Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3.

Tamanho: px
Começar a partir da página:

Download "Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3."

Transcrição

1 CONHECIMENTO ESPECÍFICO SOBRE O CÂNCER NÃO AUMENTA CONSCIENTIZAÇÃO. Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. 1 Voluntária Iniciação Científica PVIC/UEG 2 Pesquisadora Orientadora 3 Curso de Ciências Biológicas, Unidade Universitária de Ciências Exatas e Tecnológicas, UEG. RESUMO O organismo humano é formado por um agrupamento de células que em sua maioria cresce, se reproduz e morre em resposta aos sinais internos e externos. O material genético de uma célula, porém, podem sofrer alterações denominadas mutações, causadas por erros durante a replicação. Muitas delas não implicam em mudanças detectáveis na atividade metabólica, e passam despercebidas. Apenas um pequeno número ocorre em genes específicos determinando vantagens e um crescimento celular desordenado. Com o passar das divisões, uma célula poderá acumular mutações, perdendo o controle de sua divisão e desencadeando o aparecimento de um tumor que pode ser benigno (células agregadas como uma única massa) ou maligno (invasão para outros tecidos - câncer). Tabaco, radiação, alimentação e suscetibilidade genética são alguns dos fatores que podem contribuir para o surgimento da doença, sendo estes denominados carcinogênios. Para cada fator de risco há um modo de prevenção. A pesquisa foi realizada com o objetivo de realizar uma análise comparativa entre o 1º e 8º períodos para avaliar se o conhecimento específico sobre o câncer adquirido durante o curso gera uma maior conscientização entre os acadêmicos do curso de Ciências Biológicas. Palavras-chave: câncer, conscientização, conhecimento específico. Introdução Cada célula do corpo humano apresenta, em seu interior informações armazenadas no DNA genômico, determinadas pela combinação de bases nitrogenadas e que estabelece a seqüência dos genes (Maillet, 2003). O material genético pode sofrer alterações denominadas mutações, que passam desapercebidas por não alterar a atividade metabólica ou por determinar a morte celular (Zaha, 1996). Outras mutações, porém, provocam vantagens como proliferação excessiva e

2 desordenada, pois ocorrem em genes específicos como proto-oncogenes e supressores tumorais (Vidal & Mello, 1987). Agentes mutagênicos aceleram o aparecimento de mutações o que leva a formação de tumores benignos (associação de células em uma única massa) ou malignos (células invasivas) (Berkaloff et al, 1981), (Junqueira & Carneiro, 2000). O câncer é uma doença degenerativa resultante do acúmulo de lesões no material genético das células somáticas (Alberts et al, 2002). Tabaco, dieta alimentar, susceptibilidade genética, vírus, radiação, substâncias químicas e naturais são fatores que contribuem para o surgimento da doença em que para cada um há um modo de prevenção. A maioria desses fatores é mutagênico, porém nem todos são carcinogênicos (Raw et al, 1992). O tabaco é o responsável por cerca de 30% das mortes por câncer. O risco depende tanto do tempo de vício, quanto do número de cigarros consumidos por dia. A prevenção é obtida por meio da abstinência (Raw et al, 1992), (Bennett & Plum, 1996). A radiação ultravioleta emitida pelo sol é causa dominante dos carcinomas de pele. A prevenção baseia-se na redução à exposição à luz solar (Bennett & Plum, 1996). Fortes evidências indicam os hábitos alimentares como carcinógeno e também como fator de prevenção, através de uma alimentação rica em fibras, vitaminas A, C e E. Cerca de um terço ou mais de todos os cânceres está relacionado à dieta alimentar inadequada (Bennett & Plum, 1996). Cerca de 1 a 2% dos cânceres estão associados à susceptibilidade genética, porém os fatores ambientais compartilhados podem contribuir para a esta predisposição, como exposição excessiva ao sol, fumo (Raw et al, 1992). Existem mais de duas dezenas de agentes virais associados ao câncer em humanos, denominados vírus oncogênicos. Sobretudo, correlaciona-se o vírus da hepatite B com o câncer hepático e o Papilomavírus (HPV) com o de colo uterino. A prevenção baseia-se na detecção precoce, portanto a realização regular de exames preventivos torna-se fundamental e necessária (Schwarstmann, 1991). Atualmente existem mais de 200 compostos com atividade carcinogênica comprovada e a cada ano, cerca de mil produtos químicos novos são produzidos sem que se saiba se são carcinogênicos. Entre as substâncias químicas consideradas carcinogênicas

3 quase metade é medicamentos. Há também substâncias naturais com ação carcinogênica comprovada como a piperina da pimenta preta, a agaritina dos cogumelos comestíveis e a cafeína do café, chá preto e mate (Raw et al, 1992). Embora o organismo possua mecanismos de defesa naturais, hábitos benéficos à saúde podem suplantar a capacidade destes mecanismos de defesa celular contra mutações. Além disso, exames preventivos devem ser realizados periodicamente, para aumentar a chance de diagnóstico precoce (Napacan, 2005). A pesquisa foi realizada com o objetivo de realizar uma análise comparativa entre o 1º e 8º períodos para avaliar se o conhecimento específico sobre o câncer adquirido durante o curso gera uma maior conscientização entre os acadêmicos do curso de Ciências Biológicas. Material e Métodos A pesquisa foi realizada na Universidade Estadual de Goiás (UnUCET), com base em entrevistas feitas com os alunos matriculados no curso de Ciências Biológicas com idade variando de 14 a 30 anos. Os dados gerados foram analisados estatisticamente utilizando-se o programa estatístico Excel. Resultados e discussão Os dados obtidos sugerem que quase totalidade dos entrevistados tem conhecimento dos fatores de risco de câncer, porém não se previnem. Ao comparar os dados do 1º período e do 8º período observou-se uma mudança no nível de conhecimento, porém não há uma mudança significativa no que se refere à conscientização. Quando os alunos do 1º período foram questionados sobre a proteção contra raios UV, 44,4% afirmaram utilizar protetor solar diariamente; 27,8% afirmaram nunca usar. Vale ressaltar que 72,2% dos entrevistados usam protetor solar, sem saber se o mesmo é específico para seu tipo de pele. Os alunos do 8º período que possuem um maior conhecimento sobre os fatores de risco de câncer e por isso deveriam se prevenir melhor não demonstram tal conscientização já que 40% afirmaram usar protetor solar diariamente; 30% afirmaram nunca usar e 55% não sabem se o protetor utilizado é específico para seu tipo de pele.

4 Um dado alarmante é sobre a realização de exames de rotina (sangue, fezes, urina) em que 5% dos alunos do 8º período nunca realizaram; 40% raramente realizam; 40% realizam regularmente e 15% somente quando estão doentes. Dos alunos do 1º período 27,8% realizam raramente; 50% realizam regularmente e 22,2% somente quando estão doentes. Para agravar a situação os alunos do 8º período não possuem hábitos alimentares muito saudáveis já que ao analisar os dados constatou-se que 84,2% costumam trocar alguma refeição por lanches enquanto 64,7% dos alunos do 1º período possuem o mesmo hábito. Conclusão Com base nos resultados, é possível exatificar que embora os alunos saibam da existência de fatores de risco de câncer, estes não possuem conhecimento específico necessário para reconhecê-los. Ao analisar os dados referentes à proteção contra a radiação ultravioleta emitida pelo sol, conclui-se que os entrevistados possuem o hábito de utilizar protetor solar, mesmo sem saber da especificidade do produto com o tipo de pele. São agravantes as informações obtidas que corroboram a baixa freqüência com que os exames triviais são realizados pelos entrevistados. O etilismo, tabagismo, estresse e sedentarismo não se apresentaram como fatores de risco de câncer relevantes entre os alunos, de acordo com os dados obtidos. Observou-se um alto índice de câncer familiar, relatado pelos entrevistados. A preocupação em ter uma dieta alimentar adequada, expressa pelos alunos do curso ciências biológicas, é contrastada pelos resultados que demonstram que os mesmos não mantêm uma alimentação totalmente saudável. A falta de uso de equipamentos de proteção para o manuseio de produtos químicos, constitui um dado preocupante. Portanto, é de suma importância o desenvolvimento de programas informativos e de conscientização, visando o incentivo para a prevenção contra o câncer. Também é necessário rever se os objetivos da educação superior e do curso de Ciências Biológicas estão sendo alcançados no que se refere a tornar os alunos mais conscientes.

5 Referências Bibliográficas Alberts, B.; Bray, D.; Johnson, A.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P Fundamentos da Biologia Molecular Uma introdução à biologia molecular da célula. Ed. Artmed. Porto Alegre. pp Bennett, J. C.; Plum, F Cecil/Tratado de Medicina Interna. Ed. Guanabara Koogan. Rio de Janeiro. (20ª edição). pp1297. Berkaloff, A.; Bourget, P.; Favard, J.; Lacroex, C Biologie et Physiologie Cellulares. Paris. (Vol. 3). pp182. Junqueira, L. C.; Carneiro, J Biologia Celular e Molecular. Ed. Guanabara Koogan. Rio de Janeiro. (7ª edição). pp Maillet, M Biologia Celular. Ed. Santos. São Paulo. (8ª edição).pp 501. Napacan, Acessado em: 06 de junho de Raw, I.; Brentani, M.; Brentani, R.; Mennucci, L Bases Moleculares da Medicina (Câncer). Editora da Universidade de São Paulo. São Paulo. (Vol.3) pp Schwarstmann, G Oncologia Clínica Princípios e Prática. Ed. Artes Médicas. Porto Alegre. pp Vidal, B. C.; Mello, M. L. S Biologia Celular. Biologia Celular. Ed. Ateneu. Rio de Janeiro. pp 347. Zaha, A Biologia Molecular Básica. Ed. Mercado Aberto. Porto Alegre. pp

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET Rejane de Sousa Ferreira 1, Cristiane Alves da Fonseca 2, Andréia Juliana Leite

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Redações vencedoras I Concurso de Redação

Redações vencedoras I Concurso de Redação Redações vencedoras I Concurso de Redação 1 Lugar Aluno: Julia Stefani Moraes Professora: Regina M. Macedo de Melo Castro Informação: A melhor maneira de combater o câncer Penso que falar sobre este assunto

Leia mais

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Características principais Agente etiológico das verrugas (tumores epiteliais benignos) Infectam epitélio de

Leia mais

ATUALIZAÇÕES EM CÂNCER: TRATAMENTO

ATUALIZAÇÕES EM CÂNCER: TRATAMENTO ATUALIZAÇÕES EM CÂNCER: TRATAMENTO Elaine Jacob da Silva Carmo 1 ; Cristiane Alves da Fonseca 2,3 Andréia Juliana Leite Rodrigues 2,3, 4. 1 Curso de Ciências Biológicas, Unidade Universitária de Ciências

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Tipos de Câncer. Saber identifi car sinais é essencial.

Tipos de Câncer. Saber identifi car sinais é essencial. Tipos de Câncer Saber identifi car sinais é essencial. O QUE É CÂNCER É uma doença cuja característica principal é o crescimento acelerado e desordenado das células, as quais têm grande potencial para

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Prof.: Luiz Fernando Alves de Castro

Prof.: Luiz Fernando Alves de Castro Prof.: Luiz Fernando Alves de Castro Dia Nacional de Combate ao Câncer O Dia 27 de Novembro, Dia Nacional de Combate ao Câncer, é uma data que deve ser lembrada não para comemorarmos e, sim, para alertarmos

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

4. Câncer no Estado do Paraná

4. Câncer no Estado do Paraná 4. Câncer no Estado do Paraná Situação Epidemiológica do Câncer Doenças e Agravos Não Transmissíveis no Estado do Paraná Uma das principais causas de morte nos dias atuais, o câncer é um nome genérico

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

Câncer de Mama COMO SÃO AS MAMAS:

Câncer de Mama COMO SÃO AS MAMAS: Câncer de Mama COMO SÃO AS MAMAS: As mamas (ou seios) são glândulas e sua função principal é a produção de leite. Elas são compostas de lobos que se dividem em porções menores, os lóbulos, e ductos, que

Leia mais

Prevenção em dobro. Eixo de Prevenção do Câncer ganha segunda Unidade Móvel CAPA

Prevenção em dobro. Eixo de Prevenção do Câncer ganha segunda Unidade Móvel CAPA Prevenção em dobro Eixo de Prevenção do Câncer ganha segunda Unidade Móvel O eixo de Prevenção do Câncer do Programa Cuide-se+ acaba de ganhar um importante reforço no atendimento aos trabalhadores das

Leia mais

Qual é a função dos pulmões?

Qual é a função dos pulmões? Câncer de Pulmão Qual é a função dos pulmões? Os pulmões são constituídos por cinco lobos, três no pulmão direito e dois no esquerdo. Quando a pessoa inala o ar, os pulmões absorvem o oxigênio, que é levado

Leia mais

CONTEÚDO PROGRAMÁTICO 2011.1

CONTEÚDO PROGRAMÁTICO 2011.1 1 CONTEÚDO PROGRAMÁTICO 2011.1 CURSO: NUTRIÇÃO DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR TURMA: M (01) CARGA HORÁRIA: 54h PROFESSOR: João Ronaldo Tavares de Vasconcellos Neto COORDENADORA DO CURSO: Jalyne

Leia mais

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Hospital A.C.Camargo, um dos principais centros de diagnóstico, tratamento, ensino e pesquisa sobre o câncer da América Latina. Pesquisadores que

Leia mais

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER A EVOLUÇÃO DA LUTA CONTRA O CÂNCER Vanessa Gabriela Martins Pereira, Thaís Nogueira Silva, Laísa de Fátima Rangel, Karen Dias Ferreira, Hadassa Cristina Souza dos Santos, Gisele Aparecida de Castro Moreira,

Leia mais

Papilomavírus Humano HPV

Papilomavírus Humano HPV Papilomavírus Humano HPV -BIOLOGIA- Alunos: André Aroeira, Antonio Lopes, Carlos Eduardo Rozário, João Marcos Fagundes, João Paulo Sobral e Hélio Gastão Prof.: Fragoso 1º Ano E.M. T. 13 Agente Causador

Leia mais

PREVINA O CÂNCER DO COLO DO ÚTERO

PREVINA O CÂNCER DO COLO DO ÚTERO SENADO FEDERAL PREVINA O CÂNCER DO COLO DO ÚTERO SENADOR CLÉSIO ANDRADE 2 Previna o câncer do colo do útero apresentação O câncer do colo do útero continua matando muitas mulheres. Especialmente no Brasil,

Leia mais

PALAVRAJOVEM N 13-02/04/2013

PALAVRAJOVEM N 13-02/04/2013 PALAVRAJOVEM N 13-02/04/2013 RESPONSÁVEIS: Norma Holanda, Marcos Lima, Pedro Henrique, Jefferson Alves, Alcivan, Samaria Soto. ABERTURA: BOM DIA QUERIDOS OUVINTES, ESTÁ NO AR MAIS UM PROGRAMA DA ESCOLA

Leia mais

CANCÊR O QUE É? CANCÊR O QUE É? Realização: CÂNCER O QUE É? Apoio:

CANCÊR O QUE É? CANCÊR O QUE É? Realização: CÂNCER O QUE É? Apoio: Realização: CÂNCER Apoio: Esta publicação foi realizada graças ao auxílio 98/14335-2 da FAPESP (CEPID) O câncer não é uma sentença de morte. Muito pelo contrário. Muitos tumores são curáveis. É possível

Leia mais

Vamos falar sobre câncer?

Vamos falar sobre câncer? Vamos falar sobre câncer? O SIEMACO sempre está ao lado dos trabalhadores, seja na luta por melhores condições de trabalho, lazer e educação ou na manutenção da saúde, visando a promoção e ascensão social.

Leia mais

AVALIAÇÃO DO CONSUMO DE COMPOSTOS FITOQUÍMICOS EM PACIENTES SUBMETIDOS À TRATAMENTO QUIMIOTERÁPICO (2011) 1

AVALIAÇÃO DO CONSUMO DE COMPOSTOS FITOQUÍMICOS EM PACIENTES SUBMETIDOS À TRATAMENTO QUIMIOTERÁPICO (2011) 1 AVALIAÇÃO DO CONSUMO DE COMPOSTOS FITOQUÍMICOS EM PACIENTES SUBMETIDOS À TRATAMENTO QUIMIOTERÁPICO (2011) 1 MOURA, Deise Silva de 2 ; BLASI, Tereza Cristina²; BRASIL, Carla Cristina Bauermann 3 ; COSTA

Leia mais

Potencialmente perigosos

Potencialmente perigosos No mundo, 20% dos casos novos de câncer são associados a infecções virais e bacterianas Potencialmente perigosos Muito trabalho é investido na busca de explicações para o surgimento do câncer. Sabe-se

Leia mais

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE NISE HITOMI YAMAGUCHI ONCOLOGISTA E IMUNOLOGISTA UNIVERSIDADE DE SÃO PAULO MINISTÉRIO DA SAÚDE-ESTADO DE SÃO PAULO ENERGIA NUCLEAR DIAGNÓSTICO NA MEDICINA

Leia mais

OUTUBRO ROSA UMA CAMPANHA DE CONSCIENTIZAÇÃO DA SOFIS TECNOLOGIA

OUTUBRO ROSA UMA CAMPANHA DE CONSCIENTIZAÇÃO DA SOFIS TECNOLOGIA C A R T I L H A OUTUBRO ROSA UMA CAMPANHA DE CONSCIENTIZAÇÃO DA SOFIS TECNOLOGIA OOUTUBRO ROSA é um movimento mundial pela prevenção e diagnóstico precoce do câncer de mama. Com suas ações especialmente

Leia mais

DIA MUNDIAL DO CÂNCER 08 DE ABRIL

DIA MUNDIAL DO CÂNCER 08 DE ABRIL DIA MUNDIAL DO CÂNCER 08 DE ABRIL Enviado por LINK COMUNICAÇÃO EMPRESARIAL 04-Abr-2016 PQN - O Portal da Comunicação LINK COMUNICAÇÃO EMPRESARIAL - 04/04/2016 Que tal aproveitar o Dia Mundial do Câncer

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

O que é Câncer? Estágio de Iniciação

O que é Câncer? Estágio de Iniciação O que é Câncer? O câncer é definido como um tumor maligno, mas não é uma doença única e sim um conjunto de mais de 200 patologias, caracterizado pelo crescimento descontrolado de células anormais (malignas)

Leia mais

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015 UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES ONCOGÊNESE O QUE É O CÂNCER Câncer é o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado (maligno) de células

Leia mais

Disciplina: Patologia Bucal 5º período CÂNCER ORAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira

Disciplina: Patologia Bucal 5º período CÂNCER ORAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira Disciplina: Patologia Bucal 5º período CÂNCER ORAL http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 Sigmund Freud ( 1856-1939, 83 anos ) durante 59 anos, mais de 20 charutos/dia

Leia mais

PREVENÇÃO DO ENVELHECIMENTO CUTÂNEO E ATENUAÇÃO DE LINHAS DE EXPRESSÃO PELO AUMENTO DA SÍNTESE DE COLÁGENO RESUMO

PREVENÇÃO DO ENVELHECIMENTO CUTÂNEO E ATENUAÇÃO DE LINHAS DE EXPRESSÃO PELO AUMENTO DA SÍNTESE DE COLÁGENO RESUMO PREVENÇÃO DO ENVELHECIMENTO CUTÂNEO E ATENUAÇÃO DE LINHAS DE EXPRESSÃO PELO AUMENTO DA SÍNTESE DE COLÁGENO MACIEL, D. 1 ; OLIVEIRA, G.G. 2. 1. Acadêmica do 3ºano do Curso Superior Tecnólogo em Estética

Leia mais

EXERCÍCIO E DIABETES

EXERCÍCIO E DIABETES EXERCÍCIO E DIABETES Todos os dias ouvimos falar dos benefícios que os exercícios físicos proporcionam, de um modo geral, à nossa saúde. Pois bem, aproveitando a oportunidade, hoje falaremos sobre a Diabetes,

Leia mais

RADIAÇÃO ULTRAVIOLETA E CÂNCER DE PELE

RADIAÇÃO ULTRAVIOLETA E CÂNCER DE PELE UNIFESP UNIVERSIDADE FEDERAL DE SÃO PAULO ESCOLA PAULISTA DE MEDICINA PROGRAMA DE PÓS GRADUAÇÃO EM CIRURGIA PLÁSTICA REPARADORA Coordenadora e Professora Titular: Profa.Dra.Lydia Masako Ferreira RADIAÇÃO

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 Sigmund Freud ( 1856-1939, 83 anos ) durante 59 anos, mais de 20 charutos/dia

Leia mais

Câncer. Claudia witzel

Câncer. Claudia witzel Câncer Claudia witzel Célula Tecido O que é câncer? Agente cancerígeno Órgão Célula cancerosa Tecido infiltrado Ozana de Campos 3 ESTÁGIOS de evolução da célula até chegar ao tumor 1 Célula 2 Tecido alterado

Leia mais

atitudeé prevenir-se Moradores da Mooca:

atitudeé prevenir-se Moradores da Mooca: atitudeé prevenir-se Moradores da Mooca: Nós temos atitude, e você? O Câncer do Intestino pode ser prevenido com um teste simples e indolor que pode ser realizado em sua casa. O teste é GRATUITO oferecido

Leia mais

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4 IMUNOLOGIA Prof a. Dr a. Camila Souza Lemos camila.souzabiomedica@gmail.com AULA 4 Imunidade contra tumores Linfócitos T-CD8 (azul) atacando uma célula tumoral (amarela) A imunologia tumoral é o estudo

Leia mais

ATUALIZAÇÃO E EDUCAÇÃO EM SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA

ATUALIZAÇÃO E EDUCAÇÃO EM SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA ATUALIZAÇÃO E EDUCAÇÃO EM SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA Daniel Martins do Nascimento 2,3 ; Cristiane Alves Fonseca 1,3 ; Andréia Juliana Leite 1,4 ; 1 Pesquisador Orientador 2 Voluntário Iniciação

Leia mais

De 30% a 60% dos casos de câncer poderiam ser evitados com uma boa. alimentação

De 30% a 60% dos casos de câncer poderiam ser evitados com uma boa. alimentação De 30% a 60% dos casos de câncer poderiam ser evitados com uma boa alimentação Mudança na alimentação é apontada como uma das medidas mais importantes de prevenção ao câncer, dizem institutos Foto: Gonza

Leia mais

Entenda o que é o câncer de mama e os métodos de prevenção. Fonte: Instituto Nacional de Câncer (Inca)

Entenda o que é o câncer de mama e os métodos de prevenção. Fonte: Instituto Nacional de Câncer (Inca) Entenda o que é o câncer de mama e os métodos de prevenção Fonte: Instituto Nacional de Câncer (Inca) O que é? É o tipo de câncer mais comum entre as mulheres no mundo e no Brasil, depois do de pele não

Leia mais

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo?

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? BIOLOGIA Cláudio Góes Fundamentos de oncologia 1. Introdução Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? Nesta unidade, você verá que o termo câncer refere-se a uma variedade de

Leia mais

CANCER DE MAMA FERNANDO CAMILO MAGIONI ENFERMEIRO DO TRABALHO

CANCER DE MAMA FERNANDO CAMILO MAGIONI ENFERMEIRO DO TRABALHO CANCER DE MAMA FERNANDO CAMILO MAGIONI ENFERMEIRO DO TRABALHO OS TIPOS DE CANCER DE MAMA O câncer de mama ocorre quando as células deste órgão passam a se dividir e se reproduzir muito rápido e de forma

Leia mais

PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS

PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS CERBARO, Kamila 1 ; GARCES, Solange Beatriz Billig 2 ; HANSEN, Dinara 2 ; ROSA, Carolina Böettge 2 ; BRUNELLI, Ângela Vieira

Leia mais

O que é o câncer de mama?

O que é o câncer de mama? O que é o câncer de mama? As células do corpo normalmente se dividem de forma controlada. Novas células são formadas para substituir células velhas ou que sofreram danos. No entanto, às vezes, quando células

Leia mais

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV UNIC Universidade de Cuiabá NEOPLASIAS CMF IV Aspectos Morfológicos das Neoplasias DEFINIÇÕES Neoplasia Tumor Câncer Inflamação/Neoplasia Termo comum a todos tumores malignos. Derivado do grego Karkinos

Leia mais

III EGEPUB/COPPE/UFRJ

III EGEPUB/COPPE/UFRJ Luiz Otávio Zahar III EGEPUB/COPPE/UFRJ 27/11/2014 O que é a próstata? A próstata é uma glândula pequena que fica abaixo da bexiga e envolve o tubo (chamado uretra) pelo qual passam a urina e o sêmen.

Leia mais

Saúde Bucal no Programa de Saúde da Família De Nova Olímpia - MT. Importância da Campanha de. Nova Olímpia MT.

Saúde Bucal no Programa de Saúde da Família De Nova Olímpia - MT. Importância da Campanha de. Nova Olímpia MT. Saúde Bucal no Programa de Saúde da Família De Nova Olímpia - MT Importância da Campanha de câncer bucal no Município de Nova Olímpia MT. Autores: - CD Fabrício Galli e - CD Michelle Feitosa Costa. Com

Leia mais

ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A

ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A IMUNOEXPRESSÃO DO PCNA, KI-67 E CICLINA B1 SPÍNDULA FILHO, José Vieira de ;

Leia mais

UNILAB no Outubro Rosa Essa luta também é nossa. CUIDAR DA SAÚDE É UM GESTO DE AMOR À VIDA. cosbem COORDENAÇÃO DE SAÚDE E BEM-ESTAR www.unilab.edu.

UNILAB no Outubro Rosa Essa luta também é nossa. CUIDAR DA SAÚDE É UM GESTO DE AMOR À VIDA. cosbem COORDENAÇÃO DE SAÚDE E BEM-ESTAR www.unilab.edu. UNILAB no Outubro Rosa Essa luta também é nossa. CUIDAR DA SAÚDE É UM GESTO DE AMOR À VIDA. cosbem COORDENAÇÃO DE SAÚDE E BEM-ESTAR www.unilab.edu.br CUIDAR DA SUA SAÚDE É UM GESTO DE AMOR À VIDA. As mamas

Leia mais

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O fígado e a deficiência de alfa-1 antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O que é deficiência de alfa-1 antitripsina? Alfa-1 é uma condição que pode resultar em graves doenças pulmonares em adultos

Leia mais

Descobrindo o valor da

Descobrindo o valor da Descobrindo o valor da Ocâncer de mama, segundo em maior ocorrência no mundo, é um tumor maligno que se desenvolve devido a alterações genéticas nas células mamárias, que sofrem um crescimento anormal.

Leia mais

Câncer de Pulmão. Prof. Dr. Luis Carlos Losso Medicina Torácica Cremesp 18.186

Câncer de Pulmão. Prof. Dr. Luis Carlos Losso Medicina Torácica Cremesp 18.186 Câncer de Pulmão Todos os tipos de câncer podem se desenvolver em nossas células, as unidades básicas da vida. E para entender o câncer, precisamos saber como as células normais tornam-se cancerosas. O

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

CITOLOGIA ONCÓTICA CÂNCER

CITOLOGIA ONCÓTICA CÂNCER CITOLOGIA ONCÓTICA Neoplasia: crescimento desordenado de células, originando um tumor (massa de células) Tumor benigno: massa localizada de células que se multiplicam vagarosamente e se assemelham ao seu

Leia mais

E R R E C B N Â C SOR FALAS O VAM

E R R E C B N Â C SOR FALAS O VAM VAMOS FALAR SOBRE CÂNCER Câncer O que é? O câncer tem como principal característica o crescimento desordenado das células do corpo. O que diferencia os tipos de câncer, entre maligno e benigno, é a velocidade

Leia mais

Porque se cuidar é coisa de homem. Saúde do homem

Porque se cuidar é coisa de homem. Saúde do homem Porque se cuidar é coisa de homem. Saúde do homem SAÚDE DO HOMEM Por preconceito, muitos homens ainda resistem em procurar orientação médica ou submeter-se a exames preventivos, principalmente os de

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Segundo recente relatório da Agência Internacional para Pesquisa em Câncer (IARC) /OMS (World Cancer Report 2008), o impacto global do câncer mais que dobrou em 30 anos. Estimou-se que, no ano de 2008,

Leia mais

Pâncreas. Pancreatite aguda. Escolha uma das opções abaixo para ler mais detalhes.

Pâncreas. Pancreatite aguda. Escolha uma das opções abaixo para ler mais detalhes. Pâncreas Escolha uma das opções abaixo para ler mais detalhes. Pancreatite aguda Pancreatite crônica Cistos pancreáticos Câncer de Pancrêas Pancreatite aguda O pâncreas é um órgão com duas funções básicas:

Leia mais

CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR

CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR CÉLULAS-TRONCO E A DIFERENCIAÇÃO CELULAR Plano de Aula -Desenvolvimento embrionário -Diferenciação celular -Células-tronco em diversos tecidos - Profª Juliana Schmidt

Leia mais

Carcinogénese ambiental, tabaco, bactérias e vírus

Carcinogénese ambiental, tabaco, bactérias e vírus Carcinogénese ambiental, tabaco, bactérias e vírus (acompanhem com os slides!!) O tabaco, vírus e bactérias são exemplos. Os carcinogéneos ambientais são muitos mais do que estes. O que este esquema pretende

Leia mais

Azul. Novembro. cosbem. Mergulhe nessa onda! A cor da coragem é azul. Mês de Conscientização, Preveção e Combate ao Câncer De Próstata.

Azul. Novembro. cosbem. Mergulhe nessa onda! A cor da coragem é azul. Mês de Conscientização, Preveção e Combate ao Câncer De Próstata. cosbem COORDENAÇÃO DE SAÚDE E BEM-ESTAR Novembro Azul Mês de Conscientização, Preveção e Combate ao Câncer De Próstata. Mergulhe nessa onda! A cor da coragem é azul. NOVEMBRO AZUL Mês de Conscientização,

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

Câncer: mais 500 mil casos

Câncer: mais 500 mil casos Página 1 de 5 Quarta, 18 de Maio de 2011 ENTREVISTA Câncer: mais 500 mil casos O oncologista afirma que o Brasil não tem estrutura física e médica para tratar outro meio milhão de pessoas com câncer em

Leia mais

Câncer de Colo de Útero: Prevenir é o melhor remédio!

Câncer de Colo de Útero: Prevenir é o melhor remédio! Câncer de Colo de Útero: Prevenir é o melhor remédio! PASSATEMPOS BOM PRA CABEÇA Dominox a caça-palavr eto código secr s e muito mai 2 caça-palavra coquetel Procure e marque, no diagrama de letras, as

Leia mais

Apoptose em Otorrinolaringologia

Apoptose em Otorrinolaringologia Apoptose em Otorrinolaringologia Teolinda Mendoza de Morales e Myrian Adriana Pérez García Definição A apoptose é um processo biológico existente em todas as células de nosso organismo, conhecida desde

Leia mais

História Natural das Doenças e Níveis de Aplicação de Medidas Preventivas

História Natural das Doenças e Níveis de Aplicação de Medidas Preventivas Universidade Federal do Rio de Janeiro Centro de Ciências da Saúde Faculdade de Medicina / Instituto de Estudos em Saúde Coletiva - IESC Departamento Medicina Preventiva Disciplina de Epidemiologia História

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

PROTETOR SOLAR. Priscila Pessoa, bolsista PIBID, Licenciatura em Química, IQ-UNICAMP

PROTETOR SOLAR. Priscila Pessoa, bolsista PIBID, Licenciatura em Química, IQ-UNICAMP PROTETOR SOLAR Priscila Pessoa, bolsista PIBID, Licenciatura em Química, IQ-UNICAMP É a fonte de energia essencial para a vida na terra e muitos são os benefícios trazidos pela luz solar para os seres

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

ANÁLISE DE PERFIL EPIDEMIOLÓGICO DE MULHERES QUE FAZEM EXAME PAPANICOLAU EM UNIDADE DE SAÚDE EM CAJAZEIRAS-PB E RALAÇÕES COM HPV.

ANÁLISE DE PERFIL EPIDEMIOLÓGICO DE MULHERES QUE FAZEM EXAME PAPANICOLAU EM UNIDADE DE SAÚDE EM CAJAZEIRAS-PB E RALAÇÕES COM HPV. ANÁLISE DE PERFIL EPIDEMIOLÓGICO DE MULHERES QUE FAZEM EXAME PAPANICOLAU EM UNIDADE DE SAÚDE EM CAJAZEIRAS-PB E Saúde e Educação Janiele Maria Vasconcelos Mota RALAÇÕES COM HPV Áreas Temáticas Autora Instituição

Leia mais

O que é câncer de mama?

O que é câncer de mama? Câncer de Mama O que é câncer de mama? O câncer de mama é a doença em que as células normais da mama começam a se modificar, multiplicando-se sem controle e deixando de morrer, formando uma massa de células

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

EDITAL DE TRANSFERÊNCIA PARA O CURSO DE GRADUAÇÃO EM MEDICINA DA FACULDADE DINÂMICA 1º SEMESTRE DE 2016

EDITAL DE TRANSFERÊNCIA PARA O CURSO DE GRADUAÇÃO EM MEDICINA DA FACULDADE DINÂMICA 1º SEMESTRE DE 2016 EDITAL DE TRANSFERÊNCIA PARA O CURSO DE GRADUAÇÃO EM MEDICINA DA FACULDADE DINÂMICA 1º SEMESTRE DE 2016 EDITAL Nº 01/2016 O Diretor Geral da Faculdade Dinâmica, no uso das atribuições que lhe são conferidas

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Apresentação. Introdução. Francine Leite. Luiz Augusto Carneiro Superintendente Executivo

Apresentação. Introdução. Francine Leite. Luiz Augusto Carneiro Superintendente Executivo Evolução dos Fatores de Risco para Doenças Crônicas e da prevalência do Diabete Melito e Hipertensão Arterial na população brasileira: Resultados do VIGITEL 2006-2009 Luiz Augusto Carneiro Superintendente

Leia mais

Câncer de Próstata. Fernando Magioni Enfermeiro do Trabalho

Câncer de Próstata. Fernando Magioni Enfermeiro do Trabalho Câncer de Próstata Fernando Magioni Enfermeiro do Trabalho O que é próstata? A próstata é uma glândula que só o homem possui e que se localiza na parte baixa do abdômen. Ela é um órgão muito pequeno, tem

Leia mais

Você sabe os fatores que interferem na sua saúde?

Você sabe os fatores que interferem na sua saúde? DICAS DE SAÚDE 2 Promova a sua saúde. Você sabe os fatores que interferem na sua saúde? Veja o gráfico : 53% ao estilo de vida 17% a fatores hereditários 20% a condições ambientais 10% à assistência médica

Leia mais

NOVEMBRO. NAO SE ESCONDA ATRaS DOS SEUS PRECONCEITOS CUIDAR DA SAUDE TAMBEM e COISA DE HOMEM

NOVEMBRO. NAO SE ESCONDA ATRaS DOS SEUS PRECONCEITOS CUIDAR DA SAUDE TAMBEM e COISA DE HOMEM NOVEMBRO AZUL NAO SE ESCONDA ATRaS DOS SEUS PRECONCEITOS CUIDAR DA SAUDE TAMBEM e COISA DE HOMEM O movimento internacional, conhecido como Novembro Azul, é comemorado em todo o mundo, quando teve início

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

Povoado de Goiás tem maior índice mundial de doença rara de pele

Povoado de Goiás tem maior índice mundial de doença rara de pele http://www1.folha.uol.com.br/equilibrioesaude/2015/11/1704700-povoado-de-goias-temmaior-indice-mundial-de-doenca-rara-de-pele.shtml Povoado de Goiás tem maior índice mundial de doença rara de pele 11/11/2015

Leia mais

Papilomavirus Humano (HPV)

Papilomavirus Humano (HPV) Papilomavirus Humano (HPV) Introdução O HPV é uma doença infecciosa, de transmissão freqüentemente sexual, cujo agente etiológico é um vírus DNA não cultivável do grupo papovírus. Atualmente são conhecidos

Leia mais

Pesquisa revela uma das causas de morte prematura na Rússia: a vodca

Pesquisa revela uma das causas de morte prematura na Rússia: a vodca Pesquisa revela uma das causas de morte prematura na Rússia: a vodca Post 02 Fevereiro 2014 By UNIAD Revista Veja - Álcool Estudo concluiu que risco de morte entre homens russos com menos de 55 anos pode

Leia mais

Análise e discussão: O câncer do colo uterino é uma doença de evolução lenta. Na grande maioria dos casos, esta neoplasia é precedida por estágios

Análise e discussão: O câncer do colo uterino é uma doença de evolução lenta. Na grande maioria dos casos, esta neoplasia é precedida por estágios PREVENÇÃO DE LESÕES EPITELIAIS DE COLO UTERINO EM GESTANTES ATENDIDAS NO HOSPITAL UNIVERSITÁRIO DE SANTA MARIA Área Temática: Saúde Thissiane de Lima Gonçalves 1 Leidiane de Lucca 2, Leiticia B. Jantsch³,

Leia mais

D I R E T O R I A D E S A Ú D E

D I R E T O R I A D E S A Ú D E Saúde In Forma Junho/2013 Dia 26 de Junho Dia Nacional do Diabetes Diabetes é uma doença metabólica caracterizada por um aumento anormal da glicose ou açúcar no sangue. A glicose é a principal fonte de

Leia mais

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015 01/05/2015 CÂNCER UTERINO É o câncer que se forma no colo do útero. Nessa parte, há células que podem CÂNCER CERVICAL se modificar produzindo um câncer. Em geral, é um câncer de crescimento lento, e pode

Leia mais

PROTETORES SOLARES. Priscila Pessoa, bolsista PIBID, IQ-UNICAMP

PROTETORES SOLARES. Priscila Pessoa, bolsista PIBID, IQ-UNICAMP PROTETORES SOLARES Priscila Pessoa, bolsista PIBID, IQ-UNICAMP O sol é uma fonte de energia essencial para a vida na terra pois, direta ou indiretamente a maioria dos ciclos biológicos dependem da radiação

Leia mais

é a vez dos homens câncer.

é a vez dos homens câncer. Agora é a vez dos homens falarem sobre câncer. Agora é a vez dos homens falarem sobre câncer Uma publicação do SIEMACO Sindicato dos Trabalhadores em Empresas de Prestação de Serviços de Asseio e Conservação

Leia mais

É por isso que um exame clínico anual das mamas, através de um médico, é obrigatório.

É por isso que um exame clínico anual das mamas, através de um médico, é obrigatório. OUTUBRO ROSA 25 de outubro Mais detalhes sobre o câncer de mama no Brasil 1. Exames clínicos de mama são tão importantes quanto as mamografias. Mamografias a partir de 40 anos de idade são cruciais (Deve

Leia mais

Dra Adriana de O Marinho Reumatologia e Clínica Médica Fone 3223-3830

Dra Adriana de O Marinho Reumatologia e Clínica Médica Fone 3223-3830 Dra Adriana de O Marinho Reumatologia e Clínica Médica Fone 3223-3830 O que é Osteoporose? A osteoporose é uma doença freqüente que é definida como diminuição absoluta da quantidade de osso e desestruturação

Leia mais

Que tipos de Diabetes existem?

Que tipos de Diabetes existem? Que tipos de Diabetes existem? -Diabetes Tipo 1 -também conhecida como Diabetes Insulinodependente -Diabetes Tipo 2 - Diabetes Gestacional -Outros tipos de Diabetes Organismo Saudável As células utilizam

Leia mais

CÂNCER DE MAMA: é preciso falar disso. Ministério da Saúde Instituto Nacional de Câncer José Alencar Gomes da Silva

CÂNCER DE MAMA: é preciso falar disso. Ministério da Saúde Instituto Nacional de Câncer José Alencar Gomes da Silva CÂNCER DE MAMA: é preciso falar disso Ministério da Saúde Instituto Nacional de Câncer José Alencar Gomes da Silva 2014 Instituto Nacional de Câncer José Alencar Gomes da Silva/ Ministério da Saúde. Esta

Leia mais