mulheres, uma ovogônia diferencia-se em ovócito primário, que sofre a divisão I da meiose. Dessa divisão, resultam o ovócito secundário e outra célula, chamada primeiro corpúsculo

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS

BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS BIOLOGIA - 2 o ANO MÓDULO 36 MUTAÇÕES: GENÉTICAS E CROMOSSÔMICAS fita simples do gene da ß-globina normal GTGCACCTGACTCCRGAGGAG --- GTGCACCTGACTCCRGTGGAG --- fita simples do gene da ß-globina mutante única

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3.

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. CONHECIMENTO ESPECÍFICO SOBRE O CÂNCER NÃO AUMENTA CONSCIENTIZAÇÃO. Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. 1 Voluntária Iniciação Científica PVIC/UEG 2 Pesquisadora Orientadora

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Aula 8 META Discutir os principais mecanismos geradores de mutação e suas conseqüências, assim como o papel dos mecanismos de reparo do DNA na manutenção da estabilidade e sobrevivência

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Tema 5. Crescimento e renovação celular. UNIDADE 1. Crescimento e renovação celular

Tema 5. Crescimento e renovação celular. UNIDADE 1. Crescimento e renovação celular Tema 5. Crescimento e renovação celular Crescimento e renovação celular Distinção entre DNA e RNA quanto às suas características estruturais e funcionais. Reconhecimento de que os organismos necessitam

Leia mais

GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular

GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular Curso: Nutricius Vitae GENÔMICA NUTRICIONAL: Modulando a Origem e a Saúde Celular www.hgsc.bcm.tmc.edu/graphics/genome3.jpg Profª. Cibele Velloso Rodrigues 2009 e-mail: cvbiogenet@yahoo.com.br Conteúdo

Leia mais

O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. denominado interfase (núcleo interfásico).

O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. denominado interfase (núcleo interfásico). NÚCLEO E DIVISÃO CELULAR NÚCLEO E DIVISÃO CELULAR O núcleo celular é uma estrutura presente nas células eucarióticas, que contém o DNA da célula. Período em que a célula não se encontra em divisão é denominado

Leia mais

A presentamos, a seguir, a descrição dos

A presentamos, a seguir, a descrição dos PROPOSTAS PARA DESENVOLVER EM SALA DE AULA NÚMERO 5 JULHO DE 1997 EDITORA MODERNA ANALISANDO CARIÓTIPOS HUMANOS ABERRANTES J. M. Amabis* * e G. R. Martho Este folheto complementa e amplia as atividades

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos Antonio Luiz Gomes Júnior Genotoxicidade Definição: é o setor da genética que estuda os processos que alteram

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais

Atividade extra. Questão 1. Questão 2. Ciências da Natureza e suas Tecnologias Biologia. A diversidade biológica é o fruto da variação genética.

Atividade extra. Questão 1. Questão 2. Ciências da Natureza e suas Tecnologias Biologia. A diversidade biológica é o fruto da variação genética. Atividade extra Questão 1 A diversidade biológica é o fruto da variação genética. Falar em biodiversidade e em tempo significa, necessariamente, falar de: a. Degeneração. b. Conservação. c. Evolução. d.

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular.

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular. Módulo Núcleo Exercícios de Aula 1) O envelope nuclear encerra o DNA e define o compartimento nuclear. Assinale a afirmativa INCORRETA sobre o envelope nuclear. a) É formado por duas membranas concêntricas

Leia mais

Genética I: Mendel, Mitose e Meiose

Genética I: Mendel, Mitose e Meiose Página 1 de 6 Genética I: Mendel, Mitose e Meiose Uma forma de estudar a função biológica é pegar um organismo/célula e dividi-lo em componentes, como as proteínas, e então estudar os componentes individuais.

Leia mais

?respondaessa O que acontece com o corpo com anemia?

?respondaessa O que acontece com o corpo com anemia? 26 2 DOENÇAS DO SANGUE O sangue é um tecido fundamental à manutenção de todos os demais tecidos e órgãos do organismo humano. O equilíbrio entre o ritmo de produção e de destruição das células do sangue,

Leia mais

Núcleo e ciclo celular

Núcleo e ciclo celular Módulo 2 Unidade 4 Núcleo e ciclo celular Para início de conversa... Você já reparou que para que todas as coisas funcionem corretamente é preciso que haja organização? É preciso que algumas pessoas comandem,

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO BIOLOGIA 12º ANO

MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO BIOLOGIA 12º ANO MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO Duração da Prova 90 minutos + 30 minutos de tolerância BIOLOGIA 12º ANO (Cursos Científico-Humanísticos

Leia mais

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I Leia o texto abaixo com atenção. Considere que, nos pombos, a ausência de s é condicionada geneticamente. Nos cruzamentos que um criador realizava, ele observou

Leia mais

Lista de Exercícios Herança Sexual

Lista de Exercícios Herança Sexual Meus queridos alunos, preparei para vocês uma lista de atividades abordando o conteúdo estudado por nós esta semana. Espero que vocês aproveitem o final de semana para resolver esses exercícios segundo

Leia mais

CRITÉRIOS E PROPOSTA DE CORRECÇÃO DE PROVA ESCRITA DE AVALIAÇÃO SUMATIVA DE BIOLOGIA

CRITÉRIOS E PROPOSTA DE CORRECÇÃO DE PROVA ESCRITA DE AVALIAÇÃO SUMATIVA DE BIOLOGIA CRITÉRIOS E PROPOSTA DE CORRECÇÃO DE PROVA ESCRITA DE AVALIAÇÃO SUMATIVA DE BIOLOGIA Ano Lectivo: 2006/2007 CRITÉRIOS GERAIS DE CLASSIFICAÇÃO DO TESTE SUMATIVO Todas as respostas deverão ser perfeitamente

Leia mais

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose.

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose. BIO 6E aula 16 16.01. A pleiotropia ocorre quando um gene influencia mais de uma característica. Em genes que estão localizados no mesmo par de cromossomos porém distante um do outro, a maioria dos gametas

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES. DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 ACTIVIDADES ESTRATÉGIAS

ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES. DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 ACTIVIDADES ESTRATÉGIAS ESCOLA SECUNDÁRIA DR. SOLANO DE ABREU ABRANTES SECUNDÁRIO DISCIPLINA: Biologia TURMAS : A/B/C ANO: 12º ANO LECTIVO 2010/2011 COMPETÊNCIAS CONTEÚDOS PROGRAMÁTICOS ACTIVIDADES ESTRATÉGIAS AULAS PREVISTAS

Leia mais

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr.

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr. DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS Prof. Olayr Modesto Jr. INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade A A Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade 2 A A Habilidade: Conhecer sobre células- troncos, projeto genoma e engenharia genética. 3 A A Células-tronco Autorrenovação e diferenciação

Leia mais

BIOFÍSICA DAS RADIAÇÕES IONIZANTES

BIOFÍSICA DAS RADIAÇÕES IONIZANTES BIOFÍSICA DAS RADIAÇÕES IONIZANTES DANOS RADIOINDUZIDOS NA MOLÉCULA DE DNA Por ser responsável pela codificação da estrutura molecular de todas as enzimas da células, o DNA passa a ser a molécula chave

Leia mais

Técnicas de manipulação cromossomica

Técnicas de manipulação cromossomica Técnicas de manipulação cromossomica Introdução Genética Contribuição Aquacultura Moderna Utilização de técnicas usadas em biotecnologia e engenharia genética Facilmente aplicadas nos peixes: Geralmente,

Leia mais