Mutações e Polimorfismos gênicos

Tamanho: px
Começar a partir da página:

Download "Mutações e Polimorfismos gênicos"

Transcrição

1 DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual ocorre a mudança. Um organismo que apresenta um fenótipo novo resultante de uma mutação é chamado MUTANTE; Principal fonte de toda variação genética; Fornece matéria prima para evolução. CAUSAS DAS MUTAÇÕES TIPOS DE MUTAÇÕES As mutações podem ser espontânea ou induzida. As mutações espontâneas são as de causas desconhecidas e se dão naturalmente. As mutações induzidas são provocadas por agentes mutagênicos que podem ser físicos ou químicos. Duas classes de mutações, segundo o tipo de células que ocorrem seus efeitos: Mutações Somáticas (Não hereditárias); Nas células somáticas (durante a mitose) refletindo-se nas células, desse indivíduo, descendentes da que sofreu a mutação (ex: tumores); Mutações Germinativas (Hereditárias); Na formação dos gametas (meiose) -células da linhagem germinativa e serão transmitidas hereditariamente.

2 TIPOS DE MUTAÇÕES Mutações Gênicas: quando alteram a estrutura do DNA (dos genes individuais); Mutações Cromossômicas: quando alteram o número ou a estrutura dos cromossomos; Tipos de mutações gênicas: Substituiçãoocorre a troca de um ou mais pares de bases. Substituição de base Mutação silenciosa Mutação de sentido trocado Mutação sem sentido Adição ou Inserção Mudança da Matriz de Leitura Deleção

3 Substituição de base única Mutação silenciosa Alteração no códon não altera o AA Diferentes códons codificam um mesmo AA Substituição de base única Mutação de Sentido Trocado Alteração de um códon Muda um AA produzido Ex: Anemia Falciforme Efeitos de Mutações em genes de globina humana: Anemia Falciforme

4 Substituição de base única Mutação sem Sentido Formação de códon de parada UAA, UAG, ou UGA Adição ou Inserção acontece quando uma ou mais bases são adicionadas ao DNA, modificando a ordem de leitura da molécula durante a replicação ou a transcrição. Inserção ou Deleção Mudança da Matriz de Leitura Altera todos os AAs após a mutação

5 Deleçãoacontece quando uma ou mais bases são retiradas do DNA, modificando a ordem da leitura, durante a replicação ou a transcrição. (Ex: Distrofia Muscular Duchenne) Distrofia Muscular Duchenne ~60% das mutações deleções Mutações no gene DMD proteína distrofina alterada Degeneração muscular e fraqueza Idade de início: infância Sinais clínicos: Aumento de volume das panturrilhas Hiperlordose BASES MOLECULARES DAS MUTAÇÕES BASES MOLECULARES DAS MUTAÇÕES Mutações Espontâneas: Freqª mutações espontâneas humanas: 1 gene / A maioria dos erros ocorridos durante a replicação do DNA são reparados. Ex: desaminação espontânea de bases Mutações Induzidas: Agentes mutagénicos Físicos -raios X, radiação alfa, beta e gama e raios ultravioleta Químicos -colquicina, gás mostarda, nitrosaminas, constituintes do fumo do tabaco, etc. Dímeros de pirimidina por raios UV

6 POLIMORFISMOS Polimorfismos: Ocorrência em uma mesma população e ao mesmo tempo de 2 ou mais formas distintas de um gene, sendo que o alelo mais freqüente não tenha freqüência maior que 99%. Polimorfismo de nucleotídeo único (SNP) Exames de identificação pessoal pelo DNA Os SNPs(SingleNucleotidePolymorphisms) representam a classe de marcadores moleculares mais recentemente disponibilizada para a comunidade científica, a qual se baseia na identificação de polimorfismos de um único nucleotídeo em regiões do DNA expressas ou não. OBRIGADA!!!

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

MUTAÇÕES. Profa. Melissa de Freitas Cordeiro-Silva

MUTAÇÕES. Profa. Melissa de Freitas Cordeiro-Silva MUTAÇÕES Profa. Melissa de Freitas Cordeiro-Silva DEFINIÇÃO >> Mudanças na sequência dos nucleotídeos do material genético de um organismo >> Mensagem genética é alterada de forma irreversível. Causa:

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Mecanismos de variabilidade genética em agentes fitopatogênicos

Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Mecanismos de variabilidade genética em agentes fitopatogênicos Coevolução hospedeiro - patógeno Parasitismo estratégia de vida de conexão

Leia mais

BIOFÍSICA DAS RADIAÇÕES IONIZANTES

BIOFÍSICA DAS RADIAÇÕES IONIZANTES BIOFÍSICA DAS RADIAÇÕES IONIZANTES DANOS RADIOINDUZIDOS NA MOLÉCULA DE DNA Por ser responsável pela codificação da estrutura molecular de todas as enzimas da células, o DNA passa a ser a molécula chave

Leia mais

Alterações do material genético

Alterações do material genético Alterações do material genético Alterações do material genético Agentes internos ou externos causam alterações nos genes ou nos cromossomas MUTAÇÕES (ex: anemia falciforme, trissomia 21) Tecnologia permite

Leia mais

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária.

São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. MUTAÇÕES Mutações São alterações ou modificações súbitas em genes ou cromossomas, podendo acarretar variação hereditária. As mutações podem ser génicas quando alteram a estrutura do DNA ou cromossómicas

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

4. (Unifesp 2012) Durante a prófase I da meiose, pode ocorrer o crossing over ou permuta gênica entre os cromossomos das células reprodutivas.

4. (Unifesp 2012) Durante a prófase I da meiose, pode ocorrer o crossing over ou permuta gênica entre os cromossomos das células reprodutivas. 1. (Fuvest 2013) Nas mulheres, uma ovogônia diferencia-se em ovócito primário, que sofre a divisão I da meiose. Dessa divisão, resultam o ovócito secundário e outra célula, chamada primeiro corpúsculo

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

GENÉTICA 1ª Lei de Mendel

GENÉTICA 1ª Lei de Mendel GENÉTICA 1ª Lei de Mendel 1) Um rato marrom foi cruzado com duas fêmeas pretas. Uma delas teve 7 filhotes pretos e 6 filhotes de cor marrom. A outra teve 14 filhotes de cor preta. Os genótipos do macho

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade Todas as pessoas são diferentes, cada um é único, apresentam características que são próprias

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

c) Locus Gênico Local do cromossomo onde se localiza um gene.

c) Locus Gênico Local do cromossomo onde se localiza um gene. Aula Biologia Tio Ton Biologia 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula

Leia mais

EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM)

EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM) EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM) A Epidemiologia é a disciplina que estuda os determinantes da doença bem como os fatores envolvidos no seu desenvolvimento, distribuição e disseminação

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

PlanetaBio Resolução de Vestibulares UNESP 2011 2ª fase www.planetabio.com

PlanetaBio Resolução de Vestibulares UNESP 2011 2ª fase www.planetabio.com 1- Leia atentamente os três textos e analise o gráfico. I. Pela primeira vez na história, os empresários deparam-se com limites reais de crescimento econômico e de consumo, impostos por questões relacionadas

Leia mais

PADRÃO DE HERANÇA LIGADA AO CROMOSSOMO X

PADRÃO DE HERANÇA LIGADA AO CROMOSSOMO X PADRÃO DE HERANÇA LIGADA AO CROMOSSOMO X HOMENS: apresenta um X e um Y XY sexo heterogamético o seus gametas serão metade com cromossomo X e metade com cromossomo Y MULHER: apresenta dois X XX sexo homogamético

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I Síndrome de Down - Parte I Conteúdos: Tempo: Síndrome de Down 5 minutos Objetivos: Auxiliar o aluno na compreensão do que é síndrome de Down Descrição: Produções Relacionadas: Neste programa de Biologia

Leia mais

O SISTEMA GENÉTICO E AS LEIS DE MENDEL

O SISTEMA GENÉTICO E AS LEIS DE MENDEL O SISTEMA GENÉTICO E AS LEIS DE MENDEL Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Curso: Enfermagem, Nutrição e TO Conceitos Básicos Conceitos Básicos Conceitos Básicos

Leia mais

Aluno(a): Código: 2 Rua T-53 Qd. 92 Lt. 10/11 nº 1356 Setor Bueno 62-3285-7473 www.milleniumclasse.com.br

Aluno(a): Código: 2 Rua T-53 Qd. 92 Lt. 10/11 nº 1356 Setor Bueno 62-3285-7473 www.milleniumclasse.com.br Aluno(a): Código: Série: 1ª Turma: Data: / / 01. A fotomicrografia apresentada a seguir é de um tecido que apresenta as seguintes características: riqueza de substância intercelular, tipos celulares variados

Leia mais

PROVA DE BIOLOGIA. Os gráficos mostram dois comportamentos fisiológicos de plantas CAM em função das horas do dia.

PROVA DE BIOLOGIA. Os gráficos mostram dois comportamentos fisiológicos de plantas CAM em função das horas do dia. 13 PROVA DE BIOLOGIA Q U E S T Ã O 1 6 Algumas plantas, como cactos e abacaxis, fixam CO 2 através de uma via chamada CAM. Durante a noite, essas plantas fixam CO 2 em compostos orgânicos de quatro carbonos

Leia mais

a) A diversidade de anticorpos é derivada da recombinação das regiões, e.

a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Questão 1 Preencha as lacunas a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Verdadeiro ou falso. Se falso, altere a declaração de modo a torná-la verdadeira. b) A exposição

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Programa de Retomada de Conteúdo 3º Bimestre

Programa de Retomada de Conteúdo 3º Bimestre Educação Infantil, Ensino Fundamental e Ensino Médio, Rua Cantagalo 305, 313, 325, 337 e 339 Tatuapé Fones: 2293-9166 Diretoria de Ensino Região LESTE 5 Programa de Retomada de Conteúdo 3º Bimestre Nome:

Leia mais

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA MUTAÇÕES Eduardo Dias Embora um dos mais importantes requisitos do material genético seja a sua estabilidade, a capacidade de mudança também é necessária. As mutações gênicas são importantes para a evolução

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora.

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora. QUESTÃO 1 "Ceará joga fora opção alimentar" Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabeça de lagosta não são aproveitadas sendo lançadas ao mar. "0 estudo sobre hidrólise enzimática

Leia mais

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula 30/10 isto Caderno - Exercícios Genética Parte 1 (3 Pontos) 13/11 isto Caderno -

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

Questão 01 Gabarito: 27 Comentário

Questão 01 Gabarito: 27 Comentário Questão 01 Gabarito: 27 Biologia 01. Correta, pois essa é a definição de metabolismo basal, que consiste nas reações que garantem a sobrevivência do indivíduo e dos seus tecidos. 02. Correta, uma vez que

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

QUESTÃO 01 QUESTÃO 02(UNISA)

QUESTÃO 01 QUESTÃO 02(UNISA) Disciplina: Biologia Data: /09/2012 Professor: Luiz Carlos Panisset Travassos Turma: 3º Tipo de Atividade: Atividades de recuperação Segmento:EM/Agro Etapa:2ª Nome do(a) aluno(a): QUESTÃO 01 Uma criança

Leia mais

SISTEMA REPRODUTOR. Sistema reprodutor feminino

SISTEMA REPRODUTOR. Sistema reprodutor feminino SISTEMA REPRODUTOR A reprodução é de importância tremenda para os seres vivos, pois é por meio dela que os organismos transmitem suas características hereditariamente e garantem a sobrevivência de suas

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Cromossômicas: afetam a estrutura e o número de cromossomos Gênicas: afetam um único gene

Cromossômicas: afetam a estrutura e o número de cromossomos Gênicas: afetam um único gene Mutações gênicas MUTAÇÕES Cromossômicas: afetam a estrutura e o número de cromossomos Gênicas: afetam um único gene MUTAÇÕES GÊNICAS Alterações em uma ou mais bases do DNA, afetando a leitura durante a

Leia mais

GOIÂNIA, / / 2015. PROFESSOR: FreD. ALUNO(a): Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / 2015. PROFESSOR: FreD. ALUNO(a): Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2015 PROFESSOR: FreD DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): Lista de Exercícios No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

Leia mais

Padrões de Transmissão

Padrões de Transmissão Padrões de Transmissão Gênica Padrões de Transmissão Gênica DISCIPLINA: GENÉTICA BÁSICA PROFA. ZULMIRA LACAVA E LUZIRLANE BRAUN Heranças Monogênicas ou Mendelianas 1 1ª Lei de Mendel Modelo pressupôs que

Leia mais

Corresponde ao local de cada gene em específico. Em um mesmo cromossomo há vários genes, cada um com sua localização específica.

Corresponde ao local de cada gene em específico. Em um mesmo cromossomo há vários genes, cada um com sua localização específica. Espiralização do Cromossomo O material genético (DNA) encontra-se associado a proteínas, formando histonas, que vão se enrolando e formam a cromatina. Quando a cromatina está no nível máximo de espiralização,

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

International Junior Science Olympiad

International Junior Science Olympiad International Junior Science Olympiad IJSO Brasil 2009 Segunda Fase Gabarito Q U A D R O D E R E S P O S T A S Física Química Biologia A B C D E 01 X 02 X 03 X 04 X 05 X 06 X 07 X 08 X 09 X 10 X A B C

Leia mais

Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física?

Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física? Fisiologia Humana QUESTÕES INICIAIS 1 2 3 Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física? Qual a importância dos conhecimentos

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA -> mutação -> doença Mutação em regiões controladoras e codificantes Mecanismos de Reparo Fita simples

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 91) No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento

Leia mais

01) Observe a genealogia a seguir:

01) Observe a genealogia a seguir: COLÉGIO CEC CENTRO EDUCACIONAL CIANORTE ED. INFANTIL, ENS. FUNDAMENTAL E MÉDIO - SISTEMA ANGLO DE ENSINO. LISTA DE REVISÃO DE GENÉTICA TERCEIRÃO PROF. NANNI 01) Observe a genealogia a seguir: Sabendo-se

Leia mais

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71)

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71) DELIBERAÇÃO Câmara de Pós-Graduação Nº 32/2012 Reestrutura o Programa de Pós-Graduação em Genética e Biologia Molecular, em nível de Mestrado e Doutorado. CONSIDERANDO a solicitação da Comissão Coordenadora

Leia mais

Áudio GUIA DO PROFESSOR. Idéias evolucionistas e evolução biológica

Áudio GUIA DO PROFESSOR. Idéias evolucionistas e evolução biológica Teoria sintética da evolução Parte II Conteúdos: Tempo: Objetivos: Idéias evolucionistas e evolução biológica Duração do áudio 5 minutos O objetivo deste programa é tratar das idéias neodarwinistas e mostrar

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Aula 8 META Discutir os principais mecanismos geradores de mutação e suas conseqüências, assim como o papel dos mecanismos de reparo do DNA na manutenção da estabilidade e sobrevivência

Leia mais

Biologia - Grupos A e B - Gabarito revisto

Biologia - Grupos A e B - Gabarito revisto revisto 1 a QUESTÃO: (2, pontos) Avaliador Revisor Em estudos com um vegetal terrestre foram utilizadas plantas jovens com genótipo mutante (M), que não apresentam a formação de uma estrutura presente

Leia mais

TD de revisão 8º Ano- 4ª etapa- 2015

TD de revisão 8º Ano- 4ª etapa- 2015 TD de revisão 8º Ano- 4ª etapa- 2015 1. Classifique os métodos anticoncepcionais abaixo, relacionando as colunas: (1) Natural ou comportamental (2) De Barreira (3) Hormonal (4)Cirúrgico ( ) Camisinha (M)

Leia mais

Mutações Cromossômicas Estruturais

Mutações Cromossômicas Estruturais Genética Básica Mutações Cromossômicas Estruturais Aline Intorne Definição: Mudança substancial na estrutura do cromossomo, possivelmente, afetando mais do que um único gene. Segmentos de cromossomos podem

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º Avisos 1. Este documento apenas serve comoapoio parcial às aulas de Biologia 12.ºano Unidade 2 - leccionadas na Escola Secundária Morgado Mateus(Vila Real) pelo

Leia mais

Influência da Genética desempenho

Influência da Genética desempenho UNIVERSIDADE GAMA FILHO PÓS-GRADUAÇÃO Nível: LATO SENSU Curso: FISIOLOGIA E TREINAMENTO APL. ATIVIDADES DE ACADEMIAS E CLUBES Influência da Genética desempenho Prof. Drd. LUIZ CARLOS CARNEVALI luizcarnevalijr@usp.br

Leia mais

Câncer. Claudia witzel

Câncer. Claudia witzel Câncer Claudia witzel Célula Tecido O que é câncer? Agente cancerígeno Órgão Célula cancerosa Tecido infiltrado Ozana de Campos 3 ESTÁGIOS de evolução da célula até chegar ao tumor 1 Célula 2 Tecido alterado

Leia mais

PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular

PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular Professores responsáveis: Antonio Dégas, Laura Araújo Tomé e Daniela Alves Silvestre AULA 5 e 6 - PBL Câncer OBJETIVOS - Compreender

Leia mais

TALASSEMIAS: UMA ANÁLISE AMPLA E CORRELAÇÕES CLÍNICAS

TALASSEMIAS: UMA ANÁLISE AMPLA E CORRELAÇÕES CLÍNICAS TALASSEMIAS: UMA ANÁLISE AMPLA E CORRELAÇÕES CLÍNICAS Antonio Jose Dias Martins, Rassan Dyego Romão Silva e Bruna Rezende Faculdade Alfredo Nasser Aparecida de Goiânia GO Brasil antoniojdm35@hotmail.coml

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

Genética de Populações

Genética de Populações MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL Genética de Populações COMO SE CONSEGUE ATINGIR OS OBJETIVOS DO

Leia mais

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh . Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh. 1- Em um experimento, preparou-se um conjunto de plantas por técnica de clonagem

Leia mais

Marcos Luppi Engº Ambiental. Desinfecção da Água

Marcos Luppi Engº Ambiental. Desinfecção da Água Marcos Luppi Engº Ambiental Desinfecção da Água Um dos principais problemas que surgiram neste século é a crescente contaminação da água, recurso que vem sendo poluído de tal maneira que em muitos casos

Leia mais

Genética I: Mendel, Mitose e Meiose

Genética I: Mendel, Mitose e Meiose Página 1 de 6 Genética I: Mendel, Mitose e Meiose Uma forma de estudar a função biológica é pegar um organismo/célula e dividi-lo em componentes, como as proteínas, e então estudar os componentes individuais.

Leia mais

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas.

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. 2 Habilidade: Conceituar mutações gênicas e cromossômicas, compreendendo como podem influenciar nossas vidas. 3 REVISÃO

Leia mais

Técnicas de manipulação cromossomica

Técnicas de manipulação cromossomica Técnicas de manipulação cromossomica Introdução Genética Contribuição Aquacultura Moderna Utilização de técnicas usadas em biotecnologia e engenharia genética Facilmente aplicadas nos peixes: Geralmente,

Leia mais

cromossomos para montagem de um cariótipo? Prof. Zell (Biologia) OS CROMOSSOMOS 04. (UNI-RIO/ENCE) 01.

cromossomos para montagem de um cariótipo? Prof. Zell (Biologia) OS CROMOSSOMOS 04. (UNI-RIO/ENCE) 01. Biologia > Citologia > Núcleo Celular >Alunos Prof. Zell (Biologia) cromossomos para montagem de um cariótipo? OS CROMOSSOMOS 01. Observando a tabela abaixo percebemos que chimpanzé e gorila possuem mesmo

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

MUTAÇÃO 22/5/2012. Mutação gênica ou mutação de ponto: Importância da Mutação. Fonte de variabilidade genética, matéria prima para a evolução

MUTAÇÃO 22/5/2012. Mutação gênica ou mutação de ponto: Importância da Mutação. Fonte de variabilidade genética, matéria prima para a evolução Importância da Mutação MUTAÇÃO Fonte de variabilidade genética, matéria prima para a evolução Sem a mutação não existiriam tantos alelos, e os organismos não seriam capazes de se adaptar às mudanças ambientais

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

PlanetaBio Resolução de Vestibulares UNESP 2010 1ª fase www.planetabio.com

PlanetaBio Resolução de Vestibulares UNESP 2010 1ª fase www.planetabio.com 1- Leia a notícia. Dengue tipo 4 reaparece após 25 anos A dengue é causada por quatro tipos de vírus: DENV-1, DENV-2, DENV-3 e DENV-4. O tipo DENV-4 não era encontrado no país desde 1982, mas exames de

Leia mais

CÉLULAS-TRONCO E GENÉTICA DESAFIOS NA CIÊNCIA. Mayana Zatz CENTRO DE ESTUDOS DO GENOMA HUMANO

CÉLULAS-TRONCO E GENÉTICA DESAFIOS NA CIÊNCIA. Mayana Zatz CENTRO DE ESTUDOS DO GENOMA HUMANO CÉLULAS-TRONCO E GENÉTICA DESAFIOS NA CIÊNCIA Mayana Zatz CENTRO DE ESTUDOS DO GENOMA HUMANO AS GRANDES REVOLUÇÕES DA ÚLTIMA DÉCADA O Projeto Genoma Humano A CLONAGEM e AS CÉLULAS-TRONCO Como isso nos

Leia mais

Biologia 1E. Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução

Biologia 1E. Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução Biologia 1E Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução Divisão Celular Divisão das Células Para que? 1.Formar novos seres unicelulares. 2.Crescimento nos seres Pluricelulares. 3.Reposição

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Mutações somáticas x Mutações germinativas Tipos de mutações MUTAÇÃO GENÔMICA:

Leia mais

Regulação Epigenética. Paulo Thiago e Juliana Couto Programa de Carcinogênese Molecular

Regulação Epigenética. Paulo Thiago e Juliana Couto Programa de Carcinogênese Molecular Regulação Epigenética Paulo Thiago e Juliana Couto Programa de Carcinogênese Molecular Definição atual: O termo epigenética é usado para descrever os processos moleculares herdáveis que afetam a expressão

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Controle da Expressão Gênica em Eucariotes

Controle da Expressão Gênica em Eucariotes Controle da Expressão Gênica em Eucariotes 1 2 3 Transcrição: Expressão/Ativação do gene Processamento Pós-transcrição: Remoção de introns/poliadenilação, Caping, Transporte Degradação mrna: Estabilidade

Leia mais

Questão 1. Questão 3. Questão 2. Resposta. Resposta

Questão 1. Questão 3. Questão 2. Resposta. Resposta Questão 1 Uma enzima, extraída da secreção de um órgão abdominal de um cão, foi purificada, dissolvida em uma solução fisiológica com ph 8 e distribuída em seis tubos de ensaio. Nos tubos 2, 4 e 6, foi

Leia mais

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre Disciplina: Biologia Educacional Curso: Pedagogia 2 Semestre Texto 2: GENÉTICA HEREDITARIEDADE A genética é um a ciência que estuda o material hereditário e os mecanismos de sua transmissão de geração

Leia mais

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula de DNA capaz de determinar

Leia mais

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado.

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Profª Ana Luisa Miranda Vilela CICLO CELULAR e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Grande número de células se dividem continuamente, substituindo as que

Leia mais

Software. GUIA DO PROFESSOR Qual é a palavra? Genética humana e saúde

Software. GUIA DO PROFESSOR Qual é a palavra? Genética humana e saúde Qual é a palavra? Genética humana e saúde Conteúdos: Tempo: Objetivos: Descrição: Genética humana 1 hora-aula de 50 minutos Este software tem como objetivo a fixação de alguns nomes, termos e conceitos

Leia mais

Biologia Professor Leandro Gurgel de Medeiros

Biologia Professor Leandro Gurgel de Medeiros Biologia Professor Leandro Gurgel de Medeiros MEIOSE 1. Considerações Iniciais Processo de divisão celular; Responsável pela formação de gametas e esporos; Células EUCARIONTES (2n); Duplicação dos cromossomos;

Leia mais

COMENTÁRIO DA PROVA DE BIOLOGIA

COMENTÁRIO DA PROVA DE BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA A prova de Biologia do Vestibular da UFPR/2014 se destacou pelo cuidado com que foi elaborada. Nesse aspecto, podemos afirmar que apresentou um alto nível de precisão e

Leia mais

Form. A2 / / 778 D. Este desenho contem informação que não podem ser rasuradas ou alteradas SEÇÃO A-A ESCALA 1 : 5. Codigo Des.

Form. A2 / / 778 D. Este desenho contem informação que não podem ser rasuradas ou alteradas SEÇÃO A-A ESCALA 1 : 5. Codigo Des. 1 3 4 5 6 7 8 9 10 11 12 A 176 597 776 1196 A 55 B B C C 1032 D 978 778 D 128 107 A 488 E E 198 290 A 75 F 513 762 1115 1283 F 28 15 G G 15 Form. A2 H SEÇÃO A-A ESCALA 1 : 5 Este desenho contem informação

Leia mais

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil

Grupo de Protecção e Segurança Radiológica Octávia Monteiro Gil Grupo de Protecção e Segurança Radiológica 1st Workshop for Stakeholders - 6 de Dezembro de 2013 Radioactividade A radioactividade existe desde a formação do Universo, e os seres humanos viveram sempre

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Espectrofotometria Molecular UV-VIS

Espectrofotometria Molecular UV-VIS Controlo Controlo da Qualidade Qualidade e Segurança e Segurança Química Alimentar dos Alimentos II Espectrofotometria Molecular UV-VIS 1 Controlo Controlo da Qualidade Qualidade e Segurança e Segurança

Leia mais

PROVA DE BIOLOGIA II CÉLULAS-TRONCO PODERÃO SER ALTERNATIVA PARA TRATAMENTO DE DOENÇAS AUTOIMUNES

PROVA DE BIOLOGIA II CÉLULAS-TRONCO PODERÃO SER ALTERNATIVA PARA TRATAMENTO DE DOENÇAS AUTOIMUNES 24 PROVA DE BIOLOGIA II Q U E S T Ã O 4 0 CÉLULAS-TRONCO PODERÃO SER ALTERNATIVA PARA TRATAMENTO DE DOENÇAS AUTOIMUNES As doenças autoimunes afetam de 3% a 5% da população mundial. Causadas por uma disfunção

Leia mais