Departamento de Patologia - Patologia Molecular - CÂNCER. Lucas Brandão.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Departamento de Patologia - Patologia Molecular - CÂNCER. Lucas Brandão. www.lucasbrandao.org. professor@lucasbrandao.org"

Transcrição

1 Departamento de Patologia - Patologia Molecular - CÂNCER Lucas Brandão

2

3 O Câncer mata... É a segunda principal causa de morte no mundo. Perde apenas para doenças do cardiovasculares.

4 Definições Neoplasias: Crescimento novo Tumor: Intumescimento causado pela inflamação Oncologia: oncus = tumor; estudo dos tumores ou neoplasias Câncer: São tumores malignos Câncer deriva do caranguejo - capaz de aderir em qualquer superfície veementemente.

5 Neoplasia... É uma massa anormal de tecido, cujo o crescimento excede aquele dos tecidos normais e não está coordenado com ele, persistindo da mesma maneira excessiva após o término do estímulo que induz a alteração. Tecido hospedeiro - compete com o tecido normal (energia e nutrientes)

6 VISÃO GERAL Estudando o Câncer

7 O que é câncer? Definido como Iniciada por Progride por Células em divisão descontrolada Mutação do DNA Tumor primário;- Divisão das células mutadas no local de origem (i.e. in situ) Câncer invasivo- Invasão dos tecidos circundantes Metástase -via vasos sanguíneas e linfáticos para formar tumores secundários (linfonodos, baço, fígado, pulmão, ossos, cérebro) Pode matar por Drenar as fontes nutricionais Bloquear os órgãos vitais Hemorragia dos vasos sanguíneos Diminui a resistência à infecções

8 CÂNCER: UMA DOENÇA MULTIFATORIAL

9 Fatores envolvidos no Câncer Carcinôgenos Ambientais químicos (benzopirene, aflatoxina B, nitrosaminas, etc.) vírus & bactéria (Epstein-Barr, papiloma, H. pylori,etc.) hormônios (esteróides ingeridos) radiação (ionizante [Raios X & radioisótopos] e não-ionizante [UV]) Fatores Hereditários Genes herdados Enzimas reparadoras de DNA Sistema imune Outros fatores Idade Sexo Inflamação crônica

10 Um doença multifatorial Um estudo multiprofissional Óticas do Estudo do Câncer Patologia Molecular Anatomia Histologia Imunologia Biologia Celular Bioquímica

11 Células Normais Pequenas, tamanho regular e forma homogenia ~50 divisões in vitro Apresentam inibição de contato Crescem em superfícies sólidas & aderem-se umas às outras Células Cancerígenas Largas com núcleo ampliados e diferentes uns dos outros em tamanho e forma imortais in vitro Crescem umas em cima das outras Apresentam pouca afinidade e podem crescer em suspensão. A menor afinidade permite as células cancerígenas quebrarem se do tumor primário quando elas escapam para os vasos sanguíneos/ linfáticos Devido as células poderem sobreviver sem uma superfícies sólida, elas podem viajar pelos vasos sanguíneos/linfáticos até se alojarem e iniciarem um tumor secundário. Células criptas normais Células Hiperplásticas Células Displásticas

12 Por que apenas certos pacientes com um tipo de câncer respondem a quimioterapia ou outros tratamentos? Certos cânceres que se assemelham, de acordo com os patologistas clássicos, podem ser bastantes diferentes quando avaliados pela patologia molecular. Isto faz sentido quando percebemos que nenhum câncer é causado por um único gene.

13 O CÂNCER em detalhes

14 Câncer Definição: Uma desordem progressiva das transduções de sinais levando a um crescimento descontrolado das células Células em divisão descontrolada

15 Proliferação EGF, estrógeno Movimento IL-8, SDF-1 Diferenciação G-CSF, RA, TGFβ Resposta ao Stress calor, viroses Estacionar Ativação Celular LPS, IgE + Ag, esteróides, transduções de sinais som, luz, paladar, cheiro Morte TNFα, FasL Nos organismos multicelulares suas células se comunicam por transduções de sinais.

16 Proliferação Ciclo celular - Controla a proliferação celular Ponto de checagem de danos ao DNA O DNA foi Reparado? Ponto de checagem da apoptose checkpoints - Transição G2/M - Transição G1/S

17 O que faz uma célula normal transforma-se numa célula cancerígena? -Perda do controle do crescimento celular XCél. Normal Regulação do ciclo celular: - suprimir a divisão celular - estimular a divisão celular X Ciclo celular apresentam muitos checkpoints - Transição G2/M - Transição G1/S Situação onde é possível controlar Cél. Cancerígena Desegulação do ciclo celular - suprimir a divisão celular - estimular a divisão celular Situação perda total em controlar X

18 Perda do controle do crescimento celular COMO? A maioria dos cânceres são devido ao acúmulo de mutações Evidências sugerem que instabilidade cromossômica, ou perda do braço maior do cromossomo contribuem.

19 O que faz uma célula normal transforma-se numa célula cancerígena? -Perda do controle do crescimento celular XCél. Normal Regulação do ciclo celular: - suprimir a divisão celular - estimular a divisão celular X Ciclo celular apresentam muitos checkpoints - Transição G2/M - Transição G1/S Situação onde é possível controlar mutações Cél. Cancerígena Desegulação do ciclo celular - suprimir a divisão celular - estimular a divisão celular Situação perda total em controlar X

20 BENIGNO X MALIGNO

21 Conceitos usados na diferenciação da gravidade Diferenciação e Anaplasia Velocidade de Crescimento Invasão Local Metástase

22 Diferenciação e Anaplasia Diferenciação: O quão diferente as células parenquimatosas neoplásicas estão das células normais Quanto MAIS DIFERENCIADO o tumor MAIS parecido com o tecido normal. Quanto MENOS DIFERENCIADO o tumor MENOS parecido com o tecido normal. Benignos = Bem diferenciados Malignos = Pouco diferenciado ou indiferenciado (anaplásicas)

23 Tumor bem diferenciado e Maligno? Existe?

24 MUDANÇAS NO PERFIL DE EXPRESSÃO GÊNICA As células indiferenciados perdem o seu programa histoespecífico e passam a produzir outros tipos de proteínas Genes Ativação Repressão

25 Velocidade de Crescimento Tumores benignos crescem numa velocidade mais lenta quando comparados com os malignos. Quanto menor for a diferenciação maior será sua velocidade de crescimento Velocidade de crescimento não é constante Crescimento é afetado por: Capacidades hormonais Suprimento Sanguíneo Subclones específicos

26 Cinética Celular do Crescimento tumoral

27 Invasão Local Perda do reconhecimento anatômico normal. Destruição do tecido circundante.

28 Metástase Significa Malignidade. Se dá após o processo de invasão de células cancerígenas nos vasos sanguíneos, linfáticos e cavidades corporais.

29 Carcinogênese Etapas da formação/ estabelecimento do câncer Iniciação Promoção Progressão

30 Etapa 1: Iniciação Simples mutação em um ou mais genes celulares q u e c o n t r o l a m a s principais vias da célula.

31 Importante Lesão genética não-letal de uma única célula e sua expansão clonal (tumor monoclonal)

32 Etapa 2: Promoção Matriz extracelular Membrana celular fator de crescimento Sítio de ligação Proteína receptora não ligada Citoplasma Inativo Ativada Sempre ativada Divisão celular normal Divisão celular excessiva

33

34 Classes de Genes Qual a lógica: Existem genes que promovem a divisão celular Proto-oncogenes Existem genes que inibem a divisão celular Genes supressores de tumor Existem genes que regulam a morte celular programada Genes Apoptóticos Existem genes que concertam o DNA Genes estabilizadores

35 PROTO-ONCOGENES Os aceleradores

36 Proto-oncogenes Genes normais celulares

37 Mutações no DNA Alterações estruturais no gene Alterações Alterações na regulação da expressão gênica Transdução Viral X Proto-oncogenes Genes normais celulares alterados

38 oncogenes Genes promotores de neoplasia

39 Proto-oncogenes Os aceleradores - Genes codificantes de proteínas que promovem a divisão celular - São componentes do mecanismo normal para a regulação da progressão do ciclo celular - Se mutados, podem resultar em proteínas desreguladas, mas totalmente ativas. - As proteínas mutadas levam a célula a prosseguir através do ciclo celular de maneira descontrolada. -Se mutado vira Oncogene gene que induz ou continua a proliferação de células descontroladas.

40 Papel dos proto-oncogenes no ciclo celular 1. Ligação de um fator de crescimento a um receptor específico 2.Ativação transitória e limitada do receptor 3.Transdução intracelular do sinal para o crescimento 4.Indução e Ativação de fatores de transcrição 5.Entrada no ciclo celular - Divisão celular

41 Classes do Proto-oncogenes Fatores de Crescimento Receptores dos Fatores de Crescimento Proteínas Transdutoras de Sinais Fatores de Transcrição Nuclear Ciclinas e Quinase dependentes de Ciclinas

42

43 Fatores de Crescimento e seus receptores e transdutores.

44

45

46 Família de Proteína RAS 10 a 20% dos tumores apresentam o proto-oncogene ras mutado Associado ao crescimento celular por mitose. Fixadas na parte interna da membrana plasmática. Apresentam uma forma inativa e outra ativa. Inativa se associa com o GDP Ativa se associa com o GTP Mutação dominante.

47 47

48 Fatores de Transcrição

49 Transcrição Gênica no crescimento celular Os sinais para crescimento celular devem culminar na produção de proteínas quem permitam com que a célula se divida. Proteínas para replicação celular Proteínas para divisão celular A transcrição é regula por fatores de transcrição nucleares Esses fatores podem se ligar no DNA na região promotora de genes específicos induzindo/aumentando a sua produção. 49

50 Exemplos c-myc Expresso constitutivamente Quando estimulado sofre um aumento significativo da sua expressão e culmina na entrada da fase S. max max c-myc c-myc 50

51 max c-myc Induz ou aumenta a expressão de genes boxe E mrna

52 mad max reprime a expressão de genes boxe E

53 mad max max c-myc Balanço entre as concentrações de c-myc, mad, max 53

54 Ciclina e quinase dependente de ciclina

55 Moléculas Chaves no controle do ciclo celular Ciclinas; Quinase dependente de ciclina (CDK); fator de transcrição E2F; prb, p53; Inibidores de Ciclinas-CDK (CIK). Fosfatases Complexo Ciclina-CDK

56 PRINCIPAIS MOLÉCULAS CONTROLADORAS DO CICLO Ciclinas proteínas cujas concentrações na célula oscilam ciclicamente, acompanhando as fases do ciclo Quinases enzimas que transferem o 3 º grupo fosfato do ATP e se ligam as ciclinas. Fosfatases removem grupo fosfato de um substrato por hidrólise Ubiquitinas pequenas proteínas utilizadas em cadeia (poliubiquitina) para marcação de outras proteínas destinadas à proteólise por proteossomos (complexo protéico em forma de cilindro que reduz proteínas a pequenos peptídeos)

57 MPF ATIVADO = MITOSE Vários fatores promovem a sintese de Ciclina B e vários outros promove a ativação de MPF

58 Ciclinas e CDKs Ciclina D interage com CDK 4 e 6 (Fase inicial do G1) Ciclina E interage com CDK2 (Fase tardia do G1) Esses complexos dois ativam (por fosforilação) a prb que deixa de inibir o ciclo celular (proteína do retinoblastoma que é um inibidor do ciclo celular)

59

60 prb fosforilada (ativa) Não inibe o fator de transcrição (E2F) Transcrição de proteínas para entrar na Fase S DNA polimerase, histonas...

61 Ciclinas e CDKs Ciclina A se liga a CDK2 e 1 (entrar na fase G2) Ciclina B se liga a CDK1 (sair da fase G2 e entrar na M)

62 Inibidores de CDK (CDKI) p21, p27, p57; p15, p16, p18, p19;

63 SUPRESSORES DE TUMOR Os freios

64 supressores de tumor Genes normais celulares

65 Mutações no DNA Alterações estruturais no gene Alterações Alterações na regulação da expressão gênica Transdução Viral X supressores de tumor Genes normais celulares alterados

66 tumor Genes promotores de neoplasia

67 Supressores de Tumor Os freios - São genes que codificam proteínas que normalmente inibem a divisão celular -Atuam na transição G2/M ou na transição G1/S - Quando mutados perdem o ponto de checagem - Células procedem pelo ciclo celular de maneira descontrolada

68 Retinoblastoma - Tumor maligno da retina - Usualmente bilateral - Ocorre primariamente e crianças - 1:20,000 nascido - Aumenta o risco de tumor osteogênico especialmente se a criança recebe radiação É um câncer que pode ser herdado em 40% dos casos Mutações no gene RB Hipótese de DOIS EVENTOS Proposta por Alfred Knuson (1971)

69 Hipótese de DOIS EVENTOS Proposta por Alfred Knudson (1971) Para o câncer ser estabelecido são necessários DOIS eventos 1. É preciso que a cópia de gene supressor de tumor sofra uma mutação e perca a sua função 2. É preciso que a outra cópia do MESMO gene supressor de tumor sofra uma mutação e perca a sua função

70 Perde e reduplicação Deleção 1 evento 2 evento Mutação NORMAL NORMAL Portador AFETADO Recombinação

71 Função dos Genes Supressores Tumorais São genes que codificam proteínas que normalmente inibem a divisão celular prb = Supressor de tumor prb inibe a função do E2F E2F permite a produção de proteínas para a replicação e assim o avanço no ciclo celular

72 E2F inativo E2F Ativo Se RB estiver mutado = E2F sempre ficará livre e ativo

73 Classe dos Supressores Tumorais Reguladores os Fatores de Transcrição Reguladores do Ciclo Celular Reguladores da Transdução de Sinal Receptores de Superfície Celular

74 REGULADORES DOS FATORES DE TRANSCRIÇÃO, DO CICLO CELULAR E DA TRANSDUÇÃO DE SINAL

75 As principais moléculas: Gene RB Gene p53 BRCA

76 prb E2F inativo E2F Ativo Se RB estiver mutado = E2F sempre ficará livre e ativo

77 prb fosforilada (ativa) Não inibe o fator de transcrição (E2F) Transcrição de proteínas para entrar na Fase S DNA polimerase, histonas...

78 Relações dos proto-oncogenes com os supressores tumorais p16, Ciclina D, CDK 4 e prb Ciclina D + CDK4 fosforilada prb prb fosforilada ativa E2F E2F induz expressão de genes de fase S p16 inibe(regula) CDK4 78

79 p53 Proteína Supressora Tumoral 50% dos tumores apresentam mutações nesse gene. Localizada no núcleo com tempo de vida curto (20 min). Controla a transcrição de vários genes. Diferentemente da prb, a p53 não regula o ciclo celular. p53 é produzida como um freio de emergência quando o DNA sofre uma lesão.

80 * Lesão não letal no DNA

81 p53 Lesão não letal no DNA * promotor GADD45 p21 mrna

82 p21 inibe CDKs/ciclina Interrupção do Ciclo celular - Não entra na fase S (não fosforila o prb) GADD45 induz Reparo do DNA 82

83

84 BRCA (Breast Cancer) Supressores Tumorais; Muito associados ao câncer de mama hereditário (familiar) BRCA-1 e 2 Atuam na estabilidade do DNA, recombinação e reparo

85 RECEPTORES DE SUPERFÍCIE

86 TGF-b (Fator de Crescimento Transformante beta) Inibidor de crescimento. TGF-b se liga à receptores e induz a produção de CDKI (inibidores de CDKs)

87 GENES APOPTÓTICOS

88 Mecanismo de morte : Via sinalizadora Via de Controle e integração Via de Execução comum Fagocitose das células mortas Agentes promotores

89 Família bcl-2 São proteínas com papéis na regulação apoptótica (inibição e promoção) por meio da regulação mitocondrial Proteínas bcl-2 (inibidora) bax (promotora) Câncer p53 ativa a bax e induz apoptose

90 GENES ESTABILIZADORES

91 GENES ESTABILIZADORES (ou caretaker ) Esta classe induz o reparo de mau pareamento, reparo de remoção nucleotídica e reparo de remoção de bases responsáveis pelo reparo delicado das trocas feitos durante a replicação normal ou pela exposição de mutageneses

92 Síndromes Humanas com Manutenção dos genomas defeituosos Síndrome Mecanismos Afetados Predisposição ao Câncer Xerodermia pigmentosum NER/TCR UV-induced skin cancer Cockayne syndrome NER None Trichothiodystrophy NER/TCR None Ataxia telangectasia DSB repair Lymphomas Nijmegen breakage syndrome DSB repair Lymphomas BRCA1/BRCA2 Homologous recombination Câncer de Mama Werner syndrome Homologous recombination Various cancers Bloom syndrome Homologous recombination Lymphomas HNPCC Mismatch repair Colorectal/ovarian

93 Sobreposição/Conexão de diferentes sistemas de reparo de DNA

94 REPARO DE DNA E CÂNCER Reparo por remoção MMR: Reparo de Mau Pareamento (Mismatch Repair) Atua na Mau Pareamento criada pelos erros de replicação (base-base, inserção, deleção) Ex.: MSH2 câncer de colorretal HNPCC BER: Reparo por excisão de base (Base Excision Repair) Atua sobre pequenos defeitos de bases, bases danificadas ou modificadas Ex: MYH e poliposis MAP NER: Reparo por excisão de nucleotídeo (Nucleotide Excision Repair) Atua sobre os dimeros de pirimidinas ou em lesões grandes Ex: genes XP em Xeroderma Pigmentosum REPARO de DSB : Reparo por quebra da dupla fita (Double Strand Break Repair (HR & NHEJ)) Atua nos danos da dupla hélice originados pela radiação, agentes externos ou erros de replicação Ex: BRCA1 e câncer de mama

95 Gatekeeper genes - Genes que regulam o crescimento e divisão celular - Genes supressores de tumor e proto-oncogenes - Mutações gênicas resultam na perda do controle do ciclo celular Caretaker genes - Genes que ajudam na manutenção da integridade do genoma - Enzimas reparadoras de DNA - Aumenta a probabilidade de um Gatekeeper gene torna-se mutado - Causa indireta do câncer

96 96

97 TELÔMERO E TELOMERASE

98 Perda das repetições telomêricas em humanos: um mecanismo supressor de tumor? Saída do ciclo celular, apoptose Senescência celular Comprimento dos Telômeros prediz o histórico de replicação e o potencial de células

99 Telomerase Enzima que adiciona novas repetições teloméricas a 3ʼ final de cromossomos linerares. Células anormais com câncer apresentam a telomerase ativa

100 Telomerase: Contem componente de RNA e Proteína TERT é um componente catalítico essencial da telomerase.

101 CROMOSSOMOS

102 Translocação entre o cromossomo 9 e 22 produz leucemia mielóide crônica

103 Cromossomo Philadelphia

104 Translocação t(12;9) Uma leucemia mielomonocítica crônica Todo o domínio citoplasmático do PGDF está fundido com um segmento do fator de transcrição ETS, o que ocasiona sua constante dimerização. 104

105 Translocação t(14;18)(q32;q21) Desloca o bcl-2 para a região de super e x p r e s s ã o p r ó x i m o a o s g e n e s d a imunoglobulina. bcl-2 é anti-apoptótico e impede com que os linfócitos, por exemplo, vivam por longos períodos e se acumulem. 105

106 Translocação 8q24 para genes da Ig Translocam o gene c-myc para a região de super expressão próximo aos genes da imunoglobulina. 106

107 Etapa 3: Progressão Instabilidade cariotípica taxas de crescimento invasividade resposta hormonal

108 MALIGNIDADE TUMORAL MOLECULAR Iniciação Promoção Progressão

109 109

110 NENHUM CÂNCER SE DÁ POR MUTAÇÃO DE UM GENE ISOLADO Necessidade de múltiplas alterações genéticas (proto-oncogenes e supressores tumorais) para desencadear o câncer.

111 111

112 MUTAÇÕES NECESSÁRIAS PARA UMA CÉLULA SE TORNAR CANCERÍGENA As mutações promovem uma: Redução na necessidade de estímulos de crescimento Redução para responder a estímulos anti-crescimento Redução no reparo de erros do DNA Habilidade de invasão (metaloproteases) Ilimitada habilidade de divisão (imortalidade) Habilidade para atrair vasos sanguíneos (angiogêneses) Inabilidade para morrer (apoptose)

113 Malignidade em 4 fases 1. Transformação (alteração maligna); 1. Etapas de iniciação e promoção 2. Crescimento da célula transformada; 3. Invasão local; 4. Metástases distantes. Etapas de Progressão à malignidade 113

114 Crescimento Tumoral Cinética do Crescimento Angiogênese tumoral progressão e heterogeneidade clonal do tumor 114

115 Cinética Tumoral 115

116 Angiogênese Os tumores não podem ultrapassar o diâmetro/espessura de 1 a 2 nm Absorver nutrientes e O2. Para aumentarem de tamanho precisam se tornar vascularizados. Angiogênese tumoral induzida. 116

117 Formação de novos Vasos Vasculogênese Angiogênese Novos vasos Embrião Adulto

118 Vasos derivados de células endotéliais precursoras (angioblastos) Angiogênese Downloaded from: Robbins & Cotran Pathologic Basis of Disease (on 14 May :59 AM) Vasos derivados de brotamento de um vaso pré-existente.

119 Angiogênese Degradação da Membrana Basal Migração Endotelial Proliferação Endotelial Maturação Endotelial Recrutamento de células periendotéliais (pericitos, músculos liso)

120

121 ANGIOGÊNESE VEGF: Produzido por células mesenquimatosas Receptor VEGFR-2:restrito às células endoteliais e precursoras Precursores endoteliais: Mobilização da MO,proliferação e diferenciação Vasos preexistentes: Proliferação e motilidade germinação de novos capilares

122 Heterogeneidade Clonal 122

123 INVASIVIDADE E METÁSTASE

124 Etapas da Invasão Local 124

125 Alterações celulares associadas com a malignidade LIGAÇÃO A LAMININA - Reconhecimento cél-cél alterado - Aumento de receptores de laminina DIGESTÃO DA LAMINA BASAL PELA COLAGENASE TIPO IV MOBILIDADE - Invasão de vasos sanguíneos - Saída para circulação - Crescimento descontrolado independente dos tipos celulares vizinhos - Evasão de sistema imune ( Proteínas CD44 OU MHC alteradas)

126 Metástase 126

127 Figure 7-42 The metastatic cascade. Schematic illustration of the sequential steps involved in the hema 127

128 Estágios do Câncer cervical-uterino Tumor benigno -Localizados no tecido o qual se originou (in situ) - Usualmente encapsulado in membranas fibrosas - Células permanecem bem diferenciada Tumor maligno - espalha-se por todo o corpo - Células perdem sua diferenciação - Freqüentemente apresentam números anormais de cromossomos - Ganho de função enzimática o que leva a invasividade e a 2º área de crescimento

129 129

130 O que é câncer? Definido como Iniciada por Progride por Células em divisão descontrolada Mutação do DNA Tumor primário;- Divisão das células mutadas no local de origem (i.e. in situ) Câncer invasivo- Invasão dos tecidos circundantes Metástase -via vasos sanguíneas e linfáticos para formar tumores secundários (linfonodos, baço, fígado, pulmão, ossos, cérebro) Pode matar por Drenar as fontes nutricionais Bloquear os órgãos vitais Hemorragia dos vasos sanguíneos Diminui a resistência à infecções

131 Obrigado Lucas Brandão

Departamento de Patologia! Patologia Molecular! CÂNCER. Lucas Brandão. www.lucasbrandao.org. professor@lucasbrandao.org

Departamento de Patologia! Patologia Molecular! CÂNCER. Lucas Brandão. www.lucasbrandao.org. professor@lucasbrandao.org Departamento de Patologia! Patologia Molecular! CÂNCER Lucas Brandão www.lucasbrandao.org professor@lucasbrandao.org O Câncer mata... É a segunda principal causa de morte no mundo. Perde apenas para doenças

Leia mais

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado.

CICLO CELULAR. Profª Ana Luisa Miranda Vilela. e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Profª Ana Luisa Miranda Vilela CICLO CELULAR e adultos aproximadamente 100 trilhões de células, todas derivadas do ovo fertilizado. Grande número de células se dividem continuamente, substituindo as que

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Morte Celular Programada (Apoptose)

Morte Celular Programada (Apoptose) UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR Morte Celular Programada (Apoptose) Profa. Dra. Nívea Macedo APOPTOSE A morte celular desempenha

Leia mais

a) A diversidade de anticorpos é derivada da recombinação das regiões, e.

a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Questão 1 Preencha as lacunas a) A diversidade de anticorpos é derivada da recombinação das regiões, e. Verdadeiro ou falso. Se falso, altere a declaração de modo a torná-la verdadeira. b) A exposição

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

Câncer. Claudia witzel

Câncer. Claudia witzel Câncer Claudia witzel Célula Tecido O que é câncer? Agente cancerígeno Órgão Célula cancerosa Tecido infiltrado Ozana de Campos 3 ESTÁGIOS de evolução da célula até chegar ao tumor 1 Célula 2 Tecido alterado

Leia mais

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular

Fundação Faculdade Federal de Ciências Médicas de Porto Alegre. Disciplina de Genética Humana. Curso de Medicina. Estudo Dirigido: Ciclo Celular Fundação Faculdade Federal de Ciências Médicas de Porto Alegre Disciplina de Genética Humana Curso de Medicina Estudo Dirigido: Ciclo Celular 1. Qual o papel de G0 no ciclo celular? Células ativas em divisão

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas. Rudolf Virchow, 1958

Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas. Rudolf Virchow, 1958 Onde surge uma célula, existia uma célula prévia, exatamente como os animais só surgem de animais e as plantas de plantas Rudolf Virchow, 1958 CICLO CELULAR A vida das células é formada por dois períodos:

Leia mais

Controle do Ciclo Celular

Controle do Ciclo Celular Ciclo Celular Células-filhas Seqüência de eventos controlados e coordenados Divisão celular Replicação cromossômica e crescimento celular Problemas Ciclo celular Câncer Segregação cromossômica 1 Ciclo

Leia mais

Denominação geral dos tumores

Denominação geral dos tumores Imunologia dos tumores Denominação geral dos tumores Carcinomas - derivados de células epiteliais (rim, fígado, epitélio gastro-intestinal) Sarcomas - originários de fibroblastos, células musculares e

Leia mais

BIOFÍSICA DAS RADIAÇÕES IONIZANTES

BIOFÍSICA DAS RADIAÇÕES IONIZANTES BIOFÍSICA DAS RADIAÇÕES IONIZANTES DANOS RADIOINDUZIDOS NA MOLÉCULA DE DNA Por ser responsável pela codificação da estrutura molecular de todas as enzimas da células, o DNA passa a ser a molécula chave

Leia mais

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores Introdução Objetivos Ags expressados pelas células cancerosas Natureza da resposta Imune Como o câncer escapa do sistema Imune Imunoterapia Introdução ao Câncer Crescimento descontrolado produz um tumor

Leia mais

Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física?

Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física? Fisiologia Humana QUESTÕES INICIAIS 1 2 3 Qual é o objeto de estudo da Fisiologia Humana? Por que a Fisiologia Humana é ensinada em um curso de licenciatura em Educação Física? Qual a importância dos conhecimentos

Leia mais

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Princípios de Oncologia Clínica Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Histórico 1900 Termo Quimioterapia Dr. Paul Ehrlich (1854-1915) Anos 40 Segunda Guerra Mundial Ilha de Bali 1943

Leia mais

PROVA DE BIOLOGIA. Observe o esquema, que representa o transporte de lipoproteína LDL para dentro da célula. Receptores de LDL.

PROVA DE BIOLOGIA. Observe o esquema, que representa o transporte de lipoproteína LDL para dentro da célula. Receptores de LDL. 11 PROVA DE BIOLOGIA Q U E S T Ã O 1 6 Observe o esquema, que representa o transporte de lipoproteína LDL para dentro da célula. Partícula de LDL (Lipoproteína de baixa densidade) Receptores de LDL Endossomo

Leia mais

Por outro lado, na avaliação citológica e tecidual, o câncer tem seis fases, conhecidas por fases biológicas do câncer, conforme se segue:

Por outro lado, na avaliação citológica e tecidual, o câncer tem seis fases, conhecidas por fases biológicas do câncer, conforme se segue: 8 - O câncer também tem fases de desenvolvimento? Sim, o câncer tem fases de desenvolvimento que podem ser avaliadas de diferentes formas. Na avaliação clínica feita por médicos é possível identificar

Leia mais

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP 42883

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP 42883 ENFERMAGEM EM ONCOLOGIA Renata Loretti Ribeiro Enfermeira COREn/SP 42883 Fisiopatologia do Processo Maligno As células são conhecidas desde o século XVII, quando foram observadas com microscópios muito

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

Alterações genéticas no processo de carcinogênese colo-retal. Programa de Pós-Graduação em Gatroenterologia Cirúrgica 2002

Alterações genéticas no processo de carcinogênese colo-retal. Programa de Pós-Graduação em Gatroenterologia Cirúrgica 2002 Alterações genéticas no processo de carcinogênese colo-retal Programa de Pós-Graduação em Gatroenterologia Cirúrgica 2002 FREQUENTES ALT. GENÉTICAS NA CARCINOGENESE DO CÓLON FREQUENTES ALT. GENÉTICAS NA

Leia mais

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE NISE HITOMI YAMAGUCHI ONCOLOGISTA E IMUNOLOGISTA UNIVERSIDADE DE SÃO PAULO MINISTÉRIO DA SAÚDE-ESTADO DE SÃO PAULO ENERGIA NUCLEAR DIAGNÓSTICO NA MEDICINA

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

Apoptose em Otorrinolaringologia

Apoptose em Otorrinolaringologia Apoptose em Otorrinolaringologia Teolinda Mendoza de Morales e Myrian Adriana Pérez García Definição A apoptose é um processo biológico existente em todas as células de nosso organismo, conhecida desde

Leia mais

ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA

ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA Laiz Silva Ribeiro laiz0711@bol.com.br Prof Dr. Rodrigo da Silva Santos rdssantos@gmail.com FACULDADE ALFREDO

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO

SERVIÇO PÚBLICO FEDERAL UNIVERSIDADE FEDERAL DE GOIÁS CÃMPUS JATAÍ PLANO DE ENSINO PLANO DE ENSINO I. IDENTIFICAÇÃO Unidade Acadêmica: Câmpus Jataí Curso:Biomedicina Disciplina:Biologia Celular Carga horária semestral:64 Teórica: 48 Prática: 16 Semestre/ano:1/2013 Turma/turno: 1 período/

Leia mais

BASES MACROMOLECULARES DA CONSTITUIÇÃO CELULAR

BASES MACROMOLECULARES DA CONSTITUIÇÃO CELULAR BASES MACROMOLECULARES DA CONSTITUIÇÃO CELULAR As moléculas que constituem as células são formadas pelos mesmos átomos encontrados nos seres inanimados. Todavia, na origem e evolução das células, alguns

Leia mais

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV UNIC Universidade de Cuiabá NEOPLASIAS CMF IV Aspectos Morfológicos das Neoplasias DEFINIÇÕES Neoplasia Tumor Câncer Inflamação/Neoplasia Termo comum a todos tumores malignos. Derivado do grego Karkinos

Leia mais

Agentes... Célula Normal. Causa... Divisão Celular. Célula Neoplásica. Divisão Celular. Físicos Químicos Biológicos. Fatores Reguladores.

Agentes... Célula Normal. Causa... Divisão Celular. Célula Neoplásica. Divisão Celular. Físicos Químicos Biológicos. Fatores Reguladores. Célula Normal Ciclo Celular G 0 /G 1 /S/G 2 /M Divisão Celular Neoplasias Fatores Reguladores Controlada Estimuladores Inibidores Homeostase Célula Neoplásica Divisão Celular Ciclo Celular G 0 /G 1 /S/G

Leia mais

CONTROLE E INTEGRAÇÂO

CONTROLE E INTEGRAÇÂO CONTROLE E INTEGRAÇÂO A homeostase é atingida através de uma série de mecanismos reguladores que envolve todos os órgãos do corpo. Dois sistemas, entretanto, são destinados exclusivamente para a regulação

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais

Auto-imunidade Doenças auto-imunes. Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia

Auto-imunidade Doenças auto-imunes. Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia Auto-imunidade Doenças auto-imunes Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia Célula tronco-hematopoiética Pluripotente. - Progenitor linfóide comum - Progenitor

Leia mais

FISIOLOGIA HUMANA III

FISIOLOGIA HUMANA III FISIOLOGIA HUMANA III UNIVERSIDADE VEIGA DE ALMEIDA PÓS-GRADUAÇÃO LATO SENSU EM FISIOLOGIA DO EXERCÍCIO Profª Drª Silvia Aparecida Pieta Interação dos sistemas nervoso e endócrino Os sistemas nervoso e

Leia mais

VÍRUS (complementar o estudo com as páginas 211-213 do livro texto)

VÍRUS (complementar o estudo com as páginas 211-213 do livro texto) COLÉGIO E CURSO INTELECTUS APOSTILA NOME: MAT.: Biologia I PROFº: EDUARDO SÉRIE: TURMA: DATA: VÍRUS (complementar o estudo com as páginas 211-213 do livro texto) Os vírus são os únicos organismos acelulares,

Leia mais

Fonoaudiologia Oncológica Introdução

Fonoaudiologia Oncológica Introdução Fonoaudiologia Oncológica Introdução M.Sc. Profª Viviane Marques Fonoaudióloga, Neurofisiologista e Mestre em Fonoaudiologia Coordenadora da Pós-graduação em Fonoaudiologia Hospitalar da UVA Chefe da Equipe

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

COMUNICAÇÃO CELULAR. Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto

COMUNICAÇÃO CELULAR. Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto COMUNICAÇÃO CELULAR Bioquímica Básica Ciências Biológicas 3º período Cátia Capeletto O que é comunicação celular? As células possuem um sistema responsável por: Geração Transmissão Recepção Resposta. Uma

Leia mais

22.05. O tipo básico de tecido epitelial é o de revestimento sendo os demais tecidos epiteliais (glandular e neuroepitélio) derivados desse.

22.05. O tipo básico de tecido epitelial é o de revestimento sendo os demais tecidos epiteliais (glandular e neuroepitélio) derivados desse. BIO 8E aula 22 22.01. O tecido epitelial de revestimento é pobre em substância intercelular e avascular. Existe também o tecido epitelial glandular que é derivado do tecido epitelial de revestimento. O

Leia mais

HPV e Câncer Cervical. Brunna L. Misael Alves Programa de Oncovirologia Departamento de Genética

HPV e Câncer Cervical. Brunna L. Misael Alves Programa de Oncovirologia Departamento de Genética HPV e Câncer Cervical Brunna L. Misael Alves Programa de Oncovirologia Departamento de Genética Epidemiologia da infecção pelo HPV no mundo 600 11,4% milhões das mulheres de pessoas com infectadas citologia

Leia mais

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015 UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES ONCOGÊNESE O QUE É O CÂNCER Câncer é o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado (maligno) de células

Leia mais

NEOPLASIAS. Prof. Dr. Fernando Ananias

NEOPLASIAS. Prof. Dr. Fernando Ananias NEOPLASIAS Prof. Dr. Fernando Ananias Neoplasia = princípio básico CLASSIFICAÇÃO DOS TUMORES Comportamento Benigno versus Maligno Crescimento lento rápido Semelhança com O tecido de origem (Diferenciação)

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Tipos de tumores cerebrais

Tipos de tumores cerebrais Tumores Cerebrais: entenda mais sobre os sintomas e tratamentos Os doutores Calil Darzé Neto e Rodrigo Adry explicam sobre os tipos de tumores cerebrais. CONTEÚDO HOMOLOGADO "Os tumores cerebrais, originados

Leia mais

Resposta Imune contra o Câncer

Resposta Imune contra o Câncer Câncer é um termo genérico, que compreende em torno de 200 doenças, cujas células causadoras partilham algumas características em comum: Mutações genéticas; Crescimento descontrolado; Capacidade de migração

Leia mais

UNIVERSIDADE COMUNITÁRIA DA REGIÃO DE CHAPECÓ ÁREA DE CIÊNCIAS DA SAÚDE CURSO DE FISIOTERAPIA CIÊNCIAS MORFOLÓGICAS II

UNIVERSIDADE COMUNITÁRIA DA REGIÃO DE CHAPECÓ ÁREA DE CIÊNCIAS DA SAÚDE CURSO DE FISIOTERAPIA CIÊNCIAS MORFOLÓGICAS II UNIVERSIDADE COMUNITÁRIA DA REGIÃO DE CHAPECÓ ÁREA DE CIÊNCIAS DA SAÚDE CURSO DE FISIOTERAPIA CIÊNCIAS MORFOLÓGICAS II Respiração Celular 1º estágio: GLICÓLISE 2º estágio: CK Ciclo de Krebs 3º estágio:

Leia mais

Visão Geral. Tecido conjuntivo líquido. Circula pelo sistema cardiovascular. Produzido na medula óssea, volume total de 5,5 a 6 litros (homem adulto)

Visão Geral. Tecido conjuntivo líquido. Circula pelo sistema cardiovascular. Produzido na medula óssea, volume total de 5,5 a 6 litros (homem adulto) Tecido Sanguíneo Visão Geral Tecido conjuntivo líquido Circula pelo sistema cardiovascular Produzido na medula óssea, volume total de 5,5 a 6 litros (homem adulto) Defesa imunológica (Leucócitos) Trocas

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Assunto: Organelas citoplasmáticas

Leia mais

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71)

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71) DELIBERAÇÃO Câmara de Pós-Graduação Nº 32/2012 Reestrutura o Programa de Pós-Graduação em Genética e Biologia Molecular, em nível de Mestrado e Doutorado. CONSIDERANDO a solicitação da Comissão Coordenadora

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Resposta imunológica a. Ronei Luciano Mamoni

Resposta imunológica a. Ronei Luciano Mamoni Resposta imunológica a tumores Ronei Luciano Mamoni Tumores Conceitos gerais Neoplasias conceito Neoplasia (neo= novo + plasia = tecido) é o termo que designa alterações celulares que acarretam um crescimento

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS 1 CARACTERÍSTICAS GERAIS DAS NEOPLASIAS 1) INTRODUÇÃO Neoplasia significa crescimento novo. O termo tumor é usado como sinônimo e foi originalmente usado para os aumentos de volume causados pela inflamação.

Leia mais

Mutações e Polimorfismos gênicos

Mutações e Polimorfismos gênicos DEFINIÇÃO Mutações e Polimorfismos gênicos Profª. MSc. Priscila P. S. dos Santos psantos@catolica-es.edu.br O termo mutação refere-se tanto: (1) a mudança no material genético; (2) ao processo pelo qual

Leia mais

É por isso que um exame clínico anual das mamas, através de um médico, é obrigatório.

É por isso que um exame clínico anual das mamas, através de um médico, é obrigatório. OUTUBRO ROSA 25 de outubro Mais detalhes sobre o câncer de mama no Brasil 1. Exames clínicos de mama são tão importantes quanto as mamografias. Mamografias a partir de 40 anos de idade são cruciais (Deve

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

Com Ciência - Células-tronco: a promessa da medicina regenerativa

Com Ciência - Células-tronco: a promessa da medicina regenerativa Página 1 de 5 Editorial A esperança celular Carlos Vogt Reportagens Pesquisa brasileira em CT já apresenta resultados Em meio à discussão ética, a pesquisa avança em todo o mundo Faltam leis, sobra polêmica

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

PROVA ESPECÍFICA DE BIOLOGIA M23-2015

PROVA ESPECÍFICA DE BIOLOGIA M23-2015 PROVA ESPECÍFICA DE BIOLOGIA M23-2015 Nome: Data: / / Curso pretendido: ASSINALAR A RESPOSTA CORRETA NA FOLHA DE RESPOSTA 1. Os centríolos exercem importantes funções no processo de: a) Transporte intracelular.

Leia mais

Esses vírus foram reconhecidos como causas de cânceres humanos, especialmente de câncer de cérvice-uterina.

Esses vírus foram reconhecidos como causas de cânceres humanos, especialmente de câncer de cérvice-uterina. Segunda-feira, 4 de dezembro de 2006. Profa. Sônia. HPVs Papillomavirus humanos Esses vírus foram reconhecidos como causas de cânceres humanos, especialmente de câncer de cérvice-uterina. Introdução Anualmente

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

TUMOR-BUSTING. Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro.

TUMOR-BUSTING. Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro. TUMOR-BUSTING Uma nova técnica chamada viroterapia, cultiva vírus para combater o cancro. VÍRUS Isolar nas terapias Células tumorais Evitar danos Células normais Eliminar muitos efeitos colaterais nocivos

Leia mais

COMO SURGEM OS TECIDOS

COMO SURGEM OS TECIDOS TECIDO EPITELIAL COMO SURGEM OS TECIDOS Nos seres de reprodução sexuada, que constituem a maioria dos organismos, todas as células surgem a partir de uma única célula, a célula-ovo. Esta sofre divisões

Leia mais

PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA. Nome:

PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA. Nome: PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA 13/06/2011 Nome: 1. Classifique as afirmações seguintes como verdadeira (V) ou falsa (F): a) A espermatogénese é um processo contínuo, com inicio

Leia mais

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço A P R E S E N T A D O R : S E L I N A L D O A M O R I M R E S I D E N T E D E C I R U R G I A D E C A B E Ç A E P E S

Leia mais

BIOLOGIA TUMORAL E CARCINOGÊNESE

BIOLOGIA TUMORAL E CARCINOGÊNESE 6 BIOLOGIA TUMORAL E CARCINOGÊNESE INTRODUÇÃO A história natural da maioria dos tumores malignos pode ser dividida em 4 fases: (1) transformação maligna, (2) crescimento da célula transformada, (3) invasão

Leia mais

Texto de apoio ao curso de Especialização Atividade física Adaptada e saúde Prof. Dr. Luzimar Teixeira

Texto de apoio ao curso de Especialização Atividade física Adaptada e saúde Prof. Dr. Luzimar Teixeira Componentes do sistema imunitário Texto de apoio ao curso de Especialização Atividade física Adaptada e saúde Prof. Dr. Luzimar Teixeira Manual Merck Capítulo 167 O sistema imunitário é composto por células

Leia mais

Atividade de Biologia 1 série

Atividade de Biologia 1 série Atividade de Biologia 1 série Nome: 1. (Fuvest 2013) Louis Pasteur realizou experimentos pioneiros em Microbiologia. Para tornar estéril um meio de cultura, o qual poderia estar contaminado com agentes

Leia mais

Doenças degenerativas lisossômicas

Doenças degenerativas lisossômicas Doenças degenerativas lisossômicas 2013 Catabolismo - é a quebra de moléculas. Anabolismo - é processo de formação dessas macromoléculas. -As doenças lisossômicas são incluídas no grupo das doenças degenerativas;

Leia mais

Cláudio Góes. Interfase e Controle da Divisão Celular

Cláudio Góes. Interfase e Controle da Divisão Celular A mitose é um mecanismo de divisão nuclear que funciona na maioria dos tipos de células. Ela separa o material genético nos dois novos núcleos e assegura que ambos venham a possuir exatamente a mesma informação

Leia mais

Câncer Colorretal Hereditário

Câncer Colorretal Hereditário Câncer Colorretal Hereditário Critérios Diagnósticos João Gomes Netinho jgnetinho@riopreto.com.br Câncer Colorretal Incidência no mundo - 3ª causa mais comum em ambos os sexos - 2ª nos paises desenvolvidos

Leia mais

CITOLOGIA ONCÓTICA CÂNCER

CITOLOGIA ONCÓTICA CÂNCER CITOLOGIA ONCÓTICA Neoplasia: crescimento desordenado de células, originando um tumor (massa de células) Tumor benigno: massa localizada de células que se multiplicam vagarosamente e se assemelham ao seu

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

Profº André Montillo www.montillo.com.br

Profº André Montillo www.montillo.com.br Profº André Montillo www.montillo.com.br Definição: É a soma de todas as reações químicas envolvidas na manutenção do estado dinâmico das células, onde milhares de reações ocorrem ao mesmo tempo, determinando

Leia mais

Parte III: Manipulação da informação

Parte III: Manipulação da informação Parte III: Manipulação da informação Novos alvos terapêuticos É possível fazer uma classificação molecular dos tumores e correlacionar com prognóstico. E agora? Leucémias agudas : LMA (L. Mieloblástica

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA

COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA AUDIÇÃO de 26 de Abril de 2001 Carlos Alonso BEDATE Curriculum académico Licenciado em Filosofia Universidade

Leia mais

Mecanismos de reparo de DNA

Mecanismos de reparo de DNA Mecanismos de reparo de DNA Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanes de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia, Maio 2014 RESUMO Introdução:

Leia mais

Genética do câncer Aline Rodrigues Amorim

Genética do câncer Aline Rodrigues Amorim Centro Universitário de Brasília Faculdade de Ciências da Saúde Genética do câncer Aline Rodrigues Amorim Brasília 2002 Centro Universitário de Brasília Faculdade de Ciências da Saúde Licenciatura em Ciências

Leia mais

VIRUS O QUE SÃO VIRUS São as menores entidades biológicas: têm DNA e proteínas. Medem entre 15 e 300 nm. São seres acelulares: São parasitas intracelulares obrigatórios: Só se reproduzem dentro de células.

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Moléculas de Adesão, Junção Celular e Matrix Extracelular (Aula 3)

Moléculas de Adesão, Junção Celular e Matrix Extracelular (Aula 3) UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE GENÉTICA E BIOLOGIA MOLECULAR Moléculas de Adesão, Junção Celular e Matrix Extracelular (Aula 3) Profa. Dra. Nívea Macedo

Leia mais

O processo contrátil do músculo liso: A base química da contrcao do músculo liso:

O processo contrátil do músculo liso: A base química da contrcao do músculo liso: O musculo liso e sua contracao: O músculo liso e composto por fibras muito menores, contrastando com as fibras musculares esqueléticas. Muitos dos princípios da contração se aplicam, da mesma forma que

Leia mais

BIOLOGIA CELULAR Células Procariontes Eucariontes (animal e vegetal)

BIOLOGIA CELULAR Células Procariontes Eucariontes (animal e vegetal) BIOLOGIA CELULAR Células Procariontes Eucariontes (animal e vegetal) Thiago Campos Monteiro UFMS / CPCS Créditos: Prof a Elisângela de Souza Loureiro Tamanho das células Existem células de vários tamanhos.

Leia mais

GRUPO 2 1) Calor, rubor, tumor e dor são os sinais cardinais clássicos da inflamação aguda. Qual o quinto sinal? Escolha a afirmação correta: a)

GRUPO 2 1) Calor, rubor, tumor e dor são os sinais cardinais clássicos da inflamação aguda. Qual o quinto sinal? Escolha a afirmação correta: a) GRUPO 2 1) Calor, rubor, tumor e dor são os sinais cardinais clássicos da inflamação aguda. Qual o quinto sinal? Escolha a afirmação correta: a) Diminuição de tamanho b) Perda de estrutura c) Perda de

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

CIENCIAS MOLECULARES E CELULARES

CIENCIAS MOLECULARES E CELULARES CIENCIAS MOLECULARES E CELULARES Profa. Ms Solange A O Neves Curso: Enfermagem 1 Apresentação do docente Professora Ms Solange Aparecida de Oliveira Neves 2 Curso: Enfermagem Disciplina: Ciências Moleculares

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA -> mutação -> doença Mutação em regiões controladoras e codificantes Mecanismos de Reparo Fita simples

Leia mais

Citopatologia mamária. Histologia da mama feminina

Citopatologia mamária. Histologia da mama feminina Citopatologia mamária Puberdade: crescimento das mamas em função do desenvolvimento glandular e da deposição aumentada de tecido adiposo. Mulheres durante o ciclo menstrual: aumento do volume mamário em

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

SISTEMA REPRODUTOR. Sistema reprodutor feminino

SISTEMA REPRODUTOR. Sistema reprodutor feminino SISTEMA REPRODUTOR A reprodução é de importância tremenda para os seres vivos, pois é por meio dela que os organismos transmitem suas características hereditariamente e garantem a sobrevivência de suas

Leia mais

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Características principais Agente etiológico das verrugas (tumores epiteliais benignos) Infectam epitélio de

Leia mais