Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE"

Transcrição

1 Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto

2 Câncer : Doença Genética? Anomalias cromossômicas no câncer Ex: Leucemia Mielóide Crônica: translocação entre os cromossomo 9 e 22

3 Câncer : Doença Genética? Famílias nas quais o câncer é transmitido como uma característica genética

4 Câncer : Doença Genética? Anomalias cromossômicas no câncer Famílias nas quais o câncer é transmitido como uma característica genética Carcinógenos, que tendem a ser mutágenos Estimular o crescimento de malignidades Indivíduos com síndromes de deficiência de reparo de DNA

5 Integridade de um tecido Proliferação Morte celular Sinalização intra e extra celular Equilíbrio perdido TUMOR

6 O que é o câncer? Coleção de dístúrbios que compartilham a característica comum de crescimento celular descontrolado Proliferação celular anormal e invasiva

7 Manutenção do corpo Divisão celular controlada Substituir as células gastas Reparar tecidos danificados Montar respostas imunes

8 Câncer Familial Câncer Hereditário Acomete vários membros de uma família Tumores herdados Não é necessariamente hereditário 5% de todos os cânceres são hereditários, com uma mutação na linhagem germinativa.

9 O câncer surge do acúmulo de mutações no DNA ao longo do tempo. Alterações sucessivas em genes envolvidos no reparo DNA; Sinalização celular; Ciclo celular; Apoptose; Câncer Proliferação descontrolada, desarranjos genéticos e outros comportamentos anti-sociais da célula tumoral

10 Crescimento descontrolado anomalias múltiplas, que se acumulam em período de anos; Ignoram os sinais externos e internos que regulam a proliferação celular; Descontrole da proliferação celular, escapando de senescência programada e evitando a diferenciação; Têm a tendência de evitar o suicídio celular por apoptose; São geralmente muito instáveis alterações nos cromossomos, citoesqueleto;

11 Perda do controle da proliferação + Progressão tumoral Alterações no conteúdo genético da célula Expansão clonal

12

13 - Hábitos e estilo de vida (80-90% dos casos) - Fumo, álcool, alimentos, condições de trabalho - Exposição ocupacional; - Luz UV e raios X; - Infecção viral.

14 Tabagismo Câncer de pulmão, boca, laringe, faringe, esôfago, pâncreas, rim, bexiga e colo de útero. Alcoolismo + tabaco: risco de câncer da cavidade bucal, esôfago, faringe e laringe supraglótica. Hábitos Alimentares: alimentos ricos em gorduras e alimentos em conserva e defumados câncer de mama, cólon (intestino grosso) reto, próstata, esôfago e estômago. Fatores ocupacionais: benzeno (carvão e tintas e colas) leucemia. Radiação solar: radiação ultra-violeta natural (sol) câncer de pele. Hábitos sexuais: promiscuidade sexual, a falta de higiene, a precocidade do início da vida sexual e variedade de parceiros: maior risco de câncer do colo uterino e pênis.

15 -Danos em genes que controlam o ciclo celular: -Mutações somáticas; -Mutações hereditárias; -Alterações cromossômicas Translocações Amplificação Gênica

16 Mutação Somática Ocorre somente nas células somáticas Ocorre por mitose Não é passado para prole Câncer Esporádico Mutação Germinativa Ocorre nas células geminativas Alteração nas células precursoras de gametas/zigoto Detectada em várias gerações Câncer Hereditário

17

18 óvulo espermatozóide Mutação óvulo fertilizado Mutação Cel. germinativa Osso Pâncreas Células da Prole Cérebro

19 Câncer Doença genética complexa Alterações simultâneas em genes proliferação diferenciação morte celular Categorias Proto-oncogenes Genes supressores de tumor Genes de reparo

20 Mutações gênicas Desregulação do ciclo celular - Oncogenes - Genes supressores de tumor (gatekeepers) - Genes de reparo do DNA (caretakers) Proliferação celular descontrolada Câncer

21

22 Duas grandes classes de genes desempenham funções-chave na indução do tumor Oncogenes Supressores de tumor Proteínas que ajudam a controlar o crescimento e a proliferação celulares

23 Oncogene, ou genes promotores de crescimento, cuja atividade na célula está relacionada ao crescimento celular. Genes supressores de tumor, cuja função normal está em prevenir que as células se multipliquem descontroladamente.

24 genes mutantes dominantes que contribuem para o desenvolvimento de câncer; primeiramente identificados em vírus v-onc (Rous, 1914). Proto-oncogenes: genes normais que codificam proteínas que controlam positivamente o ciclo celular; Versão normal de um oncogene

25 Fatores de crescimento; Receptores de fatores de crescimento (erbb); Transdução de sinal (abl, ras, raf;) Reguladores transcricionais (jun, fos, erba) Reguladores negativos da apoptose (bcl2)

26 Estado normal controlam desenvolvimento e crescimento das células Mutação Transformação maligna da células

27

28 Leucemia Mielóide Crônica t(9;22)(q34;q11) - Cromossomo Philadelphia Proteína quimérica: Proteína quimérica: atividade aumentada

29 São genes que regulam negativamente a progressão do ciclo celular, prevenindo a proliferação celular descontrolada. Mutação Perda do freio para proliferação celular Formação do Tumor proteínas intracelulares que regulam ou inibem a progressão do ciclo celular: p16 receptores de hormônios secretados: TGFb proteínas do checkpoint: p53, prb, CDKN2A, ARF proteínas que promovem a apoptose: p53

30 Comportamento recessivo ao nível celular 2 alelos alterados para que o gene perca sua função A ausência ou deficiência da proteína supressora de tumor leva ao descontrole do ciclo celular.

31 Primeiro gene supressor tumoral descoberto : tumor retina 2 cópias devem ser perdidas para que ocorra a perda da função celular Duas mutações devem ocorrer: uma em cada alelo Perda de função Doença Mutação tem caráter recessivo Um único alelo mutado não é capaz de induzir uma neoplasia

32

33

34 Distúrbios nos quais está afetado Gene supressor tumoral Produto gênico/ possível função Familiar Esporádico Rb1 p110 / regulação do ciclo celular Retinoblastoma Retinoblastoma, carcinoma de pequena célula do pulmão Tp53 p53/regulação do ciclo celular Síndrome de Li-Fraumeni Câncer de pulmão, câncer de mama BRCA1/ BRCA2 BRCA1, BRCA2/ participa no reparo de quebra dupla de DNA Câncer de mama familiar Câncer de mama, câncer de ovário Nf1 neurofibromina/ proteína ativadora de GTPase Neurofibromatose tipo 1 Desconhecido Nf2 Merlin ou schwannomina/ liga proteínas da superfície celular ao citoesqueleto Neurofibromatose tipo 2 Schwannomas esporádicos e meningiomas

35 Defesas naturais contra danos ao DNA; Reparar danos surgidos espontaneamente no DNA ou induzidos por mutágenos Reconhecimento, excisão do dano e reparo da cadeia de DNA; Muito eficiente: menos que 1 em 1000 mudanças de base espontâneas resultam em mutação permanente bases púricas são perdidas todo dia/cd célula Danos no DNA: erros de replicação; agentes químicos: carcinógenos ambientais, dieta, estilo de vida, exposição ocupacional; agentes físicos: luz UV, radiação ionizante.

36 parar o ciclo celular e reparar os danos continuar a divisão celular Acúmulo de Danos Mutações Transformação tumoral

37 QUIMIOTERAPIA CIRURGIA RADIOTERAPIA TERAPIAS DO CÂNCER TERAPIA MOLECULAR TERAPIA GÊNICA NANOTECNOLOGIA IMUNOTERAPIA

38 Genes envolvidos na carcinogênese: Gene supressor tumoral Gene Reparo do DNA Oncogene

39 NUSSBAUM, RL; MCINNES, RR; WILLARD, HF. Thompson e Thompson - Genética Médica. 7ª ed. Elsevier, Capítulo 16. WEINBERG, RA. A Biologia do Câncer. Porto Alegre, Artmed Editora, LEWIS, B. Genes VII. 7 a ed. Artmed Editora, Capítulo 28. SNUSTAD, P.; SIMMONS, M.J. Fundamentos de Genética. 2ª ed., Rio de Janeiro, Guanabara Koogan, Capítulo 28. ALBERTS, B. et al. Biologia Molecular da Célula. 3a. ed., Porto Alegre, Artmed Editora, Capítulo 24.

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

BIOLOGIA TUMORAL E CARCINOGÊNESE

BIOLOGIA TUMORAL E CARCINOGÊNESE 6 BIOLOGIA TUMORAL E CARCINOGÊNESE INTRODUÇÃO A história natural da maioria dos tumores malignos pode ser dividida em 4 fases: (1) transformação maligna, (2) crescimento da célula transformada, (3) invasão

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3.

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. CONHECIMENTO ESPECÍFICO SOBRE O CÂNCER NÃO AUMENTA CONSCIENTIZAÇÃO. Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. 1 Voluntária Iniciação Científica PVIC/UEG 2 Pesquisadora Orientadora

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Departamento de Biologia Celular e Molecular Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Tema: Bases Moleculares do Câncer e Ação A

Leia mais

Componente Curricular: Patologia e Profilaxia Módulo I Profª Mônica I. Wingert Turma 101E TUMORES

Componente Curricular: Patologia e Profilaxia Módulo I Profª Mônica I. Wingert Turma 101E TUMORES TUMORES Tumores, também chamados de neoplasmas, ou neoplasias, são alterações celulares que provocam o aumento anormal dos tecidos corporais envolvidos. BENIGNO: são considerados benignos quando são bem

Leia mais

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE NISE HITOMI YAMAGUCHI ONCOLOGISTA E IMUNOLOGISTA UNIVERSIDADE DE SÃO PAULO MINISTÉRIO DA SAÚDE-ESTADO DE SÃO PAULO ENERGIA NUCLEAR DIAGNÓSTICO NA MEDICINA

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Características principais Agente etiológico das verrugas (tumores epiteliais benignos) Infectam epitélio de

Leia mais

IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES

IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES IMUNIDADE AOS TUMORES Neoplasias Histórico Classificação : linhagem celular, histomorfologia e comportamento clínicobiológico. Carcinogênese experimental

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Carcinogénese ambiental, tabaco, bactérias e vírus

Carcinogénese ambiental, tabaco, bactérias e vírus Carcinogénese ambiental, tabaco, bactérias e vírus (acompanhem com os slides!!) O tabaco, vírus e bactérias são exemplos. Os carcinogéneos ambientais são muitos mais do que estes. O que este esquema pretende

Leia mais

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP- 42883

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP- 42883 ENFERMAGEM EM ONCOLOGIA Renata Loretti Ribeiro Enfermeira COREn/SP- 42883 Renata Loretti Ribeiro 2 Introdução O câncer representa uma causa importante de morbidez e mortalidade, gerador de efeitos que

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Lyria Mori Departamento de Biologia, Instituto de Biociências, Universidade de São Paulo B I O L O G I A M O L E C U L A R

Lyria Mori Departamento de Biologia, Instituto de Biociências, Universidade de São Paulo B I O L O G I A M O L E C U L A R Conhecido há milênios, o câncer termo que abrange muitas doenças cuja característica básica é a proliferação descontrolada de células é hoje um dos principais males que afligem a humanidade. As descobertas

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Atividade extraclasse Apresentação do curso - Teste. Aula expositiva - DE ROBERTIS. 2000. Bases da biologia celular e molecular. 3ª edição. Ed.

Atividade extraclasse Apresentação do curso - Teste. Aula expositiva - DE ROBERTIS. 2000. Bases da biologia celular e molecular. 3ª edição. Ed. PLANO DE AULA Disciplina: Biologia Celular e Genética Professor(a): Dr. Dercy José de Sá Filho e Dra. Marizia do Amaral Toma Curso: Biomedicina Semestre/A Semestral Turma: 1A Atividades temáticas Estratégias/bibliografia

Leia mais

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015 UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES ONCOGÊNESE O QUE É O CÂNCER Câncer é o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado (maligno) de células

Leia mais

4. Câncer no Estado do Paraná

4. Câncer no Estado do Paraná 4. Câncer no Estado do Paraná Situação Epidemiológica do Câncer Doenças e Agravos Não Transmissíveis no Estado do Paraná Uma das principais causas de morte nos dias atuais, o câncer é um nome genérico

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

BIOLOGIA CELULAR E MOLECULAR DO CÂNCER

BIOLOGIA CELULAR E MOLECULAR DO CÂNCER 40 CONGRESSO BRASILEIRO DE ANÁLISES CLÍNICAS FLORIANÓPOLIS, 16 DE JUNHO DE 2013 (11:00 11:45H) BIOLOGIA CELULAR E MOLECULAR DO CÂNCER PROF.DR. PAULO CESAR NAOUM ACADEMIA DE CIÊNCIA E TECNOLOGIA DE SÀO

Leia mais

Resposta imunológica a. Ronei Luciano Mamoni

Resposta imunológica a. Ronei Luciano Mamoni Resposta imunológica a tumores Ronei Luciano Mamoni Tumores Conceitos gerais Neoplasias conceito Neoplasia (neo= novo + plasia = tecido) é o termo que designa alterações celulares que acarretam um crescimento

Leia mais

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER A EVOLUÇÃO DA LUTA CONTRA O CÂNCER Vanessa Gabriela Martins Pereira, Thaís Nogueira Silva, Laísa de Fátima Rangel, Karen Dias Ferreira, Hadassa Cristina Souza dos Santos, Gisele Aparecida de Castro Moreira,

Leia mais

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama Câncer de Mama Princípios Básicos História Natural Epidemiologia IZABELLA SERAPHIM PITANGA Mastologista do Núcleo da Mama O QUE É CÂNCER? Câncer é o nome dado a um conjunto de mais de 100 doenças que têm

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

Apoptose em Otorrinolaringologia

Apoptose em Otorrinolaringologia Apoptose em Otorrinolaringologia Teolinda Mendoza de Morales e Myrian Adriana Pérez García Definição A apoptose é um processo biológico existente em todas as células de nosso organismo, conhecida desde

Leia mais

Resposta Imune contra o Câncer

Resposta Imune contra o Câncer Câncer é um termo genérico, que compreende em torno de 200 doenças, cujas células causadoras partilham algumas características em comum: Mutações genéticas; Crescimento descontrolado; Capacidade de migração

Leia mais

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo?

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? BIOLOGIA Cláudio Góes Fundamentos de oncologia 1. Introdução Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? Nesta unidade, você verá que o termo câncer refere-se a uma variedade de

Leia mais

Mutações e Polimorfismos gênicos

Mutações e Polimorfismos gênicos DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos psantos@catolica-es.edu.br O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual

Leia mais

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço A P R E S E N T A D O R : S E L I N A L D O A M O R I M R E S I D E N T E D E C I R U R G I A D E C A B E Ç A E P E S

Leia mais

Genética do câncer Aline Rodrigues Amorim

Genética do câncer Aline Rodrigues Amorim Centro Universitário de Brasília Faculdade de Ciências da Saúde Genética do câncer Aline Rodrigues Amorim Brasília 2002 Centro Universitário de Brasília Faculdade de Ciências da Saúde Licenciatura em Ciências

Leia mais

Genética e Câncer. Viviane Ferreira Esteves

Genética e Câncer. Viviane Ferreira Esteves Genética e Câncer Viviane Ferreira Esteves Fatores de risco Fatores internos Predisposição hereditária Fatores externos Ambientais Predisposição Genética para o Câncer Tipo de câncer Mama Cólon Leucemias

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

a) A diversidade de anticorpos é derivada da recombinação das regiões, e.

a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Questão 1 Preencha as lacunas a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Verdadeiro ou falso. Se falso, altere a declaração de modo a torná-la verdadeira. b) A exposição

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

Faculdade de Medicina da Universidade do Porto

Faculdade de Medicina da Universidade do Porto Faculdade de Medicina da Universidade do Porto Instabilidade Genética e Cancerização Prof. José Carlos Machado 5 Março 2007 Hoje vamos falar sobre instabilidade genética e cancerização. Há uma lógica de

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

CITOLOGIA ONCÓTICA CÂNCER

CITOLOGIA ONCÓTICA CÂNCER CITOLOGIA ONCÓTICA Neoplasia: crescimento desordenado de células, originando um tumor (massa de células) Tumor benigno: massa localizada de células que se multiplicam vagarosamente e se assemelham ao seu

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

Declaração de Conflitos de Interesse

Declaração de Conflitos de Interesse Declaração de Conflitos de Interesse Nada a declarar. Elias Fernando Miziara - DF MR A biologia viral na indução do câncer por HPV Epidemiologia no Brasil Dr. Elias Fernando Miziara Lesâo provocada por

Leia mais

INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER

INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER PROF.DR. PAULO CESAR NAOUM ACADEMIA DE CIÊNCIA E TECNOLOGIA DE SÀO JOSÉ DO RIO PRETO,SP REVISÃO ATÉ 2013 *TODOS OS TIPOS DE CÂNCER TÊM ORIGEM

Leia mais

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET Rejane de Sousa Ferreira 1, Cristiane Alves da Fonseca 2, Andréia Juliana Leite

Leia mais

Redações vencedoras I Concurso de Redação

Redações vencedoras I Concurso de Redação Redações vencedoras I Concurso de Redação 1 Lugar Aluno: Julia Stefani Moraes Professora: Regina M. Macedo de Melo Castro Informação: A melhor maneira de combater o câncer Penso que falar sobre este assunto

Leia mais

20 e 21 de outubro de 2005 Gulnar Azevedo S. Mendonça. Coordenação de Prevenção e Vigilância

20 e 21 de outubro de 2005 Gulnar Azevedo S. Mendonça. Coordenação de Prevenção e Vigilância Seminário de 20 e 21 de outubro de 2005 Gulnar Azevedo S. Mendonça Coordenação de Prevenção e Vigilância Magnitude do problema Câncer é a segunda causa de morte no Brasil. Mortalidade por câncer vem aumentando,

Leia mais

IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013

IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013 IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013 Gênese do câncer A célula cancerosa é originada de uma célula normal que

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

O que é o câncer de mama?

O que é o câncer de mama? O que é o câncer de mama? As células do corpo normalmente se dividem de forma controlada. Novas células são formadas para substituir células velhas ou que sofreram danos. No entanto, às vezes, quando células

Leia mais

PALAVRAS-CHAVE Projeto Genoma, terapia gênica, genética do câncer, oncogenes, carcinogênese

PALAVRAS-CHAVE Projeto Genoma, terapia gênica, genética do câncer, oncogenes, carcinogênese PROJETO GENOMA NA CURA DO CÂNCER José Anulino Ferreira Neto¹, Erli de Souza Bento², Eliana da Costa Alvarenga² 1 Discente do 8º período de Biomedicina da instituição AEMS 2 Docentes das Faculdades Integradas

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais

Carcinogêse e Neoplasia. Profº Ary da Silveira Mendes Jr.

Carcinogêse e Neoplasia. Profº Ary da Silveira Mendes Jr. Carcinogêse e Neoplasia Profº Ary da Silveira Mendes Jr. Epidemiologia Principal causa de morte entre 45-60 anos Incidência no Brasil em 2003 (INCA) 126.290 mortes 402.190 casos novos DOENÇA GENÉTICA Padrão

Leia mais

Hereditariedade e cancer de mama Mutacoes e Polimorfismos

Hereditariedade e cancer de mama Mutacoes e Polimorfismos Hereditariedade e cancer de mama Mutacoes e Polimorfismos Dr. Jose Claudio Casali da Rocha Laboratorio Mantis Diagnosticos Avancados IOP Instituto de Oncologia do Parana Hospital Erasto Gaertner PUC-PR

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA

MINISTÉRIO DA EDUCAÇÃO FUNDAÇÃO UNIVERSIDADE FEDERAL DO PAMPA PRO-REITORIA ACADÊMICA DADOS DE IDENTIFICAÇÃO Campus: Uruguaiana Curso: Enfermagem Componente Curricular: Genética Humana Código: UR 1303 Pré requisito: UR 1103 Co- requisito: ---------- Professor: Michel Mansur Machado Carga

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

Departamento de Patologia - Patologia Molecular - CÂNCER. Lucas Brandão. www.lucasbrandao.org. professor@lucasbrandao.org

Departamento de Patologia - Patologia Molecular - CÂNCER. Lucas Brandão. www.lucasbrandao.org. professor@lucasbrandao.org Departamento de Patologia - Patologia Molecular - CÂNCER Lucas Brandão www.lucasbrandao.org professor@lucasbrandao.org O Câncer mata... É a segunda principal causa de morte no mundo. Perde apenas para

Leia mais

CANCÊR O QUE É? CANCÊR O QUE É? Realização: CÂNCER O QUE É? Apoio:

CANCÊR O QUE É? CANCÊR O QUE É? Realização: CÂNCER O QUE É? Apoio: Realização: CÂNCER Apoio: Esta publicação foi realizada graças ao auxílio 98/14335-2 da FAPESP (CEPID) O câncer não é uma sentença de morte. Muito pelo contrário. Muitos tumores são curáveis. É possível

Leia mais

Tipos de Câncer. Saber identifi car sinais é essencial.

Tipos de Câncer. Saber identifi car sinais é essencial. Tipos de Câncer Saber identifi car sinais é essencial. O QUE É CÂNCER É uma doença cuja característica principal é o crescimento acelerado e desordenado das células, as quais têm grande potencial para

Leia mais

INTRODUÇÃO. Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos.

INTRODUÇÃO. Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos. CANCRO INTRODUÇÃO Cancro é o crescimento desordenado de células, que invadem tecidos e órgãos. Dividindo-se rapidamente, estas células tendem a ser muito agressivas e incontroláveis. O QUE É CANCRO Cancro

Leia mais

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia

Licenciatura em Ciências Biomédicas. T1. Conceitos Gerais em Toxicologia urso Área Disciplinar icenciatura em iências Biomédicas oxicologia () no lectivo 203/204 Docente ema Duração Mestre Dr. uis Silva Santos. onceitos erais em oxicologia 6 horas () : onceitos gerais em oxicologia

Leia mais

Apudoma TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO. PROCED. DESCRIÇÃO QT CID At. Prof. Vr. TOTAL

Apudoma TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO. PROCED. DESCRIÇÃO QT CID At. Prof. Vr. TOTAL TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO Apudoma 0304020117 Quimioterapia paliativa de apudoma (doença loco-regional avançada, inoperável, metastática ou recidivada; alteração da função hepática;

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

NEOPLASIAS. Prof. Dr. Fernando Ananias

NEOPLASIAS. Prof. Dr. Fernando Ananias NEOPLASIAS Prof. Dr. Fernando Ananias Neoplasia = princípio básico CLASSIFICAÇÃO DOS TUMORES Comportamento Benigno versus Maligno Crescimento lento rápido Semelhança com O tecido de origem (Diferenciação)

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4 IMUNOLOGIA Prof a. Dr a. Camila Souza Lemos camila.souzabiomedica@gmail.com AULA 4 Imunidade contra tumores Linfócitos T-CD8 (azul) atacando uma célula tumoral (amarela) A imunologia tumoral é o estudo

Leia mais

Câncer. Claudia witzel

Câncer. Claudia witzel Câncer Claudia witzel Célula Tecido O que é câncer? Agente cancerígeno Órgão Célula cancerosa Tecido infiltrado Ozana de Campos 3 ESTÁGIOS de evolução da célula até chegar ao tumor 1 Célula 2 Tecido alterado

Leia mais

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular Fundação Faculdade Federal de Ciências Médicas de Porto Alegre Disciplina de Genética Humana Curso de Medicina Estudo Dirigido: Ciclo Celular 1. Qual o papel de G0 no ciclo celular? Células ativas em divisão

Leia mais

CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR

CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR Plano de Aula -Desenvolvimento embrionário -Diferenciação celular -Células-tronco em diversos tecidos - Profª Juliana Schmidt

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

NUTRIÇÃO CLÍNICA APLICADA À ONCOLOGIA

NUTRIÇÃO CLÍNICA APLICADA À ONCOLOGIA NUTRIÇÃO CLÍNICA APLICADA À ONCOLOGIA Incidência mundial de câncer MASC GLOBOCAN, 2008 Incidência mundial de câncer FEM GLOBOCAN, 2008 (Colo Uterino) sexo masculino : Próstata, pulmão, estômago, cólon

Leia mais

Denominação geral dos tumores

Denominação geral dos tumores Imunologia dos tumores Denominação geral dos tumores Carcinomas - derivados de células epiteliais (rim, fígado, epitélio gastro-intestinal) Sarcomas - originários de fibroblastos, células musculares e

Leia mais

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos Antonio Luiz Gomes Júnior Genotoxicidade Definição: é o setor da genética que estuda os processos que alteram

Leia mais

TÍTULO: ALTERAÇÕES CROMOSSÔMICAS ESTRUTURAIS NAS LEUCEMIAS: MECANISMOS DE REGULAÇÃO AO POTENCIAL CARCINOGÊNICO.

TÍTULO: ALTERAÇÕES CROMOSSÔMICAS ESTRUTURAIS NAS LEUCEMIAS: MECANISMOS DE REGULAÇÃO AO POTENCIAL CARCINOGÊNICO. TÍTULO: ALTERAÇÕES CROMOSSÔMICAS ESTRUTURAIS NAS LEUCEMIAS: MECANISMOS DE REGULAÇÃO AO POTENCIAL CARCINOGÊNICO. CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: BIOMEDICINA INSTITUIÇÃO:

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Herança Multifatorial Herança Monogênica Herança Cromossômica Padrões de Herança Distúrbios Monogênicos São determinados por um

Leia mais

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015 01/05/2015 CÂNCER UTERINO É o câncer que se forma no colo do útero. Nessa parte, há células que podem CÂNCER CERVICAL se modificar produzindo um câncer. Em geral, é um câncer de crescimento lento, e pode

Leia mais

Mutações Cromossômicas Estruturais

Mutações Cromossômicas Estruturais Genética Básica Mutações Cromossômicas Estruturais Aline Intorne Definição: Mudança substancial na estrutura do cromossomo, possivelmente, afetando mais do que um único gene. Segmentos de cromossomos podem

Leia mais

O que é Câncer? Estágio de Iniciação

O que é Câncer? Estágio de Iniciação O que é Câncer? O câncer é definido como um tumor maligno, mas não é uma doença única e sim um conjunto de mais de 200 patologias, caracterizado pelo crescimento descontrolado de células anormais (malignas)

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

Papilomavírus Humano HPV

Papilomavírus Humano HPV Papilomavírus Humano HPV -BIOLOGIA- Alunos: André Aroeira, Antonio Lopes, Carlos Eduardo Rozário, João Marcos Fagundes, João Paulo Sobral e Hélio Gastão Prof.: Fragoso 1º Ano E.M. T. 13 Agente Causador

Leia mais

CLASSIFICAÇÃO DE AG. CARCINOGÊNICOS (International Agency Research Cancer)

CLASSIFICAÇÃO DE AG. CARCINOGÊNICOS (International Agency Research Cancer) CÂNCER OCUPACIONAL Localização Os tumores associados ao trabalho freqüentemente são observados nos órgãos em contato direto (portas de entrada e/ou eliminação)de diversos agentes carcinogênicos, por sua

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores Introdução Objetivos Ags expressados pelas células cancerosas Natureza da resposta Imune Como o câncer escapa do sistema Imune Imunoterapia Introdução ao Câncer Crescimento descontrolado produz um tumor

Leia mais

Genética III: Genética Humana

Genética III: Genética Humana Genética III: Genética Humana 1. Genética Humana As árvores genealógicas são usadas para mostrar a herança de doenças genéticas humanas. Uma árvore genealógica na qual é possível rastrear o padrão de herança

Leia mais

CONHECIMENTOS ESPECIALIZADOS

CONHECIMENTOS ESPECIALIZADOS CONHECIMENTOS ESPECIALIZADOS 31) O Código de Ética Médica apresenta uma série de princípios que são vedados aos médicos no que se refere à relação do profissional com pacientes e familiares. A respeito

Leia mais

Fonoaudiologia Oncológica Introdução

Fonoaudiologia Oncológica Introdução Fonoaudiologia Oncológica Introdução M.Sc. Profª Viviane Marques Fonoaudióloga, Neurofisiologista e Mestre em Fonoaudiologia Coordenadora da Pós-graduação em Fonoaudiologia Hospitalar da UVA Chefe da Equipe

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 10- Mutações, Polimorfismos e Variação no Número de Cópias Mutações somáticas x Mutações germinativas Tipos de mutações MUTAÇÃO GENÔMICA:

Leia mais

Amanda Bernardini Piacentini. Novas perspectivas para a Biologia do Câncer: Compreendendo as metástases.

Amanda Bernardini Piacentini. Novas perspectivas para a Biologia do Câncer: Compreendendo as metástases. UNIVERSIDADE ESTADUAL PAULISTA NSTITUTO DE BIOCIÊNCIAS - RIO CLARO CIÊNCIAS BIOLÓGICAS Amanda Bernardini Piacentini Novas perspectivas para a Biologia do Câncer: Compreendendo as metástases. Rio Claro

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais