Resposta Imune contra o Câncer

Tamanho: px
Começar a partir da página:

Download "Resposta Imune contra o Câncer"

Transcrição

1 Câncer é um termo genérico, que compreende em torno de 200 doenças, cujas células causadoras partilham algumas características em comum: Mutações genéticas; Crescimento descontrolado; Capacidade de migração e invasão de outros locais.

2 Neoplasias

3 Os tipos de câncer malignos são: Tumores sólidos: Sarcomas: cânceres de tecidos mesodèrmicos (tecidos moles, osso, vasos sanguíneos, etc). Carcinomas: cânceres de tecidos epiteliais. Tumores Hematológicos: Leucemias: câncer hematológico com origem na medula óssea. Linfomas: câncer associado a malignização de linfócitos T ou B (Hodgkin /não-hodgkin Inflamatório/tolerogênico). Mielomas: câncer associado a malignização de plasmócitos (gamopatia monoclonal).

4 Carcinogênese Proto Oncogenes X Genes Supressores de Tumor MUTAÇÕES Proto Oncogenes Oncogenes Genes Supressores de Tumor Estes genes regulam os processos celulares que levam a malignização. Normalmente, são necessários eventos mutacionais múltiplos. Ciclo celular (proliferação); Angiogênese; Morte celular (apoptose); Expressão de proteases; Reparo do material genético; Diferenciação celular.

5 Células cancerígenas são células do nosso corpo que, por eventos mutacionais, tem seu fenótipo transformado. Como o sistema imune consegue reconhecer e atacar células do nosso próprio corpo?

6 Antígenos de rejeição ao tumor: Antígenos tumor-específicos; Antígenos da linhagem germinativa; Antígenos tecido-específicos; Antígenos superexpressos; Antígenos modificados pós-transcripcionalmente; Antígenos de vírus oncogênicos.

7 Antígenos tumor-específicos BCR/Abl Leucemia Mielóide Crônica Nat Rev Cancer. 2005;5(3):

8 Antígenos tumor-específicos

9 Antígenos da linhagem germinativa

10 Antígenos superexpressos Nature Reviews Cancer 1, 34-45

11 Antígenos superexpressos

12 Antígenos de diferenciação Melanomas carcinomas de células nãodiferenciadas capazes de produzir melanina. Wnt/b-catenina são os oncogenes que participam do processo de tumorigênese

13 Antígenos modificados pós-transcripcionalmente Mucina I hipoglicosilada cânceres de pancreas, pulmão, mama, etc The Oncologist 10:1034

14 Antígenos de vírus oncogênicos

15 Evasão da resposta Imunológica Evasão do reconhecimento antigênico Evasão da resposta efetora

16 Evasão do reconhecimento antigênico Localização tecidual sítios de imunoprevilégio

17 Evasão do reconhecimento antigênico Localização tecidual sítios de imunoprevilégio Linfonodos drenantes do sítio tumoral têm sua estrutura alterada Células apresentadoras tolerogênicas Acúmulo de linfócitos T reguladores Inibição de respostas citotóxicas mediadas por anticorpos

18 Evasão do reconhecimento antigênico Secreção de antígenos imunogênicos Altas concentrações de antígenos tumorais circulantes podem atingir o timo, levando a deleção de clones capazes de reconhecêlos. Este processo pode levar a tolerância contra estes antígenos Nature Reviews Immunology 6,

19 Evasão do reconhecimento antigênico Mutações em antígenos imunogênicos

20 Evasão da resposta efetora Clinical and Developmental Immunology Volume 2010 (2010), Article ID ,

Denominação geral dos tumores

Denominação geral dos tumores Imunologia dos tumores Denominação geral dos tumores Carcinomas - derivados de células epiteliais (rim, fígado, epitélio gastro-intestinal) Sarcomas - originários de fibroblastos, células musculares e

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores

Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores. Imunologia dos tumores Introdução Objetivos Ags expressados pelas células cancerosas Natureza da resposta Imune Como o câncer escapa do sistema Imune Imunoterapia Introdução ao Câncer Crescimento descontrolado produz um tumor

Leia mais

Sumário. Agradecimentos... 5. Prefácio... 7. Apresentação... 9. Introdução... 19

Sumário. Agradecimentos... 5. Prefácio... 7. Apresentação... 9. Introdução... 19 Sumário Agradecimentos............................ 5 Prefácio............................... 7 Apresentação............................. 9 Introdução............................. 19 Incidência...............................................................

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

4 - A radiação Ultra Violeta pode produzir efeitos lesivos para a célula e esta melhor representado pela alternativa:

4 - A radiação Ultra Violeta pode produzir efeitos lesivos para a célula e esta melhor representado pela alternativa: 1 - A respeito da inflamação crônica, analise as assertivas a seguir: I) A inflamação crônica sempre tem início após a inflamação aguda. II) A inflamação crônica inespecífica é observada em resposta à

Leia mais

3º PROVA PATOLOGIA GERAL

3º PROVA PATOLOGIA GERAL 1 - A imunoterapia tem sido usado no tratamento de tumores e em alguns casos com sucesso significativo, meios de imunização ativo e passivo foram empregados para estimular o sistema imune. A melhor resposta

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Agentes... Célula Normal. Causa... Divisão Celular. Célula Neoplásica. Divisão Celular. Físicos Químicos Biológicos. Fatores Reguladores.

Agentes... Célula Normal. Causa... Divisão Celular. Célula Neoplásica. Divisão Celular. Físicos Químicos Biológicos. Fatores Reguladores. Célula Normal Ciclo Celular G 0 /G 1 /S/G 2 /M Divisão Celular Neoplasias Fatores Reguladores Controlada Estimuladores Inibidores Homeostase Célula Neoplásica Divisão Celular Ciclo Celular G 0 /G 1 /S/G

Leia mais

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015

ONCOGÊNESE UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES O QUE É O CÂNCER PROCESSO FISIOPATOLÓGICO 16/08/2015 UNESC FACULDADES ENFERMAGEM ONCOLOGIA PROFª FLÁVIA NUNES ONCOGÊNESE O QUE É O CÂNCER Câncer é o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado (maligno) de células

Leia mais

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP 42883

ENFERMAGEM EM ONCOLOGIA. Renata Loretti Ribeiro Enfermeira COREn/SP 42883 ENFERMAGEM EM ONCOLOGIA Renata Loretti Ribeiro Enfermeira COREn/SP 42883 Fisiopatologia do Processo Maligno As células são conhecidas desde o século XVII, quando foram observadas com microscópios muito

Leia mais

NEOPLASIAS. MSc. Isabela Brcko

NEOPLASIAS. MSc. Isabela Brcko NEOPLASIAS MSc. Isabela Brcko Proliferações locais de clones celulares cuja reprodução foge ao controle normal, e que tendem para um tipo de crescimento autônomo e progressivo, e para a perda de diferenciação

Leia mais

NEOPLASIAS DE ORIGEM MESENQUIMAL E NOMENCLATURA DAS NEOPLASIAS

NEOPLASIAS DE ORIGEM MESENQUIMAL E NOMENCLATURA DAS NEOPLASIAS NEOPLASIAS DE ORIGEM MESENQUIMAL E NOMENCLATURA DAS NEOPLASIAS Curso: Graduação em Odontologia 4 º e 5 º Períodos Disciplina: Patologia Oral http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira

Leia mais

Câncer. Claudia witzel

Câncer. Claudia witzel Câncer Claudia witzel Célula Tecido O que é câncer? Agente cancerígeno Órgão Célula cancerosa Tecido infiltrado Ozana de Campos 3 ESTÁGIOS de evolução da célula até chegar ao tumor 1 Célula 2 Tecido alterado

Leia mais

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV

UNIC Universidade de Cuiabá NEOPLASIAS CMF IV UNIC Universidade de Cuiabá NEOPLASIAS CMF IV Aspectos Morfológicos das Neoplasias DEFINIÇÕES Neoplasia Tumor Câncer Inflamação/Neoplasia Termo comum a todos tumores malignos. Derivado do grego Karkinos

Leia mais

Patologia geral. Neoplasias - quarta. Alunos 4º semestre. Prof. Jane Maria Ulbrich. Prof. Adjunta do Departamento de Patologia Famed/Ufrgs

Patologia geral. Neoplasias - quarta. Alunos 4º semestre. Prof. Jane Maria Ulbrich. Prof. Adjunta do Departamento de Patologia Famed/Ufrgs Patologia geral Neoplasias - quarta Alunos 4º semestre Prof. Jane Maria Ulbrich Prof. Adjunta do Departamento de Patologia Famed/Ufrgs Material utilizado em sala de aula com alunos Neoplasia Neoplasia:

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo?

Fundamentos de oncologia. Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? BIOLOGIA Cláudio Góes Fundamentos de oncologia 1. Introdução Você sabe o que é o câncer e como ele se desenvolve em nosso corpo? Nesta unidade, você verá que o termo câncer refere-se a uma variedade de

Leia mais

Linfomas. Claudia witzel

Linfomas. Claudia witzel Linfomas Claudia witzel Pode ser definido como um grupo de diversas doenças neoplásicas : Do sistema linfático Sistema linfóide Que tem origem da proliferação de linfócitos B ou T em qualquer um de seus

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

BIOLOGIA CELULAR E MOLECULAR DO CÂNCER

BIOLOGIA CELULAR E MOLECULAR DO CÂNCER 40 CONGRESSO BRASILEIRO DE ANÁLISES CLÍNICAS FLORIANÓPOLIS, 16 DE JUNHO DE 2013 (11:00 11:45H) BIOLOGIA CELULAR E MOLECULAR DO CÂNCER PROF.DR. PAULO CESAR NAOUM ACADEMIA DE CIÊNCIA E TECNOLOGIA DE SÀO

Leia mais

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS 1 CARACTERÍSTICAS GERAIS DAS NEOPLASIAS 1) INTRODUÇÃO Neoplasia significa crescimento novo. O termo tumor é usado como sinônimo e foi originalmente usado para os aumentos de volume causados pela inflamação.

Leia mais

IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES

IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES IMUNIDADE AOS TUMORES IMUNIDADE AOS TRANSPLANTES IMUNIDADE AOS TUMORES Neoplasias Histórico Classificação : linhagem celular, histomorfologia e comportamento clínicobiológico. Carcinogênese experimental

Leia mais

INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida

INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida DEFINIÇÃO: Pathos: doença Logos: estudo Estudo das alterações estruturais, bioquímicas e funcionais nas células, tecidos e órgãos visando explicar os mecanismos

Leia mais

Apudoma TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO. PROCED. DESCRIÇÃO QT CID At. Prof. Vr. TOTAL

Apudoma TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO. PROCED. DESCRIÇÃO QT CID At. Prof. Vr. TOTAL TABELAS DE PROCEDIMENTOS POR NEOPLASIA E LOCALIZAÇÃO Apudoma 0304020117 Quimioterapia paliativa de apudoma (doença loco-regional avançada, inoperável, metastática ou recidivada; alteração da função hepática;

Leia mais

1.Introdução Educação e Atualização em Cancerologia)

1.Introdução Educação e Atualização em Cancerologia) 1 SILVA, M.B..; FONSECA, C.A.; RODRIGUES, A.J.L.; Terapia medicamentosa do câncer. In III SEMINÁRIO DE INICIAÇÃO CIENTÍFICA E I JORNADA DE PESQUISA E PÓS-GRADUAÇÃO DA UEG. 2005, Anápolis. Anápolis: UEG,

Leia mais

NEOPLASIAS DE ORIGEM MESENQUIMAL

NEOPLASIAS DE ORIGEM MESENQUIMAL NEOPLASIAS DE ORIGEM MESENQUIMAL Curso: Odontologia 4 º e 5 º Períodos Disciplina: Patologia Oral http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 NEOPLASIAS NOMENCLATURA - O critério

Leia mais

Assunto: Atendimento a pacientes corn Neoplastia Maligna pelo SUS.

Assunto: Atendimento a pacientes corn Neoplastia Maligna pelo SUS. ESTADO OE SAO PAULO - BRASIL Prefeitura Municipal de Limeira Gabinete do Prefeito A / C"tAh S LA DASASS 0EaJlt/ Limeira, 16 de outubro de 2014. OF. CM. n 2718/2014 A Sua Excelencia o Senhor RONEI COSTA

Leia mais

COMENTÁRIOS SOBRE A CLASSIFICAÇÃO INTERNACIONAL DE DOENÇAS PARA ONCOLOGIA SEGUNDA EDIÇÃO (CID-O/2)

COMENTÁRIOS SOBRE A CLASSIFICAÇÃO INTERNACIONAL DE DOENÇAS PARA ONCOLOGIA SEGUNDA EDIÇÃO (CID-O/2) Anexo COMENTÁRIOS SOBRE A CLASSIFICAÇÃO INTERNACIONAL DE DOENÇAS PARA ONCOLOGIA SEGUNDA EDIÇÃO (CID-O/2) Os Registros Hospitalares de Câncer utilizam para codificar os tumores (topografia e histologia),

Leia mais

Instituições de Solidariedade Social

Instituições de Solidariedade Social Instituições de Solidariedade Social Trabalho realizado por: Alexandre d Eça, nº1 Ana Margarida Oliveira, nº3 João André Fortunato, nº14 Margarida Milheiro, nº18 9ºC Introdução O tema deste trabalho é

Leia mais

INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER

INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER INTERFACES MOLECULARES, CELULARES E TERAPÊUTICAS DO CÂNCER PROF.DR. PAULO CESAR NAOUM ACADEMIA DE CIÊNCIA E TECNOLOGIA DE SÀO JOSÉ DO RIO PRETO,SP REVISÃO ATÉ 2013 *TODOS OS TIPOS DE CÂNCER TÊM ORIGEM

Leia mais

Imunologia do câncer. Aarestrup, F.M.

Imunologia do câncer. Aarestrup, F.M. Imunologia do câncer Impacto da imunologia na cancerologia Biologia tumoral Diagnóstico : imuno-histoquímica Tratamento : imunoterapia Mecanismos da resposta imunológica contra o câncer Quais as células

Leia mais

IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013

IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013 IMUNOLOGIA DO CÂNCER Prof. Dr. Paulo Cesar Naoum Academia de Ciência e Tecnologia de São José do Rio Preto, SP Atualizado até 2013 Gênese do câncer A célula cancerosa é originada de uma célula normal que

Leia mais

NEOPLASIAS. Prof. Dr. Fernando Ananias

NEOPLASIAS. Prof. Dr. Fernando Ananias NEOPLASIAS Prof. Dr. Fernando Ananias Neoplasia = princípio básico CLASSIFICAÇÃO DOS TUMORES Comportamento Benigno versus Maligno Crescimento lento rápido Semelhança com O tecido de origem (Diferenciação)

Leia mais

Marcadores tumorais. Carla Almeida Setembro 2010

Marcadores tumorais. Carla Almeida Setembro 2010 Marcadores tumorais Carla Almeida Setembro 2010 Marcadores tumorais Marcadores tumorais Marcadores Tumorais são substâncias que podem ser encontradas em quantidades acima do normal no sangue, urina ou

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

Difusão por Ressonância Magnética

Difusão por Ressonância Magnética Difusão por Ressonância Magnética A difusão é definida basicamente como o movimento aleatório pelo qual as moléculas de um soluto migram em direção a um gradiente mais baixo de concentração da solução.

Leia mais

BIOLOGIA TUMORAL E CARCINOGÊNESE

BIOLOGIA TUMORAL E CARCINOGÊNESE 6 BIOLOGIA TUMORAL E CARCINOGÊNESE INTRODUÇÃO A história natural da maioria dos tumores malignos pode ser dividida em 4 fases: (1) transformação maligna, (2) crescimento da célula transformada, (3) invasão

Leia mais

5.º Ano 2014 Campanha de Prevenção do Câncer de Intestino Grosso 2016 O que é o intestino grosso? 1,5 m de comprimento 6,5 cm de diâmetro COLON SIGMÓIDE CECO ÂNUS Câncer de Intestino Grosso Surge, em 90%

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861

Princípios de Oncologia Clínica. Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Princípios de Oncologia Clínica Dr. Wesley Vargas Moura Oncologista Clínico CRM ES 3861 Histórico 1900 Termo Quimioterapia Dr. Paul Ehrlich (1854-1915) Anos 40 Segunda Guerra Mundial Ilha de Bali 1943

Leia mais

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS

CARACTERÍSTICAS GERAIS DAS NEOPLASIAS CARACTERÍSTICAS GERAIS DAS NEOPLASIAS 1) INTRODUÇÃO Neoplasia significa crescimento novo. O termo tumor é usado como sinônimo e foi originalmente usado para os aumentos de volume causados pela inflamação.

Leia mais

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE

A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE A ENERGIA NUCLEAR E OS SEUS BENEFÍCIOS PARA A SAÚDE NISE HITOMI YAMAGUCHI ONCOLOGISTA E IMUNOLOGISTA UNIVERSIDADE DE SÃO PAULO MINISTÉRIO DA SAÚDE-ESTADO DE SÃO PAULO ENERGIA NUCLEAR DIAGNÓSTICO NA MEDICINA

Leia mais

Componente Curricular: Patologia e Profilaxia Módulo I Profª Mônica I. Wingert Turma 101E TUMORES

Componente Curricular: Patologia e Profilaxia Módulo I Profª Mônica I. Wingert Turma 101E TUMORES TUMORES Tumores, também chamados de neoplasmas, ou neoplasias, são alterações celulares que provocam o aumento anormal dos tecidos corporais envolvidos. BENIGNO: são considerados benignos quando são bem

Leia mais

Resposta imunológica a. Ronei Luciano Mamoni

Resposta imunológica a. Ronei Luciano Mamoni Resposta imunológica a tumores Ronei Luciano Mamoni Tumores Conceitos gerais Neoplasias conceito Neoplasia (neo= novo + plasia = tecido) é o termo que designa alterações celulares que acarretam um crescimento

Leia mais

NEOPLASIAS. Augusto Schneider Carlos Castilho de Barros. Faculdade de Nutrição Universidade Federal de Pelotas

NEOPLASIAS. Augusto Schneider Carlos Castilho de Barros. Faculdade de Nutrição Universidade Federal de Pelotas NEOPLASIAS Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas INTRODUÇÃO Multiplicação celular ocorre constantemente Indispensável para repor células que

Leia mais

Câncer e Sistema Imune

Câncer e Sistema Imune Câncer e Sistema Imune Causas de morte no ocidente Doenças cardiovasculares Câncer Tumores (neoplasias) Tumores benignos: incapazes de crescer indefinidamente, não invadem tecidos vizinhos saudáveis Tumores

Leia mais

DIVISÃO ONCOLOGIA. ONCO - HEMATOLOGIA EXAME PRAZO MÉTODO FISH Rearranjo BCR ABL (Translocação: 9;22) 10 d. u. FISH

DIVISÃO ONCOLOGIA. ONCO - HEMATOLOGIA EXAME PRAZO MÉTODO FISH Rearranjo BCR ABL (Translocação: 9;22) 10 d. u. FISH DIVISÃO ONCOLOGIA ONCO - HEMATOLOGIA FISH Rearranjo BCR ABL (Translocação: 9;22) 10 d. u. FISH PCR Rearranjo BCR ABL (Translocação: 9;22 ) 11 d. u. PCR FISH Rearranjo PML RARA (Translocação: 15;17) 12

Leia mais

MARCADORES TUMORAIS. AUTOR: PROF. DR. PAULO CESAR NAOUM Academia de Ciência e Tecnologia de São José do Rio Preto, SP, Brasil 2014

MARCADORES TUMORAIS. AUTOR: PROF. DR. PAULO CESAR NAOUM Academia de Ciência e Tecnologia de São José do Rio Preto, SP, Brasil 2014 MARCADORES TUMORAIS AUTOR: PROF. DR. PAULO CESAR NAOUM Academia de Ciência e Tecnologia de São José do Rio Preto, SP, Brasil 2014 O QUE SÃO MARCADORES TUMORAIS(MT) SÃO SUBSTÂNCIAS PRODUZIDAS POR TECIDOS

Leia mais

PATOLOGIA DA MAMA. Ana Cristina Araújo Lemos

PATOLOGIA DA MAMA. Ana Cristina Araújo Lemos PATOLOGIA DA MAMA Ana Cristina Araújo Lemos Freqüência das alterações mamárias em material de biópsia Alteração fibrocística 40% Normal 30% Alterações benignas diversas 13% Câncer 10% Fibroadenoma

Leia mais

PATOLOGIA DO SISTEMA HEMATOPOIÉTICO

PATOLOGIA DO SISTEMA HEMATOPOIÉTICO PATOLOGIA DO SISTEMA HEMATOPOIÉTICO Rafael Fighera Laboratório de Patologia Veterinária Hospital Veterinário Universitário Universidade Federal de Santa Maria INTRODUÇÃO AOS TUMORES HEMATOPOIÉTICOS Rafael

Leia mais

Imunologia dos Tumores. Bruna Queiroz Pinto Claudio Saverio Ribeiro Geovana Vasconcelos Leão Maria Cecília Zonetti Bottaro Mariana Maseiro Porto

Imunologia dos Tumores. Bruna Queiroz Pinto Claudio Saverio Ribeiro Geovana Vasconcelos Leão Maria Cecília Zonetti Bottaro Mariana Maseiro Porto Imunologia dos Tumores Bruna Queiroz Pinto Claudio Saverio Ribeiro Geovana Vasconcelos Leão Maria Cecília Zonetti Bottaro Mariana Maseiro Porto O que é um tumor? Células quando expostas a produtos químicos,

Leia mais

Com Ciência - Células-tronco: a promessa da medicina regenerativa

Com Ciência - Células-tronco: a promessa da medicina regenerativa Página 1 de 5 Editorial A esperança celular Carlos Vogt Reportagens Pesquisa brasileira em CT já apresenta resultados Em meio à discussão ética, a pesquisa avança em todo o mundo Faltam leis, sobra polêmica

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA

ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA ALTERAÇÕES CROMOSSÔMICAS, PROGNÓSTICO E DIRETRIZES TERAPÊUTICAS NA LEUCEMIA MIELÓIDE CRÔNICA Laiz Silva Ribeiro laiz0711@bol.com.br Prof Dr. Rodrigo da Silva Santos rdssantos@gmail.com FACULDADE ALFREDO

Leia mais

PROPRIEDADES E VISÃO GERAL DAS RESPOSTAS IMUNES. FARMÁCIA PROFa SIMONE PETRI AULA - 1

PROPRIEDADES E VISÃO GERAL DAS RESPOSTAS IMUNES. FARMÁCIA PROFa SIMONE PETRI AULA - 1 PROPRIEDADES E VISÃO GERAL DAS RESPOSTAS IMUNES FARMÁCIA PROFa SIMONE PETRI AULA - 1 INTRODUÇÃO A função fisiológica do sistema imune é a defesa contra micro-organismos infecciosos. Entretanto, mesmo

Leia mais

COAGULOPATIAS NO PACIENTE ONCOLÓGICO. Dra Carmen Helena Vasconcellos Hospital Veterinário Botafogo - RJ

COAGULOPATIAS NO PACIENTE ONCOLÓGICO. Dra Carmen Helena Vasconcellos Hospital Veterinário Botafogo - RJ COAGULOPATIAS NO PACIENTE ONCOLÓGICO Dra Carmen Helena Vasconcellos Hospital Veterinário Botafogo - RJ HEMOSTASIA Conjunto de mecanismos que visa manter a fluidez do sangue no interior dos vasos no sistema

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais

Câncer no Brasil - Dados dos Registros de Base Populacional Volume IV. Novembro/2010

Câncer no Brasil - Dados dos Registros de Base Populacional Volume IV. Novembro/2010 Câncer no Brasil - Dados dos Registros de Base Populacional Volume IV Novembro/2010 O QUE É? Registro de Câncer de Base Populacional RCBP: são centros sistematizados de coleta, armazenamento, processamento

Leia mais

Hermann Blumenau- Complexo Educacional Curso Técnico em Saúde Bucal. Patologia Bucal. Prof. Patrícia Cé

Hermann Blumenau- Complexo Educacional Curso Técnico em Saúde Bucal. Patologia Bucal. Prof. Patrícia Cé Hermann Blumenau- Complexo Educacional Curso Técnico em Saúde Bucal Patologia Bucal Prof. Patrícia Cé No organismo, verificam-se formas de crescimento celular controladas e não controladas. A hiperplasia,

Leia mais

NEOPLASIAS DO TECIDO HEMATOPOÉTICO. Hye, 2014

NEOPLASIAS DO TECIDO HEMATOPOÉTICO. Hye, 2014 NEOPLASIAS DO TECIDO HEMATOPOÉTICO Hye, 2014 O QUE GERA A SUSPEITA DE MALIGNIDADE HEMATOLÓGICA? Falta de energia; Facilidade de sangramentos; Infecções frequentes; Emagrecimento inexplicável; INVESTIGAÇÃO

Leia mais

Orientações sobre procedimentos em Medicina Nuclear. Oncologia

Orientações sobre procedimentos em Medicina Nuclear. Oncologia Orientações sobre procedimentos em Medicina Nuclear Oncologia Este documento foi elaborado conforme orientações da Sociedade Brasileira de Biologia e Medicina Nuclear, visando aproximar ainda mais nossa

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

Patologia geral. Neoplasias- quinta aula. Alunos 4º semestre. Prof. Jane Maria Ulbrich. Prof. Adjunta do Departamento de Patologia Famed/Ufrgs

Patologia geral. Neoplasias- quinta aula. Alunos 4º semestre. Prof. Jane Maria Ulbrich. Prof. Adjunta do Departamento de Patologia Famed/Ufrgs Patologia geral Neoplasias- quinta aula Alunos 4º semestre Prof. Jane Maria Ulbrich Prof. Adjunta do Departamento de Patologia Famed/Ufrgs Material utilizado em sala de aula com alunos A doença metastática

Leia mais

CITOLOGIA ONCÓTICA CÂNCER

CITOLOGIA ONCÓTICA CÂNCER CITOLOGIA ONCÓTICA Neoplasia: crescimento desordenado de células, originando um tumor (massa de células) Tumor benigno: massa localizada de células que se multiplicam vagarosamente e se assemelham ao seu

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

SINAIS DE ALERTA DO CÂNCER INFANTIL

SINAIS DE ALERTA DO CÂNCER INFANTIL SINAIS DE ALERTA DO CÂNCER INFANTIL Cecília Fernandes Lorea Julho/2009 EPIDEMIOLOGIA 9000 casos novos/ ano no Brasil Probabilidade de 0,3% de uma criança desenvolver câncer antes dos 20 anos 1/300 indivíduos

Leia mais

AVALIAÇÃO LABORATORIAL

AVALIAÇÃO LABORATORIAL AVALIAÇÃO LABORATORIAL Escolha das análises a serem realizadas Realização da coleta de forma adequada domínio da técnica reconhecimento de eventuais erros de procedimento escolha do recipiente, acondicionamento

Leia mais

Imuno-histoquímica - aplicações

Imuno-histoquímica - aplicações Imuno-histoquímica - aplicações diagnóstico diferencial entre neoplasias indiferenciadas pela histopatologia - casos nos quais a morfologia não permite conclusão da diferenciação do tumor Ex.: carcinoma

Leia mais

Página 1 de 23 ADVERTÊNCIA Este texto não substitui o publicado no Diário Oficial da União Ministério da Saúde Secretaria de Atenção à Saúde PORTARIA Nº 420, DE 25 DE AGOSTO DE 2010 O Secretário de Atenção

Leia mais

podem desenvolver-se até atingirem um tamanho considerável antes dos sintomas se manifestarem. Por outro lado, em outras partes do cérebro, mesmo um

podem desenvolver-se até atingirem um tamanho considerável antes dos sintomas se manifestarem. Por outro lado, em outras partes do cérebro, mesmo um Um tumor é uma massa anormal em qualquer parte do corpo. Ainda que tecnicamente ele possa ser um foco de infecção (um abcesso) ou de inflamação; o termo habitualmente significa um novo crescimento anormal

Leia mais

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 Sigmund Freud ( 1856-1939, 83 anos ) durante 59 anos, mais de 20 charutos/dia

Leia mais

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos:

6- Qual é a causa do câncer? genes DNA), moléculas de RNA cromossomos ribossomos Genes: Moléculas de RNA: Ribossomos: 6- Qual é a causa do câncer? Na realidade não há apenas uma causa, mas várias causas que induzem o aparecimento do câncer. Primeiramente é importante saber que todo o câncer tem origem genética por abranger

Leia mais

GAL-IPEN citrato de gálio (67 Ga)

GAL-IPEN citrato de gálio (67 Ga) GAL-IPEN citrato de gálio (67 Ga) ATENÇÃO GAL-IPEN É PARA USO EXCLUSIVO EM RADIODIAGNÓSTICO NA MEDICINA NUCLEAR USO RESTRITO A HOSPITAIS E CLÍNICAS ESPECIALIZADAS APRESENTAÇÃO O GAL-IPEN possui as seguintes

Leia mais

E R R E C B N Â C SOR FALAS O VAM

E R R E C B N Â C SOR FALAS O VAM VAMOS FALAR SOBRE CÂNCER Câncer O que é? O câncer tem como principal característica o crescimento desordenado das células do corpo. O que diferencia os tipos de câncer, entre maligno e benigno, é a velocidade

Leia mais

c Taxas por milhão, ajustadas pela população padrão mundial, 1966 146 Câncer na Criança e no Adolescente no Brasil

c Taxas por milhão, ajustadas pela população padrão mundial, 1966 146 Câncer na Criança e no Adolescente no Brasil As taxas médias de incidência de câncer por 1.000.000 de crianças e adolescentes (0 a 18 anos), segundo sexo, faixa etária e período disponível das informações para os 20 RCBP brasileiros, são apresentadas

Leia mais

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano Síndromes Hereditários de Cancro Coloretal André Goulart Interno Cirurgia Geral 4º ano Introdução Epidemiologia CCR 2ª causa de morte Risco desenvolver CCR 6% 90% CCR após os 50 anos Incidência aumentou

Leia mais

Perda da uniformidade nas células e desarranjo estrutural tecidual

Perda da uniformidade nas células e desarranjo estrutural tecidual .Leucoplasia: (grego: leuco = branco - plasis = formação) Transformação metaplásica do epitélio escamoso estratificado não ceratinizado consistindo em aumento das camadas de ceratina. Exemplos: mucosa

Leia mais

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE São Paulo 2010 Níveis séricos e imunoexpressão tecidual do marcador CA19-9 no carcinoma

Leia mais

HEMATOLOGIA. 2010-11 3ºAno. 10ª Aula. Prof. Leonor Correia

HEMATOLOGIA. 2010-11 3ºAno. 10ª Aula. Prof. Leonor Correia HEMATOLOGIA 2010-11 3ºAno Prof. Leonor Correia 10ª Aula Hematologia 2010/2011 Tumores dos tecidos hematopoiético e linfático Classificação OMS 2008: Interesse e objectivos da classificação Neoplasias mieloproliferativas

Leia mais

COMPETÊNCIAS DO ENFERMEIRO NA DETECÇÃO PRECOCE DO CÂNCER DE PRÓSTATA NA ATENÇÃO PRIMÁRIA

COMPETÊNCIAS DO ENFERMEIRO NA DETECÇÃO PRECOCE DO CÂNCER DE PRÓSTATA NA ATENÇÃO PRIMÁRIA Trabalhos Aprovados Nº AUTOR TÍTULO CATEGORIA A 001 CÂNDIDO, E. ATUAÇÃO DO ENFERMEIRO NA PREVENÇÃO DO CÂNCER DE PRÓSTATA UROGENITAL A 002 RODRIGUES, J. C; CÂNCER DE PRÓSTATA - UMA ANÁLISE DA MORTALIDADE

Leia mais

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA Carcinomas Profª. Dra. Maria do Carmo Assunção Carcinoma tipo basal Grau 3 CK14 & CK5 = Positivo P63 pode ser positivo (mioepitelial) Triplo negativo

Leia mais

COMANDO DA AERONÁUTICA EXAME DE ADMISSÃO AO CURSO DE ADAPTAÇÃO DE MÉDICOS DA AERONÁUTICA (CAMAR 2013) LEIA COM ATENÇÃO AS INSTRUÇÕES ABAIXO.

COMANDO DA AERONÁUTICA EXAME DE ADMISSÃO AO CURSO DE ADAPTAÇÃO DE MÉDICOS DA AERONÁUTICA (CAMAR 2013) LEIA COM ATENÇÃO AS INSTRUÇÕES ABAIXO. COMANDO DA AERONÁUTICA VERSÃO B EXAME DE ADMISSÃO AO CURSO DE ADAPTAÇÃO DE MÉDICOS DA AERONÁUTICA (CAMAR 2013) ESPECIALIDADE: CANCEROLOGIA LEIA COM ATENÇÃO AS INSTRUÇÕES ABAIXO. 1. Este caderno contém

Leia mais

HOSPITAL DE CLÍNICAS DE PORTO ALEGRE EDITAL Nº 06/2007 DE PROCESSOS SELETIVOS GABARITO APÓS RECURSOS

HOSPITAL DE CLÍNICAS DE PORTO ALEGRE EDITAL Nº 06/2007 DE PROCESSOS SELETIVOS GABARITO APÓS RECURSOS 1 HOSPITAL DE CLÍNICAS DE PORTO ALEGRE EDITAL Nº 06/2007 DE PROCESSOS SELETIVOS GABARITO APÓS RECURSOS PROCESSO SELETIVO 26 MÉDICO (Oncologia) 01. A 11. E 21. C 02. C 12. D 22. E 03. D 13. B 23. B 04.

Leia mais

O que é Câncer? Estágio de Iniciação

O que é Câncer? Estágio de Iniciação O que é Câncer? O câncer é definido como um tumor maligno, mas não é uma doença única e sim um conjunto de mais de 200 patologias, caracterizado pelo crescimento descontrolado de células anormais (malignas)

Leia mais

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama Câncer de Mama Princípios Básicos História Natural Epidemiologia IZABELLA SERAPHIM PITANGA Mastologista do Núcleo da Mama O QUE É CÂNCER? Câncer é o nome dado a um conjunto de mais de 100 doenças que têm

Leia mais

Auto-imunidade Doenças auto-imunes. Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia

Auto-imunidade Doenças auto-imunes. Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia Auto-imunidade Doenças auto-imunes Sandra Bertelli Ribeiro sandrabertelliribeiro@hotmail.com Doutoranda Lab. de Imunologia Célula tronco-hematopoiética Pluripotente. - Progenitor linfóide comum - Progenitor

Leia mais

Linfomas Dr. Ricardo Bigni -Serviço de Hematologia Hospital do Câncer I/INCA

Linfomas Dr. Ricardo Bigni -Serviço de Hematologia Hospital do Câncer I/INCA Linfomas Dr. Ricardo Bigni -Serviço de Hematologia Hospital do Câncer I/INCA A Doença, ou Linfoma de Hodgkin, é uma forma de câncer que se origina nos linfonodos (gânglios) do sistema linfático, um conjunto

Leia mais

WWW.CONTEUDOJURIDICO.COM.BR

WWW.CONTEUDOJURIDICO.COM.BR Acerca das unidades e grandezas envolvidas na dosimetria e no planejamento radioterápico no Sistema Internacional de Unidades, julgue os itens a seguir. 41 Exposição é uma grandeza física definida apenas

Leia mais

Radioterapia - Notas de aula

Radioterapia - Notas de aula Disciplina: Radioterapia Faculdade e Escola Técnica Novo Rumo Rua Paraíba, 75 - Bairro Funcionários CEP: 30130-140 - Belo Horizonte - MG Radioterapia - Notas de aula Prof. Arnie Verde Nolasco Apostila

Leia mais

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Departamento de Biologia Celular e Molecular Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Tema: Bases Moleculares do Câncer e Ação A

Leia mais

ASPECTOS EPIDEMIOLÓGICOS DO CÂNCER NO MUNICÍPIO DE SÃO PAULO FATORES DE RISCO

ASPECTOS EPIDEMIOLÓGICOS DO CÂNCER NO MUNICÍPIO DE SÃO PAULO FATORES DE RISCO MINISTÉRIO DA SAÚDE INSTITUTO NACIONAL DO CÂNCER/CONPREV SECRETARIA DE ESTADO DA SAÚDE / FUNDAÇÃO ONCOCENTRO DE SÃO PAULO SECRETARIA MUNICIPAL DA SAÚDE / PRO-AIM FACULDADE DE SAÚDE PÚBLICA DA UNIVERSIDADE

Leia mais

Licenciatura em Ciências Biomédicas Laboratoriais. Oncobiologia 2016/17. Aula 6. Inês Rodrigues Gab. 2.

Licenciatura em Ciências Biomédicas Laboratoriais. Oncobiologia 2016/17. Aula 6. Inês Rodrigues Gab. 2. Licenciatura em Ciências Biomédicas Laboratoriais Oncobiologia 2016/17 Aula 6 Inês Rodrigues igrodrigues@ualg.pt Gab. 2.06 na ESSUAlg Sumário Imunidade Tumoral: Especificidade da Resposta Imune tumoral

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Acerca da epidemiologia e das bases genéticas do câncer pediátrico, julgue os itens a seguir. 41 As leucemias e linfomas são os tumores malignos mais frequentes em lactentes, enquanto os sarcomas ósseo

Leia mais

AIDS Síndrome da Imunodeficiência Humana

AIDS Síndrome da Imunodeficiência Humana AIDS Síndrome da Imunodeficiência Humana Vírus da imunodeficiência humana (HIV) gp120 gp41 p17 Dupla camada de lipídeos p24 Material genético e enzimas Estrutura do genoma do HIV-1 vpr rev rev gag vif

Leia mais

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO Ana Flavia Damasceno Luiz Gonzaga Porto Introdução É realizada a avaliação de um grupo de pacientes com relação a sua doença. E através dele

Leia mais

DOENÇAS LINFÁTICAS NOS GRANDES ANIMAIS. Prof. Adjunto III Dr. Percilio Brasil dos Passos perciliobrasil@hotmail.com

DOENÇAS LINFÁTICAS NOS GRANDES ANIMAIS. Prof. Adjunto III Dr. Percilio Brasil dos Passos perciliobrasil@hotmail.com DOENÇAS LINFÁTICAS NOS GRANDES ANIMAIS Prof. Adjunto III Dr. Percilio Brasil dos Passos perciliobrasil@hotmail.com DISTÚRBIOS LINFOPROLIFERATIVOS E MIELOPROLIFERATIVOS Prof. Adjunto III Dr. Percilio Brasil

Leia mais